Detection of Multiple Intracellular Bacterial Pathogens in Haemaphysalis flava Ticks Collected from Hedgehogs in Central China
Abstract
1. Introduction
2. Materials and Methods
2.1. Tick Samples
2.2. PCR Amplification of Tickborne Pathogens in Ticks
2.3. Phylogenetic Analysis
2.4. Statistical Analysis
3. Results
3.1. Tick Species
3.2. Phylogenic Analysis of Different Tickborne Intracellular Bacteria
3.3. Infection Rate of Tickborne Intracellular Bacteria in Ticks
4. Discussion
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Eisen, L. Pathogen transmission in relation to duration of attachment by Ixodes scapularis ticks. Ticks Tick Borne Dis. 2018, 9, 535–542. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Qiu, J.Z.; Luo, Z.Q. Legionella and Coxiella effectors: Strength in diversity and activity. Nat. Rev. Microbiol. 2017, 15, 591–605. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ben Said, M.; Belkahia, H.; Messadi, L. Anaplasma spp. in North Africa: A review on molecular epidemiology, associated risk factors and genetic characteristics. Ticks Tick Borne Dis. 2018, 9, 543–555. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Boulanger, N.; Boyer, P.; Talagrand-Reboul, E.; Hansmann, Y. Ticks and tick-borne diseases. Med. Mal. Infect. 2019, 49, 87–97. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Machado-Ferreira, E.; Vizzoni, V.F.; Balsemao-Pires, E.; Moerbeck, L.; Gazeta, G.S.; Piesman, J.; Voloch, C.M.; Soares, C.A.G. Coxiella symbionts are widespread into hard ticks. Parasitol. Res. 2016, 115, 4691–4699. [Google Scholar] [CrossRef] [Scilit]
- El-Mahallawy, H.S.; Lu, G.; Kelly, P.; Xu, D.; Li, Y.; Fan, W.; Wang, C. Q fever in China: A systematic review, 1989–2013. Epidemiol. Infect. 2015, 143, 673–681. [Google Scholar] [CrossRef] [Scilit]
- Li, J.B.; Hu, W.; Wu, T.; Li, H.B.; Hu, W.F.; Sun, Y.; Chen, Z.; Shi, Y.L.; Zong, J.; Latif, A.; et al. Japanese spotted fever in Eastern China, 2013. Emerg. Infect. Dis. 2018, 24, 2107–2109. [Google Scholar] [CrossRef] [Scilit]
- Jia, N.; Zheng, Y.C.; Ma, L.; Huo, Q.B.; Ni, X.B.; Jiang, B.G.; Chu, Y.L.; Jiang, R.R.; Jiang, J.F.; Cao, W.C. Human infections with Rickettsia raoultii, China. Emerg. Infect. Dis. 2014, 20, 866–868. [Google Scholar] [CrossRef] [Scilit]
- Jung, M.; Kho, J.W.; Lee, W.G.; Roh, J.Y.; Lee, D.H. Seasonal occurrence of Haemaphysalis longicornis (Acari: Ixodidae) and Haemaphysalis flava, vectors of severe fever with thrombocytopenia syndrome (SFTS) in South Korea. J. Med. Entomol. 2019, 56, 1139–1144. [Google Scholar] [CrossRef] [Scilit]
- Li, Z.B.; Cheng, T.Y.; Xu, X.L.; Song, L.L.; Liu, G.H. Genetic variation in mitochondrial genes of the tick Haemaphysalis flava collected from wild hedgehogs in China. Exp. Appl. Acarol. 2017, 71, 131–137. [Google Scholar] [CrossRef] [Scilit]
