Next Article in Journal
Neuropathological Changes in Nakalanga Syndrome—A Case Report
Next Article in Special Issue
Suitability of GWAS as a Tool to Discover SNPs Associated with Tick Resistance in Cattle: A Review
Previous Article in Journal
SARS-CoV-2: Outline, Prevention, and Decontamination
Previous Article in Special Issue
A Francisella tularensis Chitinase Contributes to Bacterial Persistence and Replication in Two Major U.S. Tick Vectors
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Detection of Multiple Intracellular Bacterial Pathogens in Haemaphysalis flava Ticks Collected from Hedgehogs in Central China

1
State Key Laboratory of Virology, School of Health Sciences, Wuhan University, Wuhan 430071, China
2
The First Affiliated Hospital, Sun Yat-sen University, Guangzhou 510000, China
3
Sixth People’s Hospital, Qingdao 266000, China
4
Lab Animal Research Center, Hubei University of Chinese Medicine, Wuhan 430000, China
*
Author to whom correspondence should be addressed.
These authors contributed equally to this work.
Pathogens 2021, 10(2), 115; https://doi.org/10.3390/pathogens10020115
Submission received: 30 November 2020 / Revised: 3 January 2021 / Accepted: 15 January 2021 / Published: 23 January 2021

Abstract

Tickborne intracellular bacterial pathogens including Anaplasma, Coxiella burnetti, Ehrlichia, and Rickettsia cause emerging infectious diseases worldwide. PCR was used to amplify the genes of these pathogens in Haemaphysalis flava ticks collected from hedgehogs in Central China. Among 125 samples including 20 egg batches, 24 engorged females, and 81 molted male and female adult ticks, the DNA sequences and phylogenetic analysis showed that the minimum infection rate of the ticks was 4% (5/125) for A. bovis, 3.2% (4/125) for C. burnetti, 9.6%, (12/125) for E. ewingii, and 5.6% for Rickettsia including R. japonica (3.2%, 4/125) and R. raoultii (2.4%, 3/125), respectively. The prevalence of these pathogens was significantly higher in dead engorged females (83.3%, 20/24) than in eggs (5%, 1/20) and molted ticks (8.6%, 7/81). Our study indicated that H. flava ticks could be infected with multiple species of tickborne pathogens including Anaplasma, C. burnetti, Ehrlichia, and Rickettsia in Central China, and the prevalence of these pathogens was reduced during transovarial and transstadial transmission in ticks, suggesting that ticks may not be real reservoirs but only vectors for these tickborne pathogens.

1. Introduction

Tickborne intracellular bacteria including Anaplasma spp., Ehrlichia spp., Coxiella burnetti, and Rickettsia spp. cause severe human diseases [1,2,3,4]. Ixodidae, the hard body ticks, play an important role in the maintenance and transmission of these tickborne pathogens [5]. Approximately 100 Ixodidae species have been identified in China. Because of the vast territory, complex geography, and different climates of China, tickborne diseases are prevalent in most parts of China and pose a serious public health threat [6,7,8].
Haemaphysalis flava ticks are widely distributed throughout Asia including in China, Japan, South Korea, and Vietnam [9,10,11,12]. Hosts of H. flava include domesticated animals such as horses (Equus caballus), pigs (Sus scrofa domesticus), dogs (Canis lupus familiaris), sheep (Ovis aries), cattle (Bos taurus), and wild animals such as hedgehogs (Erinaceinae), pandas (Ailuropoda melanoleuca), Siberian chipmunks (Eutamias sibiricus), Raccoon dogs (Nyctereutes procyonoides), water deer (Hydropotes inermis), and eastern roe deer (Capreolus pygargus) [13,14,15,16]. Previous studies had demonstrated that H. flava were positive to bacterial pathogens such as Anaplasma bovis, Borrelia spp., Batonella, Francisella tularensis, Rickettsia japonica, parasites such as Babesia spp. and Toxoplasma gondii, and viruses such as severe fever with thrombocytopenia virus and tickborne encephalitis virus [17,18,19,20,21,22,23,24,25]. These studies about H. flava tickborne pathogens were mainly carried out in Japan and South Korea. In China, only two studies in the Jiangxi and Hubei Provinces demonstrated that H. flava were positive to R slovaca, R. japonica, and unclassified Ehrlichia species [26,27].
The Haemaphysalis flava tick is widely distributed, and it is important to know the pathogens carried by H. flava in China. In this study, we investigated the prevalence of intracellular bacterial pathogens in H. flava ticks collected from hedgehogs in Hubei Province in Central China.

2. Materials and Methods

2.1. Tick Samples

Ticks were pulled parallel to the skin surface by using fine-tipped tweezers from hedgehogs (Erinaceus amurensis) collected in October 2018 [28]. Hedgehogs were captured from forests near the cesspools in Xianning City, Hubei Province, China [29]. Xianning is located at 29°87′ north latitude and 114°28′ east longitude in Central China. The temperature ranges from −7 °C to 40 °C, with an annual average of 16.8 °C. All ticks were morphologically identified as H. flava [15], and nine ticks were randomly selected to amplify the 16S rRNA gene (rrs) with PCR for species confirmation as previously described [30]. Engorged ticks were kept in an incubator with 85% relative humidity at 25 °C for oviposition or molting [31].

2.2. PCR Amplification of Tickborne Pathogens in Ticks

For the detection of tickborne bacteria, the egg batches from each female were processed together, the dead engorged females were processed individually, and molted ticks (females and males) were processed in groups of six or seven ticks. Ticks were washed with distilled water and dried before DNA was extracted with the AllPrep DNA Mini Kit (Qiagen, Hilden, Germany) following the manufacturer’s instructions. Tick DNA was dissolved in 100 μL of DNase free water and stored at −80 °C.
Tick DNA was used for the PCR amplification of tickborne pathogens. The primers listed in Table 1 were used to amplify the Anaplasma 16S rRNA gene (rrs) and heat shock protein GroEL (groEL) genes, the C. burnetti outer membrane protein (omp) gene and isocitrate dehydrogenase (icd) gene, the Ehrlichia rrs and GltA (gltA) genes, and the Rickettsia 17-kDa protein gene, outer membrane protein A (OmpA) gene, gltA and rrs. The PCR cycles of outer and inner primers for each gene were one cycle of 5 min at 95 °C, followed by 35 cycles of 1 min at 95 °C, 1 min at 55 °C, and 1 min at 72 °C, and a final extension step of 10 min at 72 °C. Nuclease-free water was used as negative controls for each experiment.
PCR products were analyzed using 1.2% agarose gel electrophoresis and were detected with ethidium bromide staining under UV light. PCR products with the expected size were excised from the gels and extracted with a Gel Extraction Kit (Omega, Norcross, Georgia). The purified PCR products were cloned into PMD 19-T vectors (TaKaRa, Shiga, Japan), and the recombinant plasmids were sequenced bidirectionally.

