Genetic Insights on Meropenem Resistance Concerning Klebsiella pneumoniae Clinical Isolates
Abstract
1. Introduction
2. Materials and Methods
2.1. Presumptive Identification of K. pneumoniae Isolates
2.2. Antimicrobial Susceptibility Testing
2.3. Phenotypic Screening of ESβL and Carbapenemase Production
2.4. Quantitative Estimation of Biofilm Formation
2.5. Molecular Identification of the Tested Isolates
2.6. Molecular Detection of Biofilm-, ESβL-, Carbapenemase-, and Other AMR-Related Genes
Target Genes | Primer Sequence (5′ → 3′) | Amplicon Size (bp *) | References |
---|---|---|---|
16S−23S rDNA | F*-ATTTGAAGAGGTTGCAAACGAT | 130; F/R1 260; F/R2 | [27] |
R*1-TTCACTCTGAAGTTTTCTTGTGTTC | |||
R2-CCGAAGATGTTTCACTTCTGATT | |||
fimD | F; GTTACGCCTATCTGAATCTACAGAG | 1114 | [30] |
R; GACCAGTTGATATCGTCCACG | |||
mrkD | F; CGCTTTTTATCGTCTTAATG | 880 | |
R; GTGATGTAGCGGGTCTCCTG | |||
blaNDM | F; GCAGCTTGTCGGCCATGCGGGC | 782 | [32] |
R; GGTCGCGAAGCTGAGCACCGCAT | |||
blaKPC | F; CGTCTAGTTCTGCTGTCTTG | 798 | [33] |
R; CTTGTCATCCTTGTTAGGCG | |||
blaOXA-48-like | F; GCGTGGTTAAGGATGAACAC | 438 | |
R; CATCAAGTTCAACCCAACCG | |||
ompK35 | F; ATGATGAAGCGCAATATTCTGGCAGTGG | 684 | [23] |
R; R; TCGGCTTTGTCGCCATTGCCGTCA | |||
ompK36 | F; ATGAAAGTTAAAGTACTGTCCCTC | 1076 | |
R; GTCGTCGGTAGAGATACCGGC | |||
blaSHV | F; TCCCATGATGAGCACCTTTAAA | 104 | [31] |
R; TCCTGCTGGCGATAGTGGAT | |||
blaCTX-M | F; TCTTCCAGAATAAGGAATCCC | 909 | |
R; CCGTTTCCGCTATTACAAAC | |||
aac(3)IIa | F; ATATCGCGATGCATACGCGG | 877 | [34] |
R; GACGGCCTCTAACCGGAAGG | |||
qnrB | F; GATCGTGAAAGCCAGAAAGG | 469 | [26] |
R; ACGATGCCTGGTAGTTGTCC | |||
tetB | F; CAGTGCTGTTGTTGTCATTAA | 571 | [35] |
R; GCTTGGAATACTGAGTGTAA |
Target Genes | PCR Conditions | References | ||
---|---|---|---|---|
Initial Denaturation | Elongation (35 Cycles) | Final Extension | ||
16S-23S rDNA | 94 °C/10 min | 94 °C/30 s, 57 °C/20 s, and 72 °C/20 s | 72 °C/10 min | [27] |
fimD | 95 °C/5 min | 95 °C/30 s, 57 °C/60 s, and 72 °C/60 s | [30] | |
mrkD | 95 °C/30 s, 55 °C/60 s, and 72 °C/60 s | |||
blaNDM | 95 °C/5 min | 95 °C/45 s, 60 °C/45 s, and 72 °C/60 s | 72 °C/8 min | [32] |
blaKPC | 95 °C/30 s, 60 °C/90 s, and 72 °C/60 s | 72 °C/10 min | [33] | |
blaOXA-48-like | 95 °C/30 s, 56 °C/30 s, and 72 °C/60 s | |||
ompK35 | 93 °C/3 min | 93 °C/60 s, 55 °C/60 s, and 72 °C/60 s | 72 °C/7 min | [23] |
ompK36 | ||||
blaSHV | 95 °C/5 min | 95 °C/30 s, 50 °C/30 s, and 72 °C/60 s | 72 °C/5 min | [31] |
blaCTX-M | 95 °C/30 s, 60 °C/30 s, and 72 °C/60 s | |||
aac(3)IIa | 95 °C/5 min | 95 °C/60 s, 56 °C/30 s, and 72 °C/60 s | 72 °C/5 min | [34] |
qnrB | 94 °C/5 min | 94 °C/30 s, 53 °C/45 s, and 72 °C/45 s | 72 °C/5 min | [26] |
tetB | 94 °C/30 s, 50 °C/45 s, and 72 °C/45 s | 72 °C/10 min | [35] |
2.7. Statistical Analysis
3. Results
3.1. Phenotypic Identification of Isolates
3.2. Antimicrobial Susceptibility Profile
3.3. Phenotypic Screening of the ESβL and Carbapenemase Production
3.4. Biofilm Formation Characters Amongst K. pneumoniae Phenotypes
3.5. Molecular Identification K. pneumoniae Isolates