- Chae, J.B.; Kang, J.G.; Kim, H.C.; Chong, S.T.; Lee, I.Y.; Shin, N.S.; Chae, J.S. Identification of tick species collected from wild boars and habitats of wild boars and domestic pigs in the Republic of Korea. Korean J. Parasitol. 2017, 55, 185–191. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Duan, D.; Cheng, T. Determination of the microbial community features of Haemaphysalis flava in different developmental stages by high-throughput sequencing. J. Basic Microbiol. 2017, 57, 302–308. [Google Scholar] [CrossRef] [Scilit]
- Kim, H.C.; Han, S.H.; Chong, S.T.; Klein, T.A.; Choi, C.Y.; Nam, H.Y.; Chae, H.Y.; Lee, H.; Ko, S.; Kang, J.G.; et al. Ticks collected from selected mammalian hosts surveyed in the Republic of Korea during 2008–2009. Korean J. Parasitol. 2011, 49, 331–335. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Cheng, W.Y.; Zhao, G.H.; Jia, Y.Q.; Bian, Q.Q.; Du, S.Z.; Fang, Y.Q.; Qi, M.Z.; Yu, S.K. Characterization of Haemaphysalis flava (Acari: Ixodidae) from Qingling subspecies of Giant Panda (Ailuropoda melanoleuca qinlingensis) in Qinling Mountains (Central China) by morphology and molecular markers. PLoS ONE 2013, 8, e69793. [Google Scholar] [CrossRef] [Scilit]
- Deng, G.F. Economic Insect Fauna of China; Science Press: Beijing, China, 1991; Volume 39, p. 265. [Google Scholar]
- Shi, X.Q.; Zhou, Z.Y. The discovery of the Haemaphysalis flava on hedgehog surface in Shanghai. Shanghai J. Anim. Husb. Vet. Med. 1991, 4, 1. [Google Scholar]
- Ejiri, H.; Lim, C.K.; Isawa, H.; Yamaguchi, Y.; Fujita, R.; Takayama-Ito, M.; Kuwata, R.; Kobayashi, D.; Horiya, M.; Posadas-Herrera, G.; et al. Isolation and characterization of Kabuto Mountain virus, a new tick-borne phlebovirus from Haemaphysalis flava ticks in Japan. Virus Res. 2018, 244, 252–261. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Fujita, R.; Ejiri, H.; Lim, C.K.; Noda, S.; Yamauchi, T.; Watanabe, M.; Kobayashi, D.; Takayama-Ito, M.; Murota, K.; Posadas-Herrera, G.; et al. Isolation and characterization of Tarumizu tick virus: A new coltivirus from Haemaphysalis flava ticks in Japan. Virus Res. 2017, 242, 131–140. [Google Scholar] [CrossRef] [Scilit]
- Hong, S.H.; Kim, S.Y.; Song, B.G.; Rho, J.R.; Cho, C.R.; Kim, C.N.; Um, T.H.; Kwak, Y.G.; Cho, S.H.; Lee, S.E. Detection and characterization of an emerging type of Babesia sp. similar to Babesia motasi for the first case of human babesiosis and ticks in Korea. Emerg. Microbes Infect. 2019, 8, 869–878. [Google Scholar] [CrossRef] [Scilit]
- Jo, Y.S.; Kang, J.G.; Chae, J.B.; Cho, Y.K.; Shin, J.H.; Jheong, W.H.; Chae, J.S. Prevalence of severe fever with thrombocytopenia syndrome virus in ticks collected from National Parks in Korea. Vector Borne Zoonotic Dis. 2019, 19, 284–289. [Google Scholar] [CrossRef] [Scilit]
- Kang, J.G.; Ko, S.; Kim, H.C.; Chong, S.T.; Klein, T.A.; Chae, J.B.; Jo, Y.S.; Choi, K.S.; Yu, D.H.; Park, B.K.; et al. Prevalence of anaplasma and Bartonella spp. in ticks collected from Korean water deer (Hydropotes inermis argyropus). Korean J. Parasitol. 2016, 54, 87–91. [Google Scholar] [CrossRef] [Scilit]