2.3. Phylogenetic Analysis

The sequence chromatograms and analysis were examined with Chromas and BLAST programs (http://blast.ncbi.nlm.nih.gov/Blast.cgi), respectively. Sequences were aligned and trimmed with MEGA7 (Philadelphia, PA, USA), and phylogenetic trees were constructed with MEGA7 using the maximum-likelihood method, with nucleotide sequences and bootstrap values that were calculated with 1000 replicates [38,41]. Only bootstrap values >50% were shown.

2.4. Statistical Analysis

All the statistical analyses was performed by Fisher’s exact test with SPSS (version 17.0) (Armonk, NY, USA), and p < 0.05 was considered to be a statistically significant difference.

3. Results

3.1. Tick Species

A total of 125 ticks was collected from 15 hedgehogs, out of which 44 ticks were engorged adult females and 81 ticks were engorged nymphs. Of the engorged females, 20 females had oviposited and 24 females died before oviposition. All 81 engorged nymphs had molted into adult ticks regardless of sex. Ticks were morphologically identified as H. flava and confirmed with PCR amplification and DNA sequencing of the rrs gene.

3.2. Phylogenic Analysis of Different Tickborne Intracellular Bacteria

Rickettsia: Rickettsia sequences were obtained from seven ticks and tick pools by PCR with primers of the 17-kDa protein gene. The DNA sequence analysis indicated that the 17-kDa protein gene positive samples were divided into two groups. Group 1 consisted of four sequences, which had the highest homology with R. japonica (GenBank: CP032049) (99.3–99.5% homologous), and group 2 consisted of three sequences, which had the highest homology with R. raoultii (GenBank: MH932036) (98.8–99.5%). Further amplification of the 17-kDa gene positive ticks and tick pools with primers of ompA, gltA, and rrs showed that ticks in group 1 had one, two, and three samples that were positive, respectively; and one tick pool in group 2 was positive with gltA primers. The rickettsial sequences in group 1 obtained with primers of ompA, gltA, and rrs had the highest homology with R. japonica with a 99.7%, 99.7–100%, 96.1%, and 99.4% homology to R. japonica, respectively, and the sequence in group 2 obtained with gltA primers had the highest homology with R. raoultii (99.1%). The phylogenetic analysis was performed with only one tick sample for each group, with the R23 tick representing group 1 and R50 tick representing group 2. A phylogenic analysis with concatenated sequences of the 17-kDa protein gene and gltA indicated that the R23 formed a cluster with R. japonica and R. heilongjiangensis; and R50 was in the same cluster as R. raoultii (Figure 1A). Due to the difficulty in differentiating between R. japonica and R. heilongjiangensis, they were further analyzed by using more sequences including all four genes we obtained in tick R23. A phylogenetic analysis with concatenated sequences of rrs, 17-kDa protein gene, gltA, and ompA showed that R23 was in the same cluster with R. japonica and R. heilongjiangensis, but closer to R. japonica (Figure 1B).
Ehrlichia: Ehrlichia sequences were obtained from nine individual ticks and three tick pools by PCR with rrs primers. The rrs sequences had the highest homology with E. ewingii (GenBank: U96436) (98.8–99.8%). The rrs positive ticks and tick pools were further amplified with gltA primers. The sequences obtained with gltA primers also had the highest homology with E. ewingii (GenBank: DQ365879) (90.3–90.9%). A phylogenic analysis with concatenated sequences of rrs and gltA indicated that all 11 Ehrlichia species were in the same cluster as E. ewingii, but in a distinct group, suggesting that this Ehrlichia species was a novel Ehrlichia species (Figure 2).
Coxiella: Coxiella sequences were obtained from three individual ticks and one tick pool by PCR with omp primers. The omp sequences from ticks had the highest homology with C. burnetti (GenBank: CP014563) (99.5–99.8%). The omp positive tick samples were further amplified with icd primers, which showed that all four tick samples were positive. The icd sequences from ticks were 99.8–100% homologous with C. burnetii (GenBank: CP040059). A phylogenetic analysis with concatenated sequences of omp and icd indicated that the four sequences from ticks were in the same cluster with C. burnetti (Figure 3).
Anaplasma: Anaplasma sequences were obtained from five ticks by PCR with rrs primers. Because the rrs sequences were short and had a poor specificity at first, the semi-nested primers were designed to prolong the Anaplasma rrs sequences of the positive ticks (Table 1). The rrs sequences were prolonged in four of five rrs positive ticks. The rrs sequences from ticks had the highest homology with E. bovis (GenBank: U03775) (96.3–100%). The rrs positive ticks were further amplified with groEL primers, which showed that only one tick sample was positive. The groEL sequence obtained from a tick was 84.6% homologous with A. bovis (GenBank: MH255898). A phylogenetic analysis based on the concatenated sequence of rrs and groEL indicated that the concatenated sequence was in the same cluster as A. bovis (Figure 4).

3.3. Infection Rate of Tickborne Intracellular Bacteria in Ticks

The minimum infection rate (MIR) of pooled ticks was calculated by assuming only one tick was infected in a positive group, and the maximum infection rate (MAR) was calculated by assuming that all ticks were positive in a positive group. The MIR of all tickborne intracellular bacteria in the tested ticks was 22.4% (28/125) (Table 2). The MIR for all tickborne bacteria was 5% (1/20) for tick egg batches, and 83.3% (20/24) for dead engorged females. For molted adult ticks (females and males), the MIR was 8.6% (7/81) and the MAR was 60.5% (49/81). For a comparison of differences according to intracellular bacterial species, the prevalence of the novel Ehrlichia (9.6%, 12/125) was significantly higher than A. bovis (4%, 5/125) (p < 0.01), C. burnetti (3.2%, 4/125) (p < 0.01), R. japonica (3.2%, 4/125) (p < 0.01), or R. raoultii (2.4%, 3/125) (p < 0.01), but there was no significant difference among the last four bacterial species. For a comparison of differences according to groups of developmental stage, the prevalence of tickborne intracellular bacteria in dead engorged ticks was significantly higher than in molted adult ticks (p < 0.01) or eggs (p < 0.01), but there was no significant difference between molted adult ticks and eggs (p = 1).
GenBank deposition: the sequences of tickborne pathogens obtained in this study were deposited in GenBank with accession numbers: A. bovis rrs: MW275984–MW275987 and MN148605, and groEL: MW226869; E. ewingii rrs MN148606–MN148617, and gltA: MW226861–MW226866; C. burnetti icd: MW226857– MW226860, and omp: MW226877–MW226880. Rickettsia 17-kDa protein gene: MW226870–MW226876, gltA: MW226867 and MW226868, rrs: MW275981–MW275983, and ompA MW265948.

