The Oxidative Phosphorylation and Cytoskeleton Proteins of Mouse Ovaries after 96 Hours of Hindlimb Suspension
Abstract
1. Introduction
2. Materials and Methods
2.1. Experimental Design
2.2. Measuring Cellular Respiration by Polarography
2.3. Estimation of the Relative Protein Content by Western Blotting
2.4. Estimation of the Relative Content of mRNA by RT-PCR
2.5. Statistical Analysis
3. Results
3.1. OXPHOS of Mouse Ovaries, the Content of Proteins That Form Complexes of the Respiratory Chain, and the Content of mRNA of the Corresponding Genes
3.2. Relative Content of Cytoskeletal Proteins and mRNAs Encoding Their Genes
3.3. Content of Gdf9 Gene mRNA in Mouse Ovaries after Hindlimb Suspension
4. Discussion
5. Conclusions
6. Limitations of the Study
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Jennings, R.T.; Baker, E.S. Gynecological and reproductive issues for women in space: A review. Obstet. Gynecol. Surv. 2000, 55, 109–116. [Google Scholar] [CrossRef] [Scilit]
- Mishra, B.; Luderer, U. Reproductive hazards of space travel in women and men. Nat. Rev. Endocrinol. 2019, 15, 713–730. [Google Scholar] [CrossRef] [Scilit]
- Sandler, H.; Winters, D. Physiological Responses of Women to Simulated Weightlessness: A Review of the Significant Findings of the First Female Bed Rest Study (NASA SP-340); NASA Scientific and Technical Information Office: Washington, DC, USA, 1978. [Google Scholar]
- Rock, J.A.; Fortney, S.M. Medical and surgical considerations for women in spaceflight. Obstet. Gynecol. Surv. 1984, 39, 525–535. [Google Scholar] [CrossRef] [Scilit]
- Gorbacheva, E.Y.; Toniyan, K.A.; Biriukova, Y.A.; Lukicheva, N.A.; Orlov, O.I.; Boyarintsev, V.V.; Ogneva, I.V. The state of the organs of the female reproductive system after a 5-day “dry” immersion. Int. J. Mol. Sci. 2023, 24, 4160. [Google Scholar] [CrossRef] [Scilit]
- Sventitskaya, M.A.; Ogneva, I.V. Reorganization of the mouse oocyte’ cytoskeleton after cultivation under simulated weightlessness. Life Sci. Space Res. 2024, 40, 8–18. [Google Scholar] [CrossRef] [Scilit]
- Miglietta, S.; Cristiano, L.; Espinola, M.S.B.; Masiello, M.G.; Micara, G.; Battaglione, E.; Linari, A.; Palmerini, M.G.; Familiari, G.; Aragona, C.; et al. Effects of Simulated Microgravity In Vitro on Human Metaphase II Oocytes: An Electron Microscopy-Based Study. Cells 2023, 12, 1346. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Cheng, K.; Feng, X.; Yang, C.; Ma, C.; Niu, S.; Jia, L.; Yang, X.; Liang, J.; Bo, Y.; Geng, K.; et al. Simulated microgravity reduces quality of ovarian follicles and oocytes by disrupting communications of follicle cells. NPJ Microgravity 2023, 9, 7. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhang, S.; Wu, Y.; Weng, Y.; Xu, Z.; Chen, W.; Zheng, D.; Lin, W.; Liu, J.; Zhou, Y. In vitro growth of mouse preantral follicles under simulated microgravity. J. Vis. Exp. 2017, 130, 55641. [Google Scholar] [CrossRef] [Scilit]