3.6. Molecular Detection of the Biofilm-Associated Genes
3.7. Detection of Carbapenemase-, ESβL- and Other Plasmid-Mediated Resistance Genes
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Ibrahim, M.E.; Algak, T.B.; Abbas, M.; Elamin, B.K. Emergence of bla(TEM), bla(CTX-M), bla(SHV) and bla(OXA) genes in multidrug-resistant Enterobacteriaceae and Acinetobacter baumannii in Saudi Arabia. Exp. Ther. Med. 2021, 22, 1450. [Google Scholar] [CrossRef] [PubMed]
- Adeyemi, F.; Akinde, S. ESβL, AmpC and carbapenemase co-production in multi-drug resistant Gram-negative bacteria from HIV-infected patients in southwestern Nigeria. Afr. J. Clin. Exp. Microbiol. 2021, 22, 38–51. [Google Scholar] [CrossRef]
- Husna, A.; Rahman, M.M.; Badruzzaman, A.T.M.; Sikder, M.H.; Islam, M.R.; Rahman, M.T.; Alam, J.; Ashour, H.M. Extended-spectrum β-lactamases (ESBL): Challenges and opportunities. Biomedicines 2023, 11, 2937. [Google Scholar] [CrossRef] [PubMed]
- Sadek, M.S.; El-Sherbiny, G.M.; Halim, M.M.A.; Fouda, A.M. Detection of blaTEM, blaSHV, and blaCTX-M genes among the extended-spectrum β-lactamases (ESβLs) producing Enterobacteriaceae isolated from hospital-acquired infections and community in Egypt. Al-Azhar Int. Med. J. 2021, 2, 7–14. [Google Scholar]
- Randall, L.P.; Kirchner, M.; Teale, C.J.; Coldham, N.G.; Liebana, E.; Clifton-Hadley, F. Evaluation of CHROMagar CTX, a novel medium for isolating CTX-M-ESBL-positive Enterobacteriaceae while inhibiting AmpC-producing strains. J. Antimicrob. Chemother. 2009, 63, 302–308. [Google Scholar] [CrossRef]
- Silago, V.; Kovacs, D.; Samson, H.; Seni, J.; Matthews, L.; Oravcova, K.; Lupindu, A.M.; Hoza, A.S.; Mshana, S.E. Existence of multiple ESBL genes among phenotypically confirmed ESBL producing Klebsiella pneumoniae and Escherichia coli concurrently isolated from clinical, colonization and contamination samples from neonatal units at Bugando Medical Center, Mwanza, Tanzania. Antibiotics 2021, 10, 476. [Google Scholar] [CrossRef]
- Farhadi, M.; Ahanjan, M.; Goli, H.R.; Haghshenas, M.R.; Gholami, M. High frequency of multidrug-resistant (MDR) Klebsiella pneumoniae harboring several β-lactamase and integron genes collected from several hospitals in the north of Iran. Ann. Clin. Microbiol. Antimicrob. 2021, 20, 70. [Google Scholar] [CrossRef]
- Huang, W.; Zhang, J.; Zeng, L.; Yang, C.; Yin, L.; Wang, J.; Li, J.; Li, X.; Hu, K.; Zhang, X.; et al. Carbapenemase production and epidemiological characteristics of carbapenem-resistant Klebsiella pneumoniae in Western Chongqing, China. Front. Cell. Infect. Microbiol. 2021, 11, 775740. [Google Scholar] [CrossRef]
- Guo, Y.; Liu, F.; Zhang, Y.; Wang, X.; Gao, W.; Xu, B.; Li, Y.; Song, N. Virulence, antimicrobial resistance, and molecular characteristics of carbapenem-resistant Klebsiella pneumoniae in a hospital in Shijiazhuang City from China. Int. Microbiol. Off. J. Span. Soc. Microbiol. 2023, 26, 1073–1085. [Google Scholar] [CrossRef]