4. Discussion

We collected 125 ticks from 15 hedgehogs in Hubei Province, Central China, and all ticks were H. flava. We found three genera of Rickettsiales, including: Rickettsia, Ehrlichia and Anaplasma, and Coxiella burnetti in different developmental stages of H. flava, including eggs, adult ticks, and dead engorged females. We hypothesized that ticks in different stages should have a similar infection rate of intracellular bacteria as they were all collected from 15 hedgehogs. However, our results showed that the prevalence of intracellular bacteria was significantly higher in dead engorged ticks than in eggs and adult ticks molted from nymphs, indicating that there were far more pathogens in every tick immediately after bloodmeal than after the transition to the next stage of development. The transovarial and transstadial transmission reduction in the prevalence of ticks can be observed in all detected nonrelated pathogens. The engorged females were not accidently killed during harvesting from hedgehogs due to their large body size. Even if the ticks were accidently killed, this could not explain why the infection rate of the intracellular bacteria was significantly higher in the dead ticks than in the live ticks. The significant difference in the infection rates between the dead engorged females, and the tick eggs or molted adult ticks may be explained by two possibilities. One possibility is the detrimental effect of intracellular bacteria on ticks, i.e., intracellular bacteria might be detrimental to the engorged adult females, causing the death of engorged female adult ticks during oviposition; another possibility is the transstadial blockage of intracellular bacteria in ticks, i.e., ticks obtained intracellular bacteria during feeding on hedgehogs, and the intracellular bacteria were lost during oviposition or molting due to these bacteria failing to be effectively transmitted transovarially or due to a transstadial blockage occurring in the molting ticks. A previous study showed that only 6% of Ixodes ricinus larvae could be infected by the European strain of tickborne encephalitis virus through transovarial transmission and that the Kyasanur forest disease virus could successfully pass transovarially in 59% of Haemaphysalis spinigera larvae [42]. Our previous study also demonstrated that 70% of Haemaphysalis Iongicornis ticks transovarially transmitted SFTSV and that only 20% transstadially transmitted SFTSV [30]. A previous study showed that if infected ticks were maintained on infection-free hosts for several generations, their pathogens would permanently disappear after 2–3 generations [43]. Our study and previous study suggested that ticks are not real reservoirs but only vectors for these tickborne pathogens.
An Ehrlichia species identified in this study was most closely related to E. ewingii, but in a distinct phylogenetic group, suggesting that it was a novel Ehrlichia species that needed to be further investigated. Ehrlichia ewingii had been reported to infect dogs and cause canine fever, thrombocytopenia, anorexia, polyarthritis, and central nervous system abnormalities [44]. The susceptible animal for this new Ehrlichia species needed to be investigated. Coxiella burnetii, the causative agents of Q fever, are broadly distributed in the environment. Livestock were identified as main reservoirs, which may infect people through their contaminative urine, feces, milk, and birth products. Our previous study had demonstrated that 12.2% of hedgehogs in Hubei Province were PCR-positive to C. burnetii [29]. Our studies indicated that both hedgehogs and their surface parasite ticks could serve as the animal host and vector for C. burnetii. Many kinds of animals could be infected by A. bovis, which caused animal abortions and the reduction of milk production and body weight, and which frequently led to death [45]. A previous study indicated the A. bovis infection of monkeys, suggesting that A. bovis may infect humans [46]. Rickettsia japonica, which was widely distributed in China (including in Henan [40], Anhui [7], Zhejiang [47], Shandong [48], and Hubei [26]) and R. raoultii, which was mainly reported around the border of China (like the Northeastern [49], Northwestern [50,51], Southwestern [52], Inner Mongolia [53], and Central [40] areas) belonged to the spotted fever group rickettsiae and could cause human fever, vomiting, nausea, maculopapular rash, and occasionally eschars at the site of inoculation [54].
To our knowledge, this is the first report about C. burnetti, E. ewingii, and R. raoultii in H. flava. R. japonica, R. heilongjiangensis, Candidatus R. principis, R. felis, and R. helvetica have been reported in H. flava in China, South Korea, and Japan [55,56,57,58,59]. These studies indicate that H. flava could transmit multiple rickettsial pathogens in Asia.
In conclusion, H. flava ticks collected from hedgehogs in Central China were infected with multiple intracellular bacterial pathogens, including R. raoultii, R. japonica, E. ewingii, C. burnetti, and A. bovis. The diseases caused by these pathogens need to be monitored in China.

Author Contributions

L.-Z.F., S.-C.L. designed the study and performed the experiments. S.-C.L., X.X., and X.-Q.G. participated in ticks’ sampling. Z.-J.Y. had applied statistical techniques and J.-W.L. designed the methodology. L.-Z.F., S.-C.L., H.Y. revised manuscript, and X.-J.Y. involved in funding acquisition, conceptualization, and manuscript revision. All authors read and approved the final manuscript.

Funding

This research was funded by the National Natural Science Funds of China grant number 81971939.

Institutional Review Board Statement

The study was conducted according to the guidelines of the Declaration of Helsinki, and approved by the Institutional Review Board (or Ethics Committee) of Ethics Committee of Prevention Medicine of Wuhan University (protocol code 2018010).

Informed Consent Statement

Not applicable.