- Suzuki, J.; Hashino, M.; Matsumoto, S.; Takano, A.; Kawabata, H.; Takada, N.; Andoh, M.; Oikawa, Y.; Kajita, H.; Uda, A.; et al. Detection of Francisella tularensis and analysis of bacterial growth in ticks in Japan. Lett. Appl. Microbiol. 2016, 63, 240–246. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Takhampunya, R.; Kim, H.C.; Chong, S.T.; Korkusol, A.; Tippayachai, B.; Davidson, S.A.; Petersen, J.M.; Klein, T.A. Francisella-like endosymbiont detected in Haemaphysalis ticks (Acari: Ixodidae) from the Republic of Korea. J. Med. Entomol. 2017, 54, 1735–1742. [Google Scholar] [CrossRef] [Scilit]
- Yun, S.M.; Lee, Y.J.; Choi, W.; Kim, H.C.; Chong, S.T.; Chang, K.S.; Coburn, J.M.; Klein, T.A.; Lee, W.J. Molecular detection of severe fever with thrombocytopenia syndrome and tick-borne encephalitis viruses in ixodid ticks collected from vegetation, Republic of Korea, 2014. Ticks Tick Borne Dis. 2016, 7, 970–978. [Google Scholar] [CrossRef] [Scilit]
- Kim, J.Y.; Kwak, Y.S.; Lee, I.Y.; Yong, T.S. Molecular detection of Toxoplasma Gondii in Haemaphysalis ticks in Korea. Korean J. Parasitol. 2020, 58, 327. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lu, M.; Tian, J.H.; Yu, B.; Guo, W.P.; Holmes, E.C.; Zhang, Y.Z. Extensive diversity of rickettsiales bacteria in ticks from Wuhan, China. Ticks Tick Borne Dis. 2017, 8, 574–580. [Google Scholar] [CrossRef] [Scilit]
- Zheng, W.Q.; Xuan, X.N.; Fu, R.L.; Tao, H.Y.; Liu, Y.Q.; Liu, X.Q.; Li, D.M.; Ma, H.M.; Chen, H.Y. Tick-borne pathogens in Ixodid ticks from Poyang lake region, Southeastern China. Korean J. Parasitol. 2018, 56, 589–596. [Google Scholar] [CrossRef] [Scilit]
- Levy, S. The Lyme disease debate: Host biodiversity and human disease risk. Environ. Health Perspect. 2013, 121, A120–A125. [Google Scholar] [CrossRef] [Scilit]
- Gong, X.Q.; Xiao, X.; Liu, J.W.; Han, H.J.; Qin, X.R.; Lei, S.C.; Yu, X.J. Occurrence and genotyping of Coxiella burnetii in hedgehogs in China. Vector Borne Zoonotic Dis. 2020, 20, 580–585. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Luo, L.M.; Zhao, L.; Wen, H.L.; Zhang, Z.T.; Liu, J.W.; Fang, L.Z.; Xue, Z.F.; Ma, D.Q.; Zhang, X.S.; Ding, S.J.; et al. Haemaphysalis longicornis ticks as reservoir and vector of severe fever with thrombocytopenia syndrome virus in China. Emerg. Infect. Dis. 2015, 21, 1770–1776. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Li, L.H.; Zhu, D.; Zhang, C.C.; Zhang, Y.; Zhou, X.N. Experimental transmission of Babesia microti by Rhipicephalus haemaphysaloides. Parasites Vectors 2016, 9, 231. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Han, H.J.; Liu, J.W.; Wen, H.L.; Qin, X.R.; Zhao, M.; Wang, L.J.; Zhou, C.M.; Qi, R.; Yu, H.; Yu, X.J. Babesia vesperuginis in insectivorous bats from China. Parasites Vectors 2018, 11, 317. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Chitanga, S.; Simulundu, E.; Simuunza, M.C.; Changula, K.; Qiu, Y.; Kajihara, M.; Nakao, R.; Syakalima, M.; Takada, A.; Mweene, A.S.; et al. First molecular detection and genetic characterization of Coxiella burnetii in Zambian dogs and rodents. Parasites Vectors 2018, 11, 40. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kawahara, M.; Rikihisa, Y.; Lin, Q.; Isogai, E.; Tahara, K.; Itagaki, A.; Hiramitsu, Y.; Tajima, T. Novel genetic variants of Anaplasma phagocytophilum, Anaplasma bovis, Anaplasma centrale, and a novel Ehrlichia sp. in wild deer and ticks on two major islands in Japan. Appl. Environ. Microbiol. 2006, 72, 1102–1109. [Google Scholar] [CrossRef] [Scilit]
- Weisburg, W.G.; Barns, S.M.; Pelletier, D.A.; Lane, D.J. 16S ribosomal DNA amplification for phylogenetic study. J. Bacteriol. 1991, 173, 697–703. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Parola, P.; Roux, V.; Camicas, J.L.; Baradji, I.; Brouqui, P.; Raoult, D. Detection of ehrlichiae in African ticks by polymerase chain reaction. Trans. R. Soc. Trop. Med. Hyg. 2000, 94, 2. [Google Scholar] [CrossRef] [Scilit]
- Zhang, X.; Geng, J.; Du, J.; Wang, Y.; Qian, W.; Zheng, A.; Zou, Z. Molecular identification of Rickettsia species in Haemaphysalis ticks collected from Southwest China. Vector Borne Zoonotic Dis. 2018, 18, 663–668. [Google Scholar] [CrossRef] [Scilit]
- Huang, Y.; Zhao, L.; Zhang, Z.; Liu, M.; Xue, Z.; Ma, D.; Sun, X.; Sun, Y.; Zhou, C.; Qin, X.; et al. Detection of a novel Rickettsia from Leptotrombidium scutellare mites (Acari: Trombiculidae) from Shandong of China. J. Med. Entomol. 2017, 54, 544–549. [Google Scholar] [CrossRef] [Scilit]
- Roux, V.; Fournier, P.E.; Raoult, D. Differentiation of spotted fever group rickettsiae by sequencing and analysis of restriction fragment length polymorphism of PCR-amplified DNA of the gene encoding the protein rOmpA. J. Clin. Microbiol. 1996, 34, 2058–2065. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhuang, L.; Du, J.; Cui, X.M.; Li, H.; Tang, F.; Zhang, P.H.; Hu, J.G.; Tong, Y.G.; Feng, Z.C.; Liu, W. Identification of tick-borne pathogen diversity by metagenomic analysis in Haemaphysalis longicornis from Xinyang, China. Infect. Dis. Poverty 2018, 7, 45. [Google Scholar] [CrossRef] [Scilit]
- Luo, L.M.; Sun, J.M.; Yan, J.B.; Wang, C.W.; Zhang, Z.T.; Zhao, L.; Han, H.J.; Tong, Z.D.; Liu, M.M.; Wu, Y.Y.; et al. Detection of a novel Ehrlichia Species in Haemaphysalis longicornis tick from China. Vector Borne Zoonotic Dis. 2016, 16, 363–367. [Google Scholar] [CrossRef] [Scilit]