- Sugawara, E.; Kojima, S.; Nikaido, H. Klebsiella pneumoniae Major Porins OmpK35 and OmpK36 allow more efficient diffusion of β-Lactams than Their Escherichia coli Homologs OmpF and OmpC. J. Bacteriol. 2016, 198, 3200–3208. [Google Scholar] [CrossRef]
- Reeves, C.M.; Magallon, J.; Rocha, K.; Tran, T.; Phan, K.; Vu, P.; Yi, Y.; Oakley-Havens, C.L.; Cedano, J.; Jimenez, V.; et al. Aminoglycoside 6′-N-acetyltransferase type Ib [AAC(6′)-Ib]-mediated aminoglycoside resistance: Phenotypic conversion to susceptibility by silver ions. Antibiotics 2021, 10, 29. [Google Scholar] [CrossRef] [PubMed]
- Haeili, M.; Salehzeinali, H.; Mirzaei, S.; Pishnian, Z.; Ahmadi, A. Molecular characterization of quinolone resistance and antimicrobial resistance profiles of Klebsiella pneumoniae and Escherichia coli isolated from human and broiler chickens. Int. J. Environ. Health Res. 2022, 32, 1382–1392. [Google Scholar] [CrossRef] [PubMed]
- Kareem, S.M.; Al-kadmy, I.M.S.; Kazaa, S.A.; Ali, A.N.M.; Aziz, S.N.; Makharita, R.R.; Algamma, A.M.; Al-Rejaie, S.; Behl, T.; Batiha, G.E.; et al. Detection of gyrA and parC mutations and prevalence of plasmid-mediated quinolone resistance genes in Klebsiella pneumoniae. Infect. Drug Resist. 2021, 14, 555–563. [Google Scholar] [CrossRef] [PubMed]
- Ochońska, D.; Olechowska-Jarząb, A.; Dobrut, A.; Bulanda, M.; Brzychczy-Włoch, M. Studies on molecular epidemiology of ESΒL producing Klebsiella pneumoniae isolated from patients hospitalized in a specialist hospital in southern Poland. Postępy Hig. I Med. Doświadczalnej 2021, 75, 970–979. [Google Scholar] [CrossRef]
- Wang, A.; Yang, Y.; Lu, Q.; Wang, Y.; Chen, Y.; Deng, L.; Ding, H.; Deng, Q.; Wang, L.; Shen, X. Occurrence of qnr-positive clinical isolates in Klebsiella pneumoniae producing ESBL or AmpC-type β-lactamase from five pediatric hospitals in China. FEMS Microbiol. Lett. 2008, 283, 112–116. [Google Scholar] [CrossRef][Green Version]
- Izquierdo, L.; Coderch, N.; Pique, N.; Bedini, E.; Corsaro, M.M.; Merino, S.; Fresno, S.; Tomas, J.M.; Regue, M. The Klebsiella pneumoniae wabG gene: Role in biosynthesis of the core lipopolysaccharide and virulence. J. Bacteriol. 2003, 185, 7213–7221. [Google Scholar] [CrossRef]
- Rastegar, S.; Moradi, M.; Kalantar-Neyestanaki, D.; Ali Golabi, D.; Hosseini-Nave, H. Virulence factors, capsular serotypes and antimicrobial resistance of hypervirulent Klebsiella pneumoniae and classical Klebsiella pneumoniae in Southeast Iran. Infect. Chemother. 2019, 51, e39. [Google Scholar] [CrossRef]
- Shein, A.M.S.; Wannigama, D.L.; Higgins, P.G.; Hurst, C.; Abe, S.; Hongsing, P.; Chantaravisoot, N.; Saethang, T.; Luk-in, S.; Liao, T.; et al. Novel colistin-EDTA combination for successful eradication of colistin-resistant Klebsiella pneumoniae catheter-related biofilm infections. Sci. Rep. 2021, 11, 21676. [Google Scholar] [CrossRef]
- Procop, G.; Church, D.; Hall, G.; Janda, W.; Koneman, E.; Schreckenberger, P.; Woods, G. Koneman’s Color Atlas and Textbook of Diagnostic Microbiology, 7th ed.; Lippincott Williams and Wilkins Company: Philadelphia, PA, USA, 2017. [Google Scholar]