Data Availability Statement

Not applicable.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Eisen, L. Pathogen transmission in relation to duration of attachment by Ixodes scapularis ticks. Ticks Tick Borne Dis. 2018, 9, 535–542. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  2. Qiu, J.Z.; Luo, Z.Q. Legionella and Coxiella effectors: Strength in diversity and activity. Nat. Rev. Microbiol. 2017, 15, 591–605. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  3. Ben Said, M.; Belkahia, H.; Messadi, L. Anaplasma spp. in North Africa: A review on molecular epidemiology, associated risk factors and genetic characteristics. Ticks Tick Borne Dis. 2018, 9, 543–555. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  4. Boulanger, N.; Boyer, P.; Talagrand-Reboul, E.; Hansmann, Y. Ticks and tick-borne diseases. Med. Mal. Infect. 2019, 49, 87–97. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  5. Machado-Ferreira, E.; Vizzoni, V.F.; Balsemao-Pires, E.; Moerbeck, L.; Gazeta, G.S.; Piesman, J.; Voloch, C.M.; Soares, C.A.G. Coxiella symbionts are widespread into hard ticks. Parasitol. Res. 2016, 115, 4691–4699. [Google Scholar] [CrossRef] [Scilit]
  6. El-Mahallawy, H.S.; Lu, G.; Kelly, P.; Xu, D.; Li, Y.; Fan, W.; Wang, C. Q fever in China: A systematic review, 1989–2013. Epidemiol. Infect. 2015, 143, 673–681. [Google Scholar] [CrossRef] [Scilit]
  7. Li, J.B.; Hu, W.; Wu, T.; Li, H.B.; Hu, W.F.; Sun, Y.; Chen, Z.; Shi, Y.L.; Zong, J.; Latif, A.; et al. Japanese spotted fever in Eastern China, 2013. Emerg. Infect. Dis. 2018, 24, 2107–2109. [Google Scholar] [CrossRef] [Scilit]
  8. Jia, N.; Zheng, Y.C.; Ma, L.; Huo, Q.B.; Ni, X.B.; Jiang, B.G.; Chu, Y.L.; Jiang, R.R.; Jiang, J.F.; Cao, W.C. Human infections with Rickettsia raoultii, China. Emerg. Infect. Dis. 2014, 20, 866–868. [Google Scholar] [CrossRef] [Scilit]
  9. Jung, M.; Kho, J.W.; Lee, W.G.; Roh, J.Y.; Lee, D.H. Seasonal occurrence of Haemaphysalis longicornis (Acari: Ixodidae) and Haemaphysalis flava, vectors of severe fever with thrombocytopenia syndrome (SFTS) in South Korea. J. Med. Entomol. 2019, 56, 1139–1144. [Google Scholar] [CrossRef] [Scilit]
  10. Li, Z.B.; Cheng, T.Y.; Xu, X.L.; Song, L.L.; Liu, G.H. Genetic variation in mitochondrial genes of the tick Haemaphysalis flava collected from wild hedgehogs in China. Exp. Appl. Acarol. 2017, 71, 131–137. [Google Scholar] [CrossRef] [Scilit]
  11. Chae, J.B.; Kang, J.G.; Kim, H.C.; Chong, S.T.; Lee, I.Y.; Shin, N.S.; Chae, J.S. Identification of tick species collected from wild boars and habitats of wild boars and domestic pigs in the Republic of Korea. Korean J. Parasitol. 2017, 55, 185–191. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  12. Duan, D.; Cheng, T. Determination of the microbial community features of Haemaphysalis flava in different developmental stages by high-throughput sequencing. J. Basic Microbiol. 2017, 57, 302–308. [Google Scholar] [CrossRef] [Scilit]
  13. Kim, H.C.; Han, S.H.; Chong, S.T.; Klein, T.A.; Choi, C.Y.; Nam, H.Y.; Chae, H.Y.; Lee, H.; Ko, S.; Kang, J.G.; et al. Ticks collected from selected mammalian hosts surveyed in the Republic of Korea during 2008–2009. Korean J. Parasitol. 2011, 49, 331–335. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  14. Cheng, W.Y.; Zhao, G.H.; Jia, Y.Q.; Bian, Q.Q.; Du, S.Z.; Fang, Y.Q.; Qi, M.Z.; Yu, S.K. Characterization of Haemaphysalis flava (Acari: Ixodidae) from Qingling subspecies of Giant Panda (Ailuropoda melanoleuca qinlingensis) in Qinling Mountains (Central China) by morphology and molecular markers. PLoS ONE 2013, 8, e69793. [Google Scholar] [CrossRef] [Scilit]
  15. Deng, G.F. Economic Insect Fauna of China; Science Press: Beijing, China, 1991; Volume 39, p. 265. [Google Scholar]
  16. Shi, X.Q.; Zhou, Z.Y. The discovery of the Haemaphysalis flava on hedgehog surface in Shanghai. Shanghai J. Anim. Husb. Vet. Med. 1991, 4, 1. [Google Scholar]
  17. Ejiri, H.; Lim, C.K.; Isawa, H.; Yamaguchi, Y.; Fujita, R.; Takayama-Ito, M.; Kuwata, R.; Kobayashi, D.; Horiya, M.; Posadas-Herrera, G.; et al. Isolation and characterization of Kabuto Mountain virus, a new tick-borne phlebovirus from Haemaphysalis flava ticks in Japan. Virus Res. 2018, 244, 252–261. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  18. Fujita, R.; Ejiri, H.; Lim, C.K.; Noda, S.; Yamauchi, T.; Watanabe, M.; Kobayashi, D.; Takayama-Ito, M.; Murota, K.; Posadas-Herrera, G.; et al. Isolation and characterization of Tarumizu tick virus: A new coltivirus from Haemaphysalis flava ticks in Japan. Virus Res. 2017, 242, 131–140. [Google Scholar] [CrossRef] [Scilit]
  19. Hong, S.H.; Kim, S.Y.; Song, B.G.; Rho, J.R.; Cho, C.R.; Kim, C.N.; Um, T.H.; Kwak, Y.G.; Cho, S.H.; Lee, S.E. Detection and characterization of an emerging type of Babesia sp. similar to Babesia motasi for the first case of human babesiosis and ticks in Korea. Emerg. Microbes Infect. 2019, 8, 869–878. [Google Scholar] [CrossRef] [Scilit]
  20. Jo, Y.S.; Kang, J.G.; Chae, J.B.; Cho, Y.K.; Shin, J.H.; Jheong, W.H.; Chae, J.S. Prevalence of severe fever with thrombocytopenia syndrome virus in ticks collected from National Parks in Korea. Vector Borne Zoonotic Dis. 2019, 19, 284–289. [Google Scholar] [CrossRef] [Scilit]
  21. Kang, J.G.; Ko, S.; Kim, H.C.; Chong, S.T.; Klein, T.A.; Chae, J.B.; Jo, Y.S.; Choi, K.S.; Yu, D.H.; Park, B.K.; et al. Prevalence of anaplasma and Bartonella spp. in ticks collected from Korean water deer (Hydropotes inermis argyropus). Korean J. Parasitol. 2016, 54, 87–91. [Google Scholar] [CrossRef] [Scilit]
  22. Suzuki, J.; Hashino, M.; Matsumoto, S.; Takano, A.; Kawabata, H.; Takada, N.; Andoh, M.; Oikawa, Y.; Kajita, H.; Uda, A.; et al. Detection of Francisella tularensis and analysis of bacterial growth in ticks in Japan. Lett. Appl. Microbiol. 2016, 63, 240–246. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  23. Takhampunya, R.; Kim, H.C.; Chong, S.T.; Korkusol, A.; Tippayachai, B.; Davidson, S.A.; Petersen, J.M.; Klein, T.A. Francisella-like endosymbiont detected in Haemaphysalis ticks (Acari: Ixodidae) from the Republic of Korea. J. Med. Entomol. 2017, 54, 1735–1742. [Google Scholar] [CrossRef] [Scilit]