- Singh, K.R.; Pavri, K.; Anderson, C.R. Experimental transovarial transmission of Kyasanur forest disease virus in Haemaphysalis spinigera. Nature 1963, 199, 513. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Burgdorfer, W.; Brinton, L.P. Mechanisms of transovarial infection of spotted fever Rickettsiae in ticks. Ann. N. Y. Acad. Sci. 1975, 266, 61–72. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Starkey, L.A.; Barrett, A.W.; Beall, M.J.; Chandrashekar, R.; Thatcher, B.; Tyrrell, P.; Little, S.E. Persistent Ehrlichia ewingii infection in dogs after natural tick infestation. J. Vet. Intern. Med. 2015, 29, 552–555. [Google Scholar] [CrossRef] [Scilit]
- Stuen, S.; Nevland, S.; Moum, T. Fatal cases of tick-borne fever (TBF) in sheep caused by several 16S rRNA gene variants of Anaplasma phagocytophilum. Ann. N. Y. Acad. Sci. 2003, 990, 10. [Google Scholar] [CrossRef] [Scilit]
- Tay, S.T.; Koh, F.X.; Kho, K.L.; Sitam, F.T. Rickettsial infections in monkeys, Malaysia. Emerg. Infect. Dis. 2015, 21, 545–547. [Google Scholar] [CrossRef] [Scilit]
- Sun, J.M.; Lin, J.F.; Gong, Z.Y.; Chang, Y.; Ye, X.D.; Gu, S.P.; Pang, W.L.; Wang, C.W.; Zheng, X.H.; Hou, J.; et al. Detection of spotted fever group Rickettsiae in ticks from Zhejiang Province, China. Exp. Appl. Acarol. 2015, 65, 403–411. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Qin, X.R.; Han, H.J.; Han, F.J.; Zhao, F.M.; Zhang, Z.T.; Xue, Z.F.; Ma, D.Q.; Qi, R.; Zhao, M.; Wang, L.J.; et al. Rickettsia japonica and novel Rickettsia species in ticks, China. Emerg. Infect. Dis. 2019, 25, 992–995. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wen, J.; Jiao, D.; Wang, J.H.; Yao, D.H.; Liu, Z.X.; Zhao, G.; Ju, W.D.; Cheng, C.; Li, Y.J.; Sun, Y. Rickettsia raoultii, the predominant Rickettsia found in Dermacentor silvarum ticks in China–Russia border areas. Exp. Appl. Acarol. 2014, 63, 579–585. [Google Scholar] [CrossRef] [Scilit]
- Guo, L.P.; Mu, L.M.; Xu, J.; Jiang, S.H.; Wang, A.D.; Chen, C.F.; Guo, G.; Zhang, W.J.; Wang, Y.Z. Rickettsia raoultii in Haemaphysalis erinacei from marbled polecats, China-Kazakhstan border. Parasites Vectors 2015, 8, 461. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Dong, Z.H.; Yang, Y.C.; Wang, Q.; Xie, S.S.; Zhao, S.S.; Tan, W.B.; Yuan, W.M.; Wang, Y.Z. A case with neurological abnormalities caused by Rickettsia raoultii in northwestern China. BMC Infect. Dis. 2019, 19, 796. [Google Scholar] [CrossRef] [Scilit]
- Liu, H.; Liang, X.T.; Wang, H.J.; Sun, X.T.; Bai, X.; Hu, B.; Shi, N.; Wang, N.; Zhang, X.L.; Huang, L.Z.; et al. Molecular evidence of the spotted fever group Rickettsiae in ticks from Yunnan Province, Southwest China. Exp. Appl. Acarol. 2020, 80, 339–348. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Gaowa, W.; Yin, X.H.; Guo, S.C.; Ding, C.L.; Cao, M.Z.; Kawabata, H.; Sato, K.; Ando, S.; Fujita, H.; Kawamori, F.; et al. Spotted fever group Rickettsiae in Inner Mongolia, China, 2015–2016. Emerg. Infect. Dis. 2018, 24, 2105–2107. [Google Scholar]
- Gaywee, J.; Sunyakumthorn, P.; Rodkvamtook, W.; Ruang-Areerate, T.; Mason, C.J.; Sirisopana, N. Human infection with Rickettsia sp. related to R. japonica, Thailand. Emerg. Infect. Dis. 2007, 13, 671–673. [Google Scholar] [CrossRef] [Scilit]