- Fatima, S.; Liaqat, F.; Akbar, A.; Sahfee, M.; Samad, A.; Anwar, M.; Iqbal, S.; Khan, S.A.; Sadia, H.; Makai, G.; et al. Virulent and multidrug-resistant Klebsiella pneumoniae from clinical samples in Balochistan. Int. Wound J. 2021, 18, 510–518. [Google Scholar] [CrossRef]
- Clinical and Laboratory Standards Institute. Performance Standards for Antimicrobial Susceptibility Testing, 30th ed.; CLSI Supplement M100; CLSI: Wayne, PA, USA, 2020. [Google Scholar]
- Elshikh, M.; Ahmed, S.; Funston, S.; Dunlop, P.; McGaw, M.; Marchant, R.; Banat, I.M. Resazurin-based 96-well plate microdilution method for the determination of minimum inhibitory concentration of biosurfactants. Biotechnol. Lett. 2016, 38, 1015–1019. [Google Scholar] [CrossRef]
- Indrajith, S.; Mukhopadhyay, A.K.; Chowdhury, G.; Al Farrajc, D.A.; Alkufeidy, R.M.; Natesana, S.; Meghanathand, V.; Gopale, S.; Muthupandianf, S. Molecular insights of carbapenem resistance Klebsiella pneumoniae isolates with focus on multidrug resistance from clinical samples. J. Infect. Public Health 2021, 14, 131–138. [Google Scholar] [CrossRef] [PubMed]
- Awoke, T.; Teka, B.; Aseffa, A.; Sebre, S.; Seman, A.; Yeshitela, B.; Abebe, T.; Mihret, A. Detection of blaKPC and blaNDM carbapenemase genes among Klebsiella pneumoniae isolates in Addis Ababa, Ethiopia: Dominance of blaNDM. PLoS ONE 2022, 17, e0267657. [Google Scholar] [CrossRef] [PubMed]
- Shadkam, S.; Goli, H.R.; Mirzaei, B.; Gholami, M.; Ahanjan, M. Correlation between antimicrobial resistance and biofilm formation capability among Klebsiella pneumoniae strains isolated from hospitalized patients in Iran. Ann. Clin. Microbiol. Antimicrob. 2021, 20, 13. [Google Scholar] [CrossRef] [PubMed]
- Izadi, N.; Naderi Nasab, M.; Harifi Mood, E.; Meshkat, Z. The frequency of qnr Genes in extended-spectrum β-lactamases and non-ESβLs Klebsiella pneumoniae species isolated from patients in Mashhad, Iran. Iran. J. Pathol. 2017, 12, 377–383. [Google Scholar] [CrossRef] [PubMed]
- Osman, E.A.; El-Amin, N.; Adrees, E.A.E.; Al-Hassan, L.; Mukhtar, M. Comparing conventional, biochemical and genotypic methods for accurate identification of Klebsiella pneumoniae in Sudan. Access Microbiol. 2020, 2, acmi000096. [Google Scholar] [CrossRef]
- Elkady, F.M.; Al-Askar, A.A.; Tawab, A.A.; Alkherkhisy, M.M.; Arishi, A.A.; Hashem, A.H. Comparative genotypic analysis of RAPD and RFLP markers for molecular variation detection of methicillin-resistant Staphylococcus aureus clinical isolates. Medicina 2022, 58, 1245. [Google Scholar] [CrossRef]
- Anis, R.H.; Ahmed, S.M.; Esmaeel, N.E. Virulence determinants associated with biofilm formation by Klebsiella pneumoniae causing hospital-acquired bloodstream infection. Microbes Infect. Dis. 2021, 2, 317–325. [Google Scholar] [CrossRef]
- Ballén, V.; Gabasa, Y.; Ratia, C.; Ortega, R.; Tejero, M.; Soto, S. Antibiotic resistance and virulence profiles of Klebsiella pneumoniae strains isolated from different clinical sources. Front. Cell. Infect. Microbiol. 2021, 11, 738223. [Google Scholar] [CrossRef]