- Tou, J.C.; Grindeland, R.E.; Wade, C.E. Effects of diet and exposure to hindlimb suspension on estrous cycling in Sprague-Dawley rats. Am. J. Physiol. Endocrinol. Metab. 2004, 286, E425–E433. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ronca, A.E.; Baker, E.S.; Bavendam, T.G.; Beck, K.D.; Miller, V.M.; Tash, J.S.; Jenkins, M. Effects of sex and gender on adaptations to space: Reproductive health. J. Women Health 2014, 23, 967–974. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hong, X.; Ratri, A.; Choi, S.Y.; Tash, J.S.; Ronca, A.E.; Alwood, J.S.; Christenson, L.K. Effects of spaceflight aboard the International Space Station on mouse estrous cycle and ovarian gene expression. NPJ Microgravity 2021, 7, 11. [Google Scholar] [CrossRef] [Scilit]
- Suen, D.F.; Norris, K.L.; Youle, R.J. Mitochondrial dynamics and apoptosis. Genes Dev. 2008, 22, 1577–1590. [Google Scholar] [CrossRef] [Scilit]
- Park, W.; Wei, S.; Kim, B.S.; Kim, B.; Bae, S.J.; Chae, Y.C.; Ryu, D.; Ha, K.T. Diversity and complexity of cell death: A historical review. Exp. Mol. Med. 2023, 55, 1573–1594. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Anesti, V.; Scorrano, L. The relationship between mitochondrial shape and function and the cytoskeleton. Biochim. Biophys. Acta 2006, 1757, 692–699. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Bartolák-Suki, E.; Imsirovic, J.; Nishibori, Y.; Krishnan, R.; Suki, B. Regulation of mitochondrial structure and dynamics by the cytoskeleton and mechanical factors. Int. J. Mol. Sci. 2017, 18, 1812. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Shah, M.; Chacko, L.A.; Joseph, J.P.; Ananthanarayanan, V. Mitochondrial dynamics, positioning and function mediated by cytoskeletal interactions. Cell Mol. Life Sci. 2021, 78, 3969–3986. [Google Scholar] [CrossRef] [Scilit]
- Fernández Casafuz, A.B.; De Rossi, M.C.; Bruno, L. Mitochondrial cellular organization and shape fluctuations are differentially modulated by cytoskeletal networks. Sci. Rep. 2023, 13, 7543. [Google Scholar] [CrossRef] [Scilit]
- Morey-Holton, E.; Globus, R.K.; Kaplansky, A.; Durnova, G. The hindlimb unloading rat model: Literature overview, technique update and comparison with space flight data. Adv. Space Biol. Med. 2005, 10, 7–40. [Google Scholar] [CrossRef] [Scilit]
- Kuznetsov, A.V.; Veksler, V.; Gellerich, F.N.; Saks, V.; Margreiter, R.; Kunz, W.S. Analysis of mitochondrial function in situ in permeabilized muscle fibers, tissues and cells. Nat. Protoc. 2008, 3, 965–976. [Google Scholar] [CrossRef] [Scilit]
- Ogneva, I.V.; Usik, M.A.; Biryukov, N.S.; Zhdankina, Y.S. Sperm motility of mice under simulated microgravity and hypergravity. Int. J. Mol. Sci. 2020, 21, 5054. [Google Scholar] [CrossRef] [Scilit]
- Towbin, H.; Staehlin, T.; Gordon, J. Electrophoretic transfer of proteins from polyacrylamide gels to nitrocellulose sheets: Procedure and some application. Proc. Natl. Acad. Sci. USA 1979, 76, 4350–4354. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) method. Methods 2001, 2, 402–408. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Yding Andersen, C. Inhibin-B secretion and FSH isoform distribution may play an integral part of follicular selection in the natural menstrual cycle. Mol. Hum. Reprod. 2017, 23, 16–24. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ogneva, I.V.; Usik, M.A. Mitochondrial respiration in drosophila ovaries after a full cycle of oogenesis under simulated microgravity. Curr. Issues Mol. Biol. 2021, 43, 176–186. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lambert, A.J.; Brand, M.D. Reactive oxygen species production by mitochondria. Methods Mol. Biol. 2009, 554, 165–181. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wang, Y.; Javed, I.; Liu, Y.; Lu, S.; Peng, G.; Zhang, Y.; Qing, H.; Deng, Y. Effect of Prolonged Simulated Microgravity on Metabolic Proteins in Rat Hippocampus: Steps toward Safe Space Travel. J. Proteome Res. 2016, 15, 29–37. [Google Scholar] [CrossRef] [Scilit]
- Nguyen, H.P.; Tran, P.H.; Kim, K.S.; Yang, S.G. The effects of real and simulated microgravity on cellular mitochondrial function. NPJ Microgravity 2021, 7, 44. [Google Scholar] [CrossRef] [Scilit]
- Youle, R.J.; van der Bliek, A.M. Mitochondrial fission, fusion, and stress. Science 2012, 337, 1062. [Google Scholar] [CrossRef] [Scilit]
- Fernández-Vizarra, E.; Enríquez, J.A.; Pérez-Martos, A.; Montoya, J.; Fernández-Silva, P. Tissue-specific differences in mitochondrial activity and biogenesis. Mitochondrion 2011, 11, 207–213. [Google Scholar] [CrossRef] [Scilit]
- Herbers, E.; Kekäläinen, N.J.; Hangas, A.; Pohjoismäki, J.L.; Goffart, S. Tissue specific differences in mitochondrial DNA maintenance and expression. Mitochondrion 2019, 44, 85–92. [Google Scholar] [CrossRef] [Scilit]
- Schatten, H.; Lewis, M.L.; Chakrabarti, A. Spaceflight and clinorotation cause cytoskeleton and mitochondria changes and increases in apoptosis in cultured cells. Acta Astronaut. 2001, 49, 399–418. [Google Scholar] [CrossRef] [Scilit]
- Fung, T.S.; Chakrabarti, R.; Higgs, H.N. The multiple links between actin and mitochondria. Nat. Rev. Mol. Cell Biol. 2023, 24, 651–667. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Heggeness, M.H.; Simon, M.; Singer, S.J. Association of mitochondria with microtubules in cultured cells. Proc. Natl. Acad. Sci. USA 1978, 75, 3863–3866. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Usik, M.A.; Ogneva, I.V. The regulation of the DNA methylation in the ovaries of mice under 23-days hindlimb suspension. Front. Physiol. 2019, 88–91. [Google Scholar] [CrossRef] [Scilit]
- Lei, X.; Cao, Y.; Ma, B.; Zhang, Y.; Ning, L.; Qian, J.; Zhang, L.; Qu, Y.; Zhang, T.; Li, D.; et al. Development of mouse preimplantation embryos in space. Natl. Sci. Rev. 2020, 7, 1437–1446. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Chowdhury, B.; Seetharam, A.; Wang, Z.; Liu, Y.; Lossie, A.C.; Thimmapuram, J.; Irudayaraj, J. A Study of Alterations in DNA Epigenetic Modifications (5mC and 5hmC) and Gene Expression Influenced by Simulated Microgravity in Human Lymphoblastoid Cells. PLoS ONE 2016, 11, e0147514. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Singh, K.P.; Kumari, R.; Dumond, J.W. Simulated microgravity-induced epigenetic changes in human lymphocytes. J. Cell Biochem. 2010, 111, 123. [Google Scholar] [CrossRef] [Scilit]
- de Castro, F.C.; Cruz, M.H.; Leal, C.L. Role of Growth Differentiation Factor 9 and Bone Morphogenetic Protein 15 in Ovarian Function and Their Importance in Mammalian Female Fertility—A Review. Asian Australas. J. Anim. Sci. 2016, 29, 1065–1074. [Google Scholar] [CrossRef] [Scilit]