  24. Yun, S.M.; Lee, Y.J.; Choi, W.; Kim, H.C.; Chong, S.T.; Chang, K.S.; Coburn, J.M.; Klein, T.A.; Lee, W.J. Molecular detection of severe fever with thrombocytopenia syndrome and tick-borne encephalitis viruses in ixodid ticks collected from vegetation, Republic of Korea, 2014. Ticks Tick Borne Dis. 2016, 7, 970–978. [Google Scholar] [CrossRef] [Scilit]
  25. Kim, J.Y.; Kwak, Y.S.; Lee, I.Y.; Yong, T.S. Molecular detection of Toxoplasma Gondii in Haemaphysalis ticks in Korea. Korean J. Parasitol. 2020, 58, 327. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  26. Lu, M.; Tian, J.H.; Yu, B.; Guo, W.P.; Holmes, E.C.; Zhang, Y.Z. Extensive diversity of rickettsiales bacteria in ticks from Wuhan, China. Ticks Tick Borne Dis. 2017, 8, 574–580. [Google Scholar] [CrossRef] [Scilit]
  27. Zheng, W.Q.; Xuan, X.N.; Fu, R.L.; Tao, H.Y.; Liu, Y.Q.; Liu, X.Q.; Li, D.M.; Ma, H.M.; Chen, H.Y. Tick-borne pathogens in Ixodid ticks from Poyang lake region, Southeastern China. Korean J. Parasitol. 2018, 56, 589–596. [Google Scholar] [CrossRef] [Scilit]
  28. Levy, S. The Lyme disease debate: Host biodiversity and human disease risk. Environ. Health Perspect. 2013, 121, A120–A125. [Google Scholar] [CrossRef] [Scilit]
  29. Gong, X.Q.; Xiao, X.; Liu, J.W.; Han, H.J.; Qin, X.R.; Lei, S.C.; Yu, X.J. Occurrence and genotyping of Coxiella burnetii in hedgehogs in China. Vector Borne Zoonotic Dis. 2020, 20, 580–585. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  30. Luo, L.M.; Zhao, L.; Wen, H.L.; Zhang, Z.T.; Liu, J.W.; Fang, L.Z.; Xue, Z.F.; Ma, D.Q.; Zhang, X.S.; Ding, S.J.; et al. Haemaphysalis longicornis ticks as reservoir and vector of severe fever with thrombocytopenia syndrome virus in China. Emerg. Infect. Dis. 2015, 21, 1770–1776. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  31. Li, L.H.; Zhu, D.; Zhang, C.C.; Zhang, Y.; Zhou, X.N. Experimental transmission of Babesia microti by Rhipicephalus haemaphysaloides. Parasites Vectors 2016, 9, 231. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  32. Han, H.J.; Liu, J.W.; Wen, H.L.; Qin, X.R.; Zhao, M.; Wang, L.J.; Zhou, C.M.; Qi, R.; Yu, H.; Yu, X.J. Babesia vesperuginis in insectivorous bats from China. Parasites Vectors 2018, 11, 317. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  33. Chitanga, S.; Simulundu, E.; Simuunza, M.C.; Changula, K.; Qiu, Y.; Kajihara, M.; Nakao, R.; Syakalima, M.; Takada, A.; Mweene, A.S.; et al. First molecular detection and genetic characterization of Coxiella burnetii in Zambian dogs and rodents. Parasites Vectors 2018, 11, 40. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  34. Kawahara, M.; Rikihisa, Y.; Lin, Q.; Isogai, E.; Tahara, K.; Itagaki, A.; Hiramitsu, Y.; Tajima, T. Novel genetic variants of Anaplasma phagocytophilum, Anaplasma bovis, Anaplasma centrale, and a novel Ehrlichia sp. in wild deer and ticks on two major islands in Japan. Appl. Environ. Microbiol. 2006, 72, 1102–1109. [Google Scholar] [CrossRef] [Scilit]
  35. Weisburg, W.G.; Barns, S.M.; Pelletier, D.A.; Lane, D.J. 16S ribosomal DNA amplification for phylogenetic study. J. Bacteriol. 1991, 173, 697–703. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  36. Parola, P.; Roux, V.; Camicas, J.L.; Baradji, I.; Brouqui, P.; Raoult, D. Detection of ehrlichiae in African ticks by polymerase chain reaction. Trans. R. Soc. Trop. Med. Hyg. 2000, 94, 2. [Google Scholar] [CrossRef] [Scilit]
  37. Zhang, X.; Geng, J.; Du, J.; Wang, Y.; Qian, W.; Zheng, A.; Zou, Z. Molecular identification of Rickettsia species in Haemaphysalis ticks collected from Southwest China. Vector Borne Zoonotic Dis. 2018, 18, 663–668. [Google Scholar] [CrossRef] [Scilit]
  38. Huang, Y.; Zhao, L.; Zhang, Z.; Liu, M.; Xue, Z.; Ma, D.; Sun, X.; Sun, Y.; Zhou, C.; Qin, X.; et al. Detection of a novel Rickettsia from Leptotrombidium scutellare mites (Acari: Trombiculidae) from Shandong of China. J. Med. Entomol. 2017, 54, 544–549. [Google Scholar] [CrossRef] [Scilit]
  39. Roux, V.; Fournier, P.E.; Raoult, D. Differentiation of spotted fever group rickettsiae by sequencing and analysis of restriction fragment length polymorphism of PCR-amplified DNA of the gene encoding the protein rOmpA. J. Clin. Microbiol. 1996, 34, 2058–2065. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  40. Zhuang, L.; Du, J.; Cui, X.M.; Li, H.; Tang, F.; Zhang, P.H.; Hu, J.G.; Tong, Y.G.; Feng, Z.C.; Liu, W. Identification of tick-borne pathogen diversity by metagenomic analysis in Haemaphysalis longicornis from Xinyang, China. Infect. Dis. Poverty 2018, 7, 45. [Google Scholar] [CrossRef] [Scilit]
  41. Luo, L.M.; Sun, J.M.; Yan, J.B.; Wang, C.W.; Zhang, Z.T.; Zhao, L.; Han, H.J.; Tong, Z.D.; Liu, M.M.; Wu, Y.Y.; et al. Detection of a novel Ehrlichia Species in Haemaphysalis longicornis tick from China. Vector Borne Zoonotic Dis. 2016, 16, 363–367. [Google Scholar] [CrossRef] [Scilit]
  42. Singh, K.R.; Pavri, K.; Anderson, C.R. Experimental transovarial transmission of Kyasanur forest disease virus in Haemaphysalis spinigera. Nature 1963, 199, 513. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  43. Burgdorfer, W.; Brinton, L.P. Mechanisms of transovarial infection of spotted fever Rickettsiae in ticks. Ann. N. Y. Acad. Sci. 1975, 266, 61–72. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  44. Starkey, L.A.; Barrett, A.W.; Beall, M.J.; Chandrashekar, R.; Thatcher, B.; Tyrrell, P.; Little, S.E. Persistent Ehrlichia ewingii infection in dogs after natural tick infestation. J. Vet. Intern. Med. 2015, 29, 552–555. [Google Scholar] [CrossRef] [Scilit]
  45. Stuen, S.; Nevland, S.; Moum, T. Fatal cases of tick-borne fever (TBF) in sheep caused by several 16S rRNA gene variants of Anaplasma phagocytophilum. Ann. N. Y. Acad. Sci. 2003, 990, 10. [Google Scholar] [CrossRef] [Scilit]
  46. Tay, S.T.; Koh, F.X.; Kho, K.L.; Sitam, F.T. Rickettsial infections in monkeys, Malaysia. Emerg. Infect. Dis. 2015, 21, 545–547. [Google Scholar] [CrossRef] [Scilit]