- Al-Hashimy, A.B.; Al-Musawy, W.K. Molecular study and antibiotic susceptibility patterns of some extended spectrum Beta-lactamase genes (ESBL) of Klebsiella pneumpniae in urinary tract infections. J. Phys. Conf. Ser. 2020, 1, 012017. [Google Scholar] [CrossRef]
- Hosseinzadeh, Z.; Ebrahim-Saraie, H.S.; Sarvari, J.; Mardaneh, J.; Dehghani, B.; Rokni-Hosseini, S.M.H.; Motamedifar, M. Emerge of bla(NDM-1) and bla(OXA-48-like) harboring carbapenem-resistant Klebsiella pneumoniae isolates from hospitalized patients in southwestern Iran. J. Chin. Med. Assoc. JCMA 2018, 81, 536–540. [Google Scholar] [CrossRef]
- Taha, M.S.; Shouib, S.M.; ELmonir, W.; Zahra, S.W.; Hegazy, E.E. Microbiological profile of blood stream infection: Genetic relatedness of carbapenemase producing klebsiella Pneumoniae isolates using ERIC PCR. Microbes Infect. Dis. 2023, 4, 168–181. [Google Scholar] [CrossRef]
- Latifi, B.; Tajbakhsh, S.; Ahadi, L.; Yousefi, F. Coexistence of aminoglycoside resistance genes in CTX-M-producing isolates of Klebsiella pneumoniae in Bushehr province, Iran. Iran. J. Microbiol. 2021, 13, 161–170. [Google Scholar] [CrossRef]
- Adesoji, A.T.; Ogunjobi, A.A.; Olatoye, I.O.; Douglas, D.R. Prevalence of tetracycline resistance genes among multi-drug resistant bacteria from selected water distribution systems in southwestern Nigeria. Ann. Clin. Microbiol. Antimicrob. 2015, 14, 35. [Google Scholar] [CrossRef]
- Taha, M.S.; Hagras, M.M.; Shalaby, M.M.; Zamzam, Y.A.; Elkolaly, R.M.; Abdelwahab, M.A.; Maxwell, S.Y. Genotypic characterization of carbapenem-resistant Klebsiella pneumoniae isolated from an Egyptian University Hospital. Pathogens 2023, 12, 121. [Google Scholar] [CrossRef]
- Córdova-Espinoza, M.G.; Giono-Cerezo, S.; Sierra-Atanacio, E.G.; Escamilla-Gutierrez, A.; Carrillo-Tapia, E.; Carrillo-Vazquez, L.I.; Mendoza-Perez, F.; Leyte-Lugo, M.; Gonzalez-Vazquez, R.; Mayorga-Reyes, L.; et al. Isolation and identification of multidrug-resistant Klebsiella pneumoniae clones from the hospital environment. Pathogens 2023, 12, 634. [Google Scholar] [CrossRef]
- Osman, E.A.; Yokoyama, M.; Altayb, H.N.; Cantillon, D.; Wille, J.; Seifert, H.; Higgins, P.G.; Al-Hassan, L. Klebsiella pneumonia in Sudan: Multidrug resistance, polyclonal dissemination, and virulence. Antibiotics 2023, 12, 233. [Google Scholar] [CrossRef]
- Kazemian, H.; Heidari, H.; Ghanavati, R.; Ghafourian, S.; Yazdani, F.; Sadeghifard, N.; Valadbeigi, H.; Maleki, A.; Pakzad, I. Phenotypic and genotypic characterization of ESβL-, AmpC-, and carbapenemase-producing Klebsiella pneumoniae and Escherichia coli isolates. Med. Princ. Pract. 2019, 28, 547–551. [Google Scholar] [CrossRef]
- Sarva, K.; Marimuthu Ragavan, R.; Tadi, L.J.; Raja, S.; Narasingam, A. Performance of carbapenemase Nordmann-Poirel, modified carbapenem inactivation, and EDTA carbapenem inactivation methods for detecting carbapenem-resistant Klebsiella pneumoniae isolates. Microb. Drug Resist. 2023, 29, 504–509. [Google Scholar] [CrossRef]