- Wu, C.; Li, L.; Wei, H.; Wu, Z.; Jiang, Q.; Zhang, S. Tail-suspended model simulating mouse oocytes maturation inhibited with microgravity. Sheng Wu Yi Xue Gong. Cheng Xue Za Zhi 2012, 29, 687–690+696. (In Chinese) [Google Scholar]
- Fareh, J.; Fagette, S.; Cottet-Emard, J.M.; Allevard, A.M.; Viso, M.; Gauquelin, G.; Gharib, C. Comparison of the effects of spaceflight and hindlimb-suspension on rat pituitary vasopressin and brainstem norepinephrine content. Adv. Space Res. 1994, 14, 365–371. [Google Scholar] [CrossRef] [Scilit]



| Primary Antibodies | Molecular Weight | Dilution | Producer | Catalog Number |
|---|---|---|---|---|
| Cytochrome c-1 | 13.5 kDa | 5 µg/mL | Abcam, Cambridge, UK | #ab13575 |
| ATP synthase F1 | 53 kDa | 1 µg/mL | Abcam, Cambridge, UK | #ab14748 |
| Beta-actin | 42 kDa | 1:500 | Santa Cruz Biotechnology, Inc., Dallas, TX, USA | #sc-81178 |
| Gamma-actin | 42 kDa | 1:500 | Santa Cruz Biotechnology, Inc., USA | #sc-65638 |
| Alpha-actinin-1 | 103 kDa | 1:500 | Santa Cruz Biotechnology, Inc., USA | #sc-17829 |
| Alpha-actinin-4 | 102 kDa | 1:500 | Santa Cruz Biotechnology, Inc., USA | #sc-393495 |
| Alpha-tubulin | 50 kDa | 1:1000 | Abcam, Cambridge, UK | #ab52866 |
| AcetylatedAlpha-tubulin | 55 kDa | 1:500 | Santa Cruz Biotechnology, Inc., USA | #sc-23950 |
| Histone H3 | 15 kDa | 1 µg/mL | Abcam, Cambridge, UK | #ab10799 |
| Gene | Primer Sequence, Forward/Reverse (5′…3′) | Product Size, bp |
|---|---|---|
| Cyc1 | GTGGAACCCTGGAACCCATA/CAAACAGTGCTGCCAGGTTTT | 106 |
| Cox4i1 | CTTCCCTGATTCCCGCGATG/ACACTCCCATGTGCTCGAAG | 208 |
| ATP5a1 | GGCAACCACAAGGTCGATTC/CGGACGACTGGCACAAAATG | 241 |
| Gapdh | TCCCAGCTTAGGTTCATCAGG/ATGAAGGGGTCGTTGATGGC | 165 |
| Actb | TGAGCTGCGTTTTACACCCT/TTTGGGGGATGTTTGCTCCA | 231 |
| Actg1 | CTGGTGGATCTCTGTGAGCA/TCAGGAGGGAAGAAACCAGA | 184 |
| Actn1 | AAACCTGAACACGGCCTTTG/ATTGACCGCCAACACTTTGC | 199 |
| Actn4 | AATCCAATGAGCACCTTCGC/TGGTGTGCTTGTTGTCGAAG | 243 |
| Tuba1c | GGCTCGCCTAGATCACAAGT/CTCATCGTCTCCTTCAGCACT | 172 |
| Gdf9 | CCTCTACAATACCGTCCGGC/CTGTAAAGGCCTCCAGGTGG | 511 |
| H3f3a | CCTCGGTGTCAGCCATCTTT/GCCATGGTAAGGACACCTCC | 140 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Gorbacheva, E.Y.; Sventitskaya, M.A.; Biryukov, N.S.; Ogneva, I.V. The Oxidative Phosphorylation and Cytoskeleton Proteins of Mouse Ovaries after 96 Hours of Hindlimb Suspension. Life 2023, 13, 2332. https://doi.org/10.3390/life13122332
Gorbacheva EY, Sventitskaya MA, Biryukov NS, Ogneva IV. The Oxidative Phosphorylation and Cytoskeleton Proteins of Mouse Ovaries after 96 Hours of Hindlimb Suspension. Life. 2023; 13(12):2332. https://doi.org/10.3390/life13122332
Chicago/Turabian StyleGorbacheva, Elena Yu., Maria A. Sventitskaya, Nikolay S. Biryukov, and Irina V. Ogneva. 2023. "The Oxidative Phosphorylation and Cytoskeleton Proteins of Mouse Ovaries after 96 Hours of Hindlimb Suspension" Life 13, no. 12: 2332. https://doi.org/10.3390/life13122332
APA StyleGorbacheva, E. Y., Sventitskaya, M. A., Biryukov, N. S., & Ogneva, I. V. (2023). The Oxidative Phosphorylation and Cytoskeleton Proteins of Mouse Ovaries after 96 Hours of Hindlimb Suspension. Life, 13(12), 2332. https://doi.org/10.3390/life13122332