  47. Sun, J.M.; Lin, J.F.; Gong, Z.Y.; Chang, Y.; Ye, X.D.; Gu, S.P.; Pang, W.L.; Wang, C.W.; Zheng, X.H.; Hou, J.; et al. Detection of spotted fever group Rickettsiae in ticks from Zhejiang Province, China. Exp. Appl. Acarol. 2015, 65, 403–411. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  48. Qin, X.R.; Han, H.J.; Han, F.J.; Zhao, F.M.; Zhang, Z.T.; Xue, Z.F.; Ma, D.Q.; Qi, R.; Zhao, M.; Wang, L.J.; et al. Rickettsia japonica and novel Rickettsia species in ticks, China. Emerg. Infect. Dis. 2019, 25, 992–995. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  49. Wen, J.; Jiao, D.; Wang, J.H.; Yao, D.H.; Liu, Z.X.; Zhao, G.; Ju, W.D.; Cheng, C.; Li, Y.J.; Sun, Y. Rickettsia raoultii, the predominant Rickettsia found in Dermacentor silvarum ticks in China–Russia border areas. Exp. Appl. Acarol. 2014, 63, 579–585. [Google Scholar] [CrossRef] [Scilit]
  50. Guo, L.P.; Mu, L.M.; Xu, J.; Jiang, S.H.; Wang, A.D.; Chen, C.F.; Guo, G.; Zhang, W.J.; Wang, Y.Z. Rickettsia raoultii in Haemaphysalis erinacei from marbled polecats, China-Kazakhstan border. Parasites Vectors 2015, 8, 461. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  51. Dong, Z.H.; Yang, Y.C.; Wang, Q.; Xie, S.S.; Zhao, S.S.; Tan, W.B.; Yuan, W.M.; Wang, Y.Z. A case with neurological abnormalities caused by Rickettsia raoultii in northwestern China. BMC Infect. Dis. 2019, 19, 796. [Google Scholar] [CrossRef] [Scilit]
  52. Liu, H.; Liang, X.T.; Wang, H.J.; Sun, X.T.; Bai, X.; Hu, B.; Shi, N.; Wang, N.; Zhang, X.L.; Huang, L.Z.; et al. Molecular evidence of the spotted fever group Rickettsiae in ticks from Yunnan Province, Southwest China. Exp. Appl. Acarol. 2020, 80, 339–348. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  53. Gaowa, W.; Yin, X.H.; Guo, S.C.; Ding, C.L.; Cao, M.Z.; Kawabata, H.; Sato, K.; Ando, S.; Fujita, H.; Kawamori, F.; et al. Spotted fever group Rickettsiae in Inner Mongolia, China, 2015–2016. Emerg. Infect. Dis. 2018, 24, 2105–2107. [Google Scholar]
  54. Gaywee, J.; Sunyakumthorn, P.; Rodkvamtook, W.; Ruang-Areerate, T.; Mason, C.J.; Sirisopana, N. Human infection with Rickettsia sp. related to R. japonica, Thailand. Emerg. Infect. Dis. 2007, 13, 671–673. [Google Scholar] [CrossRef] [Scilit]
  55. Jiang, J.; Choi, Y.J.; Kim, J.; Kim, H.C.; Klein, T.A.; Chong, S.T.; Richards, A.L.; Park, H.J.; Shin, S.H.; Song, D.; et al. Distribution of Rickettsia spp. in ticks from Northwestern and Southwestern Provinces, Republic of Korea. Korean J. Parasitol. 2019, 57, 161–166. [Google Scholar] [CrossRef] [Scilit]
  56. Seo, M.G.; Kwon, O.D.; Kwak, D. High prevalence of Rickettsia raoultii and associated pathogens in canine ticks, South Korea. Emerg. Infect. Dis. 2020, 26, 2530–2532. [Google Scholar] [CrossRef] [Scilit]
  57. Ishikura, M.; Ando, S.; Shinagawa, Y.; Matsuura, K.; Hasegawa, S.; Nakayama, T.; Fujita, H.; Watanabe, M. Phylogenetic analysis of spotted fever group rickettsiae based on gltA, 17-kDa, and rOmpA genes amplified by nested PCR from ticks in Japan. Microbiol. Immunol. 2003, 47, 823–832. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  58. Li, W.; Liu, L.; Jiang, X.; Guo, X.; Garnier, M.; Raoult, D.; Parola, P. Molecular identification of spotted fever group Rickettsiae in ticks collected in central China. Clin. Microbiol. Infect. 2009, 15, 279–280. [Google Scholar] [CrossRef] [Scilit]
  59. Fournier, P.E.; Fujita, H.; Takada, N.; Raoult, D. Genetic identification of rickettsiae isolated from ticks in Japan. J. Clin. Microbiol. 2002, 40, 2176–2181. [Google Scholar] [CrossRef] [Scilit]
Figure 1. Phylogenetic tree of the Rickettsia species. The phylogenetic trees were constructed using (A) the concatenated sequences of the 17-kDa protein gene and gltA and (B) the concatenated sequences of rrs,17-kDa protein gene, gltA, and ompA. The tree was generated using the Maximum Likelihood method, the Kimura 2-parameter model, and 1000 replicates for bootstrap testing in MEGA 7.0 software. Only bootstrap values > 50% were shown. Rickettsia sequences obtained in this study are shown with dots. The scale bar indicates nucleotide substitutions per site. The Rickettsia species’ name and complete genome GenBank accession numbers of reference sequences are shown in each line.
Figure 1. Phylogenetic tree of the Rickettsia species. The phylogenetic trees were constructed using (A) the concatenated sequences of the 17-kDa protein gene and gltA and (B) the concatenated sequences of rrs,17-kDa protein gene, gltA, and ompA. The tree was generated using the Maximum Likelihood method, the Kimura 2-parameter model, and 1000 replicates for bootstrap testing in MEGA 7.0 software. Only bootstrap values > 50% were shown. Rickettsia sequences obtained in this study are shown with dots. The scale bar indicates nucleotide substitutions per site. The Rickettsia species’ name and complete genome GenBank accession numbers of reference sequences are shown in each line.
Pathogens 10 00115 g001
Figure 2. Phylogenetic tree of Ehrlichia species. The phylogenetic tree was constructed using the concatenated sequences of rrs and gltA. The tree was generated using the Maximum Likelihood method, the Kimura 2-parameter model, and 1000 replicates for bootstrap testing in MEGA 7.0 software. Only bootstrap values >50% were shown. Ehrlichia sequences obtained in this study are shown with dots. The scale bar indicates nucleotide substitutions per site. The Ehrlichia species’ name and GenBank accession numbers of reference sequences are shown in each line. For the Ehrlichia species without complete genome sequences, the GenBank accession numbers in the order of rrs and gltA were DQ365879.1 and M73227.1 for E. ewingii; DQ365879.1 and U96436.1 for E. ewingii; MN685612.1 and MN658719.1 for E. muris; MN685612.1 and MN658719.1 for E. muris; and NR 148800.1 and JX629807.1 for E. minasensis.