- Jiang, J.; Choi, Y.J.; Kim, J.; Kim, H.C.; Klein, T.A.; Chong, S.T.; Richards, A.L.; Park, H.J.; Shin, S.H.; Song, D.; et al. Distribution of Rickettsia spp. in ticks from Northwestern and Southwestern Provinces, Republic of Korea. Korean J. Parasitol. 2019, 57, 161–166. [Google Scholar] [CrossRef] [Scilit]
- Seo, M.G.; Kwon, O.D.; Kwak, D. High prevalence of Rickettsia raoultii and associated pathogens in canine ticks, South Korea. Emerg. Infect. Dis. 2020, 26, 2530–2532. [Google Scholar] [CrossRef] [Scilit]
- Ishikura, M.; Ando, S.; Shinagawa, Y.; Matsuura, K.; Hasegawa, S.; Nakayama, T.; Fujita, H.; Watanabe, M. Phylogenetic analysis of spotted fever group rickettsiae based on gltA, 17-kDa, and rOmpA genes amplified by nested PCR from ticks in Japan. Microbiol. Immunol. 2003, 47, 823–832. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Li, W.; Liu, L.; Jiang, X.; Guo, X.; Garnier, M.; Raoult, D.; Parola, P. Molecular identification of spotted fever group Rickettsiae in ticks collected in central China. Clin. Microbiol. Infect. 2009, 15, 279–280. [Google Scholar] [CrossRef] [Scilit]
- Fournier, P.E.; Fujita, H.; Takada, N.; Raoult, D. Genetic identification of rickettsiae isolated from ticks in Japan. J. Clin. Microbiol. 2002, 40, 2176–2181. [Google Scholar] [CrossRef] [Scilit]




| Organisms | Primary/Nested | Primers | Primer Sequences | Target Gene | Amplicon Size | Reference |
|---|---|---|---|---|---|---|
| Coxiella burnetti | Primary | Omp1 | AGTAGAAGCATCCCAAGCATTG | omp | 438 bp | [32] |
| Omp2 | TGCCTGCTAGCTGTAACGATTG | |||||
| Nested | Omp3 | GAAGCGCAACAAGAAGAACA | ||||
| Omp4 | TGGAAGTTATCACGCAGTTG | |||||
| Primary | BicdF1 | CGGAGTTAACCGGAGTATCCA | icd | 651 bp | [33] | |
| BicdR1 | CCGTGAATTTCATGATGTTACCTTT | |||||
| Nested | BicdF2 | AGTTAACCGGAGTATCCATC | This study | |||
| BicdR2 | CTAAACGGCTCGTGCCTTCT | |||||
| Anaplasma | Primary | EC9 | TACCTTGTTACGACTT | rrs | 477 bp | [34] |
| EC12A | TGATCCTGGCTCAGAACGAACG | |||||
| Nested | EM87F | GGTTCGCTATTAGTGGCAGA | ||||
| EM584R | CAGTATTAAAAGCCGCTCCA | |||||
| Primary | fD1 | AGAGTTTGATCCTGGCTCAG | rrs | 742–1426 bp | [35] | |
| Rp2 | ACGGCTACCTTGTTACGACTT | |||||
| Nested | EHR16SD | GGTACCY * ACAGAAGAAGTCC | [36] | |||
| EHR16SR | TAGCACTCATCGTTTACAGC | |||||
| Primary | agroELwf | TTTGCCAGTTTTGGAAGGCG | groEL | 473 bp | This study | |
| agroELwr | TTTCAGCGGATCCATCACCC | |||||
| Nested | agroELnf | TGAGGGTGAAGCATTGAGCA | ||||
| agroELnr | AGAGTGTACAGCAGAGCAGC | |||||
| Ehrlichia | Primary | EC9 | TACCTTGTTACGACTT | rrs | 477 bp 538 bp | [34] |
| EC12A | TGATCCTGGCTCAGAACGAACG | |||||
| Nested | EM87F | GGTTCGCTATTAGTGGCAGA | ||||
| EM584R | CAGTATTAAAAGCCGCTCCA | |||||
| Nested | HF51F | AAGTCGAACGGACAATTACC | ||||
| HF954R | GTTAGGGGGATACGACCTTC | |||||
| Primary | e-gltawf | TTCTCAGGAATACATGCCACC | gltA | 411 bp | This study | |
| e-gltawr | ACCATTGAGCAGACCAGCCA | |||||