- Makhrmash, J.H.; Al-Aidy, S.R.; Qaddoori, B.H. Investigation of biofilm virulence genes prevalence in Klebsiella pneumoniae isolated from the urinary tract infections. Arch. Razi Inst. 2022, 77, 1421–1427. [Google Scholar] [CrossRef]
- Sabença, C.; Costa, E.; Sousa, S.; Barros, L.; Oliveira, A.; Ramos, S.; Igrejas, G.; Torres, C.; Poeta, P. Evaluation of the ability to form biofilms in KPC-producing and ESBL-producing Klebsiella pneumoniae isolated from clinical samples. Antibiotics 2023, 12, 1143. [Google Scholar] [CrossRef]
- Ochońska, D.; Ścibik, Ł.; Brzychczy-Włoch, M. Biofilm formation of clinical Klebsiella pneumoniae strains isolated from tracheostomy tubes and their association with antimicrobial resistance, virulence and genetic diversity. Pathogens 2021, 10, 1345. [Google Scholar] [CrossRef]
- Kot, B.; Piechota, M.; Szweda, P.; Mitrus, J.; Wicha, J.; Grużewska, A.; Witeska, M. Virulence analysis and antibiotic resistance of Klebsiella pneumoniae isolates from hospitalised patients in Poland. Sci. Rep. 2023, 13, 4448. [Google Scholar] [CrossRef]
- Davoudabadi, S.; Goudarzi, M.; Hashemi, A. Detection of virulence factors and antibiotic resistance among Klebsiella pneumoniae isolates from Iran. BioMed Res. Int. 2023, 2023, 3624497. [Google Scholar] [CrossRef]
- Shen, M.; Chen, X.; He, J.; Xiong, L.; Tian, R.; Yang, G.; Zha, H.; Wu, K. Antimicrobial resistance patterns, sequence types, virulence and carbapenemase genes of carbapenem-resistant Klebsiella pneumoniae clinical isolates from a tertiary care teaching hospital in Zunyi, China. Infect. Drug Resist. 2023, 16, 637–649. [Google Scholar] [CrossRef]
- Abbasi, E.; Ghaznavi-Rad, E. High frequency of NDM-1 and OXA-48 carbapenemase genes among Klebsiella pneumoniae isolates in central Iran. BMC Microbiol. 2023, 23, 98. [Google Scholar] [CrossRef]
- Ghotaslou, R.; Salahi, B.; Naderi, G.; Alizadeh, N. High frequency of bla(OXA-48like) producing Klebsiella pneumoniae isolated from nosocomial infection in Azerbaijan, Iran. Infect. Chemother. 2023, 55, 90–98. [Google Scholar] [CrossRef]
- El-Hariri, S.A.; Saleh, F.; Moghnieh, W.; Sokhn, E.S. Phenotypic and molecular characterization of ESBL producing Escherichia coli and Klebsiella pneumoniae among Lebanese patients. JAC-Antimicrob. Resist. 2023, 5, dlad074. [Google Scholar] [CrossRef]
- Khoshnood, S.; Akrami, S.; Saki, M.; Motahar, M.; Masihzadeh, S.; Daneshfar, S.; Meghdadi, H.; Montazeri, E.A.; Abdi, M.; Farshadzadeh, Z. Molecular evaluation of aminoglycosides resistance and biofilm formation in Klebsiella pneumoniae clinical isolates: A cross-sectional study. Health Sci. Rep. 2023, 6, e1266. [Google Scholar] [CrossRef]
- Abdulkareem, M.M.; Abdulrahman, M.A.; Yassin, N.A. Molecular detection of plasmid-mediated quinolone resistance genes among clinical isolates of Klebsiella pneumoniae during COVID-19 pandemic. Pharmacia 2023, 70, 225–231. [Google Scholar] [CrossRef]
- Swedan, S.; Alabdallah, E.A.; Ababneh, Q. Resistance to aminoglycoside and quinolone drugs among Klebsiella pneumoniae clinical isolates from northern Jordan. Heliyon 2024, 10, e23368. [Google Scholar] [CrossRef]
- Ahmadi, Z.; Noormohammadi, Z.; Ranjbar, R.; Behzadi, P. Prevalence of tetracycline resistance genes tet (A, B, C, 39) in Klebsiella pneumoniae isolated from Tehran, Iran. Iran. J. Med. Microbiol. 2022, 16, 141–147. [Google Scholar] [CrossRef]
- Bokaeian, M.; Saeidi, S.; Shahi, Z.; Kadaei, V. TetA and tetB genes in Klebsiella pneumoniae isolated from clinical samples. Gene Cell Tissue 2014, 1, e18152. [Google Scholar] [CrossRef]
Antimicrobial Agents | K. pneumoniae (N = 63) | ||
---|---|---|---|
Susceptible (%) | Intermediate Resistant (%) | Resistant (%) | |
Ceftriaxone | 1 (1.6) | 9 (14.3) | 53 (84.1) |
Cefotaxime | 0 (0) | 11 (17.5) | 52 (82.5) |
Ceftazidime | 7 (11.1) | 12 (19.1) | 44 (69.8) |
Meropenem | 7 (11.1) | 22 (34.9) | 34 (54) |
Amoxicillin/Clavulanic | 2 (3.2) | 11 (17.5) | 50 (79.3) |
Amikacin | 32 (50.8) | 12 (19.1) | 19 (30.1) |
Gentamycin | 16 (25.4) | 21 (33.3) | 26 (41.3) |
Doxycycline | 24 (38.1) | 24 (38.1) | 15 (23.8) |
Tetracycline | 22 (34.9) | 28 (44.4) | 13 (20.7) |
Ciprofloxacin | 13 (20.7) | 20 (31.7) | 30 (47.6) |
Category | Plasmid-Mediated AMR Genes | No. of Isolates (%) | Total No. of Isolates (%) | ||||
---|---|---|---|---|---|---|---|
EsβLs * | Carbapenemase * | aac(3)IIa | qnrB | tetB | |||
A | + * | + | + | + | + | 2 (3.2) | 2 (3.2) |
B | + | + | + | + | − * | 9 (14.3) | 11 (17.4) |
+ | + | + | − | + | 2 (3.2) | ||
C | + | + | + | − | − | 6 (9.5) | 22 (35) |
+ | + | − | + | − | 14 (22.2) | ||
+ | + | − | − | + | 1 (1.6) | ||
+ | − | + | + | − | 1 (1.6) | ||
D | + | + | − | − | − | 11 (17.4) | 17 (27) |
+ | − | + | − | - | 3 (4.8) | ||
+ | − | − | + | − | 2 (3.2) | ||
− | − | + | + | − | 1 (1.6) | ||
E | + | − | − | − | − | 11 (17.4) | 11 (17.4) |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Elkady, F.M.; Badr, B.M.; Alfeky, A.-A.E.; Abdulrahman, M.S.; Hashem, A.H.; Al-Askar, A.A.; AbdElgayed, G.; Hashem, H.R. Genetic Insights on Meropenem Resistance Concerning Klebsiella pneumoniae Clinical Isolates. Life 2024, 14, 1408. https://doi.org/10.3390/life14111408
Elkady FM, Badr BM, Alfeky A-AE, Abdulrahman MS, Hashem AH, Al-Askar AA, AbdElgayed G, Hashem HR. Genetic Insights on Meropenem Resistance Concerning Klebsiella pneumoniae Clinical Isolates. Life. 2024; 14(11):1408. https://doi.org/10.3390/life14111408
Chicago/Turabian StyleElkady, Fathy M., Bahaa M. Badr, Abdel-Aty E. Alfeky, Mohammed S. Abdulrahman, Amr H. Hashem, Abdulaziz A. Al-Askar, Gehad AbdElgayed, and Hany R. Hashem. 2024. "Genetic Insights on Meropenem Resistance Concerning Klebsiella pneumoniae Clinical Isolates" Life 14, no. 11: 1408. https://doi.org/10.3390/life14111408
APA StyleElkady, F. M., Badr, B. M., Alfeky, A.-A. E., Abdulrahman, M. S., Hashem, A. H., Al-Askar, A. A., AbdElgayed, G., & Hashem, H. R. (2024). Genetic Insights on Meropenem Resistance Concerning Klebsiella pneumoniae Clinical Isolates. Life, 14(11), 1408. https://doi.org/10.3390/life14111408