Figure 2. Phylogenetic tree of Ehrlichia species. The phylogenetic tree was constructed using the concatenated sequences of rrs and gltA. The tree was generated using the Maximum Likelihood method, the Kimura 2-parameter model, and 1000 replicates for bootstrap testing in MEGA 7.0 software. Only bootstrap values >50% were shown. Ehrlichia sequences obtained in this study are shown with dots. The scale bar indicates nucleotide substitutions per site. The Ehrlichia species’ name and GenBank accession numbers of reference sequences are shown in each line. For the Ehrlichia species without complete genome sequences, the GenBank accession numbers in the order of rrs and gltA were DQ365879.1 and M73227.1 for E. ewingii; DQ365879.1 and U96436.1 for E. ewingii; MN685612.1 and MN658719.1 for E. muris; MN685612.1 and MN658719.1 for E. muris; and NR 148800.1 and JX629807.1 for E. minasensis.
Pathogens 10 00115 g002
Figure 3. Phylogenetic tree of the Coxiella species. The phylogenetic tree was constructed based on the concatenated sequences of omp and icd. The tree was generated using the Maximum Likelihood method, the Kimura 2-parameter model, and 1000 replicates for bootstrap testing in MEGA 7.0 software. Only bootstrap values >50% were shown. Coxiella sequences obtained in this study are shown with dots. The scale bar indicates nucleotide substitutions per site. The Coxiella species’ name and complete genome GenBank accession numbers of reference sequences are shown in each line.
Figure 3. Phylogenetic tree of the Coxiella species. The phylogenetic tree was constructed based on the concatenated sequences of omp and icd. The tree was generated using the Maximum Likelihood method, the Kimura 2-parameter model, and 1000 replicates for bootstrap testing in MEGA 7.0 software. Only bootstrap values >50% were shown. Coxiella sequences obtained in this study are shown with dots. The scale bar indicates nucleotide substitutions per site. The Coxiella species’ name and complete genome GenBank accession numbers of reference sequences are shown in each line.
Pathogens 10 00115 g003
Figure 4. Phylogenetic tree of the Anaplasma species. The phylogenetic tree was constructed based on the concatenated sequences of rrs and groEL. The tree was generated using the Maximum Likelihood method, the Kimura 2-parameter model, and 1000 replicates for bootstrap testing in MEGA 7.0 software. Only bootstrap values >50% were shown. Anaplasma sequences obtained in this study are shown with dots. The scale bar indicates nucleotide substitutions per site. The Anaplasma species’ name and complete genome GenBank accession numbers of reference sequences are shown in each line.
Figure 4. Phylogenetic tree of the Anaplasma species. The phylogenetic tree was constructed based on the concatenated sequences of rrs and groEL. The tree was generated using the Maximum Likelihood method, the Kimura 2-parameter model, and 1000 replicates for bootstrap testing in MEGA 7.0 software. Only bootstrap values >50% were shown. Anaplasma sequences obtained in this study are shown with dots. The scale bar indicates nucleotide substitutions per site. The Anaplasma species’ name and complete genome GenBank accession numbers of reference sequences are shown in each line.
Pathogens 10 00115 g004
Table 1. Primers for the amplification of sequences of Coxiella burnetti, Anaplasma spp., Ehrlichia spp., and Rickettsia spp. from ticks.
Table 1. Primers for the amplification of sequences of Coxiella burnetti, Anaplasma spp., Ehrlichia spp., and Rickettsia spp. from ticks.
OrganismsPrimary/NestedPrimersPrimer SequencesTarget GeneAmplicon SizeReference
Coxiella burnettiPrimary Omp1AGTAGAAGCATCCCAAGCATTGomp438 bp[32]
Omp2TGCCTGCTAGCTGTAACGATTG
Nested Omp3GAAGCGCAACAAGAAGAACA
Omp4TGGAAGTTATCACGCAGTTG
Primary BicdF1CGGAGTTAACCGGAGTATCCAicd651 bp[33]
BicdR1CCGTGAATTTCATGATGTTACCTTT
Nested BicdF2AGTTAACCGGAGTATCCATCThis study
BicdR2CTAAACGGCTCGTGCCTTCT
AnaplasmaPrimary EC9TACCTTGTTACGACTTrrs477 bp[34]
EC12ATGATCCTGGCTCAGAACGAACG
Nested EM87FGGTTCGCTATTAGTGGCAGA
EM584RCAGTATTAAAAGCCGCTCCA
Primary fD1AGAGTTTGATCCTGGCTCAGrrs742–1426 bp[35]
Rp2ACGGCTACCTTGTTACGACTT
Nested EHR16SDGGTACCY * ACAGAAGAAGTCC[36]
EHR16SRTAGCACTCATCGTTTACAGC
PrimaryagroELwfTTTGCCAGTTTTGGAAGGCGgroEL473 bpThis study
agroELwrTTTCAGCGGATCCATCACCC
NestedagroELnfTGAGGGTGAAGCATTGAGCA
agroELnrAGAGTGTACAGCAGAGCAGC
EhrlichiaPrimaryEC9TACCTTGTTACGACTTrrs477 bp
538 bp
[34]
EC12ATGATCCTGGCTCAGAACGAACG
NestedEM87FGGTTCGCTATTAGTGGCAGA
EM584RCAGTATTAAAAGCCGCTCCA
NestedHF51FAAGTCGAACGGACAATTACC
HF954RGTTAGGGGGATACGACCTTC
Primarye-gltawfTTCTCAGGAATACATGCCACCgltA411 bpThis study
e-gltawrACCATTGAGCAGACCAGCCA
Nestede-gltanfAATTGCAGGGATAGTGGCAA
e-gltanrCTGTGGCCAAAACCCATCAA
RickettsiaPrimaryR17F1TTTACAAAATTCTAAAAACCAT17-kDa protein gene410 bp[37]
RRTCAATTCACAACTTGCCATT
NestedRrF2GCTCTTGCAACTTCTATGTT
RrRTCAATTCACAACTTGCCATT
Primary S1TGATCCTGGCTCAGAACGAACrrs1317 bp[38]
S2TAAGGAGGTAATCCAGCCGC
Nested S3AACACATGCAAGTCGRACGG
S4GGCTGCCTCTTGCGTTAGCT
Primary glta1TGATCCTGGCTCAGAACGAACgltA667 bpThis study
glta2TAAGGAGGTAATCCAGCCGC
Nested glta3AACACATGCAAGTCGRACGG
glta4GGCTGCCTCTTGCGTTAGCT
Rr190.70p ATGGCGAATATTTCTCCAAAA ompA631 bp[39]
Rr190.701n GTTCCGTTAATGGCAGCATCT
R. raoultiiPrimaryRglta1ATGACCAATGAAAATAATAATgltA341 bp[40]
Rglta2CTTATACTCTCTATGTACA
Nested Rglta3GGGGACCTGCTCACGGCGG
Rglta4ATTGCAAAAAGTACAGTGAACA
* Degenerate primer: Y = C or T.
Table 2. Prevalence of intracellular tickborne pathogens in ticks collected from hedgehogs in Hubei Province, China.
Table 2. Prevalence of intracellular tickborne pathogens in ticks collected from hedgehogs in Hubei Province, China.
Tick SpeciesYear of Tick CollectionPathogensEgg Batches (%) n = 20Dead Engorged Females (%) n = 24Molted Adults (%)
n = 81
Total % n = 125
MIRMAR
Haemaphysalis flava2018Anaplasma bovis020.8 004
Haemaphysalis flava2018Coxiella burnetti012.51.28.63.2
Haemaphysalis flava2018Ehrlichia ewingii037.53.725.99.6
Haemaphysalis flava2018Rickettsia raoultii502.517.32.4
Haemaphysalis flava2018Rickettsia japonica012.51.28.63.2
Total583.38.660.522.4
Note: MIR = the minimum infection rate of pooled ticks and MAR=the maximum infection rate of pooled ticks.
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Share and Cite