| Nested | e-gltanf | AATTGCAGGGATAGTGGCAA | ||||
| e-gltanr | CTGTGGCCAAAACCCATCAA | |||||
| Rickettsia | Primary | R17F1 | TTTACAAAATTCTAAAAACCAT | 17-kDa protein gene | 410 bp | [37] |
| RR | TCAATTCACAACTTGCCATT | |||||
| Nested | RrF2 | GCTCTTGCAACTTCTATGTT | ||||
| RrR | TCAATTCACAACTTGCCATT | |||||
| Primary | S1 | TGATCCTGGCTCAGAACGAAC | rrs | 1317 bp | [38] | |
| S2 | TAAGGAGGTAATCCAGCCGC | |||||
| Nested | S3 | AACACATGCAAGTCGRACGG | ||||
| S4 | GGCTGCCTCTTGCGTTAGCT | |||||
| Primary | glta1 | TGATCCTGGCTCAGAACGAAC | gltA | 667 bp | This study | |
| glta2 | TAAGGAGGTAATCCAGCCGC | |||||
| Nested | glta3 | AACACATGCAAGTCGRACGG | ||||
| glta4 | GGCTGCCTCTTGCGTTAGCT | |||||
| Rr190.70p | ATGGCGAATATTTCTCCAAAA | ompA | 631 bp | [39] | ||
| Rr190.701n | GTTCCGTTAATGGCAGCATCT | |||||
| R. raoultii | Primary | Rglta1 | ATGACCAATGAAAATAATAAT | gltA | 341 bp | [40] |
| Rglta2 | CTTATACTCTCTATGTACA | |||||
| Nested | Rglta3 | GGGGACCTGCTCACGGCGG | ||||
| Rglta4 | ATTGCAAAAAGTACAGTGAACA |
| Tick Species | Year of Tick Collection | Pathogens | Egg Batches (%) n = 20 | Dead Engorged Females (%) n = 24 | Molted Adults (%) n = 81 | Total % n = 125 | |
|---|---|---|---|---|---|---|---|
| MIR | MAR | ||||||
| Haemaphysalis flava | 2018 | Anaplasma bovis | 0 | 20.8 | 0 | 0 | 4 |
| Haemaphysalis flava | 2018 | Coxiella burnetti | 0 | 12.5 | 1.2 | 8.6 | 3.2 |
| Haemaphysalis flava | 2018 | Ehrlichia ewingii | 0 | 37.5 | 3.7 | 25.9 | 9.6 |
| Haemaphysalis flava | 2018 | Rickettsia raoultii | 5 | 0 | 2.5 | 17.3 | 2.4 |
| Haemaphysalis flava | 2018 | Rickettsia japonica | 0 | 12.5 | 1.2 | 8.6 | 3.2 |
| Total | 5 | 83.3 | 8.6 | 60.5 | 22.4 | ||
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Fang, L.-Z.; Lei, S.-C.; Yan, Z.-J.; Xiao, X.; Liu, J.-W.; Gong, X.-Q.; Yu, H.; Yu, X.-J. Detection of Multiple Intracellular Bacterial Pathogens in Haemaphysalis flava Ticks Collected from Hedgehogs in Central China. Pathogens 2021, 10, 115. https://doi.org/10.3390/pathogens10020115
Fang L-Z, Lei S-C, Yan Z-J, Xiao X, Liu J-W, Gong X-Q, Yu H, Yu X-J. Detection of Multiple Intracellular Bacterial Pathogens in Haemaphysalis flava Ticks Collected from Hedgehogs in Central China. Pathogens. 2021; 10(2):115. https://doi.org/10.3390/pathogens10020115
Chicago/Turabian StyleFang, Li-Zhu, Si-Cong Lei, Zhi-Jian Yan, Xiao Xiao, Jian-Wei Liu, Xiao-Qing Gong, Hao Yu, and Xue-Jie Yu. 2021. "Detection of Multiple Intracellular Bacterial Pathogens in Haemaphysalis flava Ticks Collected from Hedgehogs in Central China" Pathogens 10, no. 2: 115. https://doi.org/10.3390/pathogens10020115
APA StyleFang, L.-Z., Lei, S.-C., Yan, Z.-J., Xiao, X., Liu, J.-W., Gong, X.-Q., Yu, H., & Yu, X.-J. (2021). Detection of Multiple Intracellular Bacterial Pathogens in Haemaphysalis flava Ticks Collected from Hedgehogs in Central China. Pathogens, 10(2), 115. https://doi.org/10.3390/pathogens10020115