MDPI and ACS Style

Fang, L.-Z.; Lei, S.-C.; Yan, Z.-J.; Xiao, X.; Liu, J.-W.; Gong, X.-Q.; Yu, H.; Yu, X.-J. Detection of Multiple Intracellular Bacterial Pathogens in Haemaphysalis flava Ticks Collected from Hedgehogs in Central China. Pathogens 2021, 10, 115. https://doi.org/10.3390/pathogens10020115

AMA Style

Fang L-Z, Lei S-C, Yan Z-J, Xiao X, Liu J-W, Gong X-Q, Yu H, Yu X-J. Detection of Multiple Intracellular Bacterial Pathogens in Haemaphysalis flava Ticks Collected from Hedgehogs in Central China. Pathogens. 2021; 10(2):115. https://doi.org/10.3390/pathogens10020115

Chicago/Turabian Style

Fang, Li-Zhu, Si-Cong Lei, Zhi-Jian Yan, Xiao Xiao, Jian-Wei Liu, Xiao-Qing Gong, Hao Yu, and Xue-Jie Yu. 2021. "Detection of Multiple Intracellular Bacterial Pathogens in Haemaphysalis flava Ticks Collected from Hedgehogs in Central China" Pathogens 10, no. 2: 115. https://doi.org/10.3390/pathogens10020115

APA Style

Fang, L.-Z., Lei, S.-C., Yan, Z.-J., Xiao, X., Liu, J.-W., Gong, X.-Q., Yu, H., & Yu, X.-J. (2021). Detection of Multiple Intracellular Bacterial Pathogens in Haemaphysalis flava Ticks Collected from Hedgehogs in Central China. Pathogens, 10(2), 115. https://doi.org/10.3390/pathogens10020115

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop