PKS5 Confers Cold Tolerance by Controlling Stomatal Movement and Regulating Cold-Responsive Genes in Arabidopsis
Abstract
1. Introduction
2. Materials and Methods
2.1. Plant Materials and Growth Conditions
2.2. Freezing Tolerance Assay
2.3. Ion Leakage Assay
2.4. Stomatal Aperture Assay
2.5. qRT-PCR Analysis
3. Results
3.1. PKS5 Is Essential for Plant Freezing Tolerance
3.2. Increases in PKS5 Activity Enhance Plant Freezing Tolerance
3.3. PKS5 Regulates Stomatal Movements under Cold Stress
3.4. PKS5 Mediates ABA-Regulated Stomatal Movements
3.5. Cold-Responsive Genes Regulated by PKS5 under Cold Stress
3.6. Cold Stress and ABA Treatment Regulate PKS5 Expression
4. Discussion
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Shi, Y.; Ding, Y.; Yang, S. Molecular regulation of CBF signaling in cold acclimation. Trends Plant Sci. 2018, 23, 623–637. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wang, X.; Song, Q.; Liu, Y.; Brestic, M.; Yang, X. The network centered on ICEs play roles in plant cold tolerance, growth and development. Planta 2022, 255, 81. [Google Scholar] [CrossRef] [Scilit]
- Li, H.; Ding, Y.; Shi, Y.; Zhang, X.; Zhang, S.; Gong, Z.; Yang, S. MPK3- and MPK6-mediated ICE1 phosphorylation negatively regulates ICE1 stability and freezing tolerance in Arabidopsis. Dev. Cell 2017, 43, 630–642.e634. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhang, H.; Zhu, J.; Gong, Z.; Zhu, J.K. Abiotic stress responses in plants. Nat. Rev. Genet. 2022, 23, 104–119. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Du, X.; Jin, Z.; Liu, D.; Yang, G.; Pei, Y. Hydrogen sulfide alleviates the cold stress through MPK4 in Arabidopsis thaliana. Plant Physiol. Biochem. 2017, 120, 112–119. [Google Scholar] [CrossRef] [Scilit]
- Lindfors, L.; Hölttä, T.; Lintunen, A.; Porcar-Castell, A.; Nikinmaa, E.; Juurola, E. Dynamics of leaf gas exchange, chlorophyll fluorescence and stem diameter changes during freezing and thawing of Scots pine seedlings. Tree Physiol. 2015, 35, 1314–1324. [Google Scholar] [CrossRef] [Scilit]
- Du, X.; Jin, Z.; Liu, Z.; Liu, D.; Zhang, L.; Ma, X.; Yang, G.; Liu, S.; Guo, Y.; Pei, Y. H2S persulfidated and increased kinase activity of MPK4 to response cold stress in Arabidopsis. Front. Mol. Biosci. 2021, 8, 635470. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Gobel, L.; Coners, H.; Hertel, D.; Willinghofer, S.; Leuschner, C. The role of low soil temperature for photosynthesis and stomatal conductance of three graminoids from different elevations. Front. Plant Sci. 2019, 10, 330. [Google Scholar] [CrossRef] [Scilit]
- Chen, K.; Li, G.J.; Bressan, R.A.; Song, C.P.; Zhu, J.K.; Zhao, Y. Abscisic acid dynamics, signaling, and functions in plants. J. Integr. Plant Biol. 2020, 62, 25–54. [Google Scholar] [CrossRef] [Scilit]
- Verma, V.; Ravindran, P.; Kumar, P.P. Plant hormone-mediated regulation of stress responses. BMC Plant Biol. 2016, 16, 86. [Google Scholar] [CrossRef] [Scilit]
- Wang, Y.G.; Fu, F.L.; Yu, H.Q.; Hu, T.; Zhang, Y.Y.; Tao, Y.; Zhu, J.K.; Zhao, Y.; Li, W.C. Interaction network of core ABA signaling components in maize. Plant Mol. Biol. 2018, 96, 245–263. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Fabregas, N.; Yoshida, T.; Fernie, A.R. Role of Raf-like kinases in SnRK2 activation and osmotic stress response in plants. Nat. Commun. 2020, 11, 6184. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Agurla, S.; Gahir, S.; Munemasa, S.; Murata, Y.; Raghavendra, A.S. Mechanism of stomatal closure in plants exposed to drought and cold Stress. Adv. Exp. Med. Biol. 2018, 1081, 215–232. [Google Scholar] [PubMed]
- Waadt, R.; Seller, C.A.; Hsu, P.K.; Takahashi, Y.; Munemasa, S.; Schroeder, J.I. Plant hormone regulation of abiotic stress responses. Nat. Rev. Mol. Cell Biol. 2022, 23, 680–694. [Google Scholar] [CrossRef] [Scilit]
- Fuglsang, A.T.; Guo, Y.; Cuin, T.A.; Qiu, Q.; Song, C.; Kristiansen, K.A.; Bych, K.; Schulz, A.; Shabala, S.; Schumaker, K.S.; et al. Arabidopsis protein kinase PKS5 inhibits the plasma membrane H+-ATPase by preventing interaction with 14-3-3 protein. Plant Cell 2007, 19, 1617–1634. [Google Scholar] [CrossRef] [Scilit]
- Yang, Z.; Wang, C.; Xue, Y.; Liu, X.; Chen, S.; Song, C.; Yang, Y.; Guo, Y. Calcium-activated 14-3-3 proteins as a molecular switch in salt stress tolerance. Nat. Commun. 2019, 10, 1199. [Google Scholar] [CrossRef] [Scilit]
- Yang, Y.; Qin, Y.; Xie, C.; Zhao, F.; Zhao, J.; Liu, D.; Chen, S.; Fuglsang, A.T.; Palmgren, M.G.; Schumaker, K.S.; et al. The Arabidopsis chaperone J3 regulates the plasma membrane H+-ATPase through interaction with the PKS5 kinase. Plant Cell 2010, 22, 1313–1332. [Google Scholar] [CrossRef] [Scilit]
- Zhou, X.; Hao, H.; Zhang, Y.; Bai, Y.; Zhu, W.; Qin, Y.; Yuan, F.; Zhao, F.; Wang, M.; Hu, J.; et al. SOS2-LIKE PROTEIN KINASE5, an SNF1-RELATED PROTEIN KINASE3-Type protein kinase, is important for abscisic acid responses in Arabidopsis through phosphorylation of ABSCISIC ACID-INSENSITIVE5. Plant Physiol. 2015, 168, 659–676. [Google Scholar] [CrossRef] [Scilit]
- Saito, S.; Hamamoto, S.; Moriya, K.; Matsuura, A.; Sato, Y.; Muto, J.; Noguchi, H.; Yamauchi, S.; Tozawa, Y.; Ueda, M.; et al. N-myristoylation and S-acylation are common modifications of Ca2+-regulated Arabidopsis kinases and are required for activation of the SLAC1 anion channel. New Phytol. 2018, 218, 1504–1521. [Google Scholar] [CrossRef] [Scilit]
- Merlot, S.; Leonhardt, N.; Fenzi, F.; Valon, C.; Costa, M.; Piette, L.; Vavasseur, A.; Genty, B.; Boivin, K.; Muller, A.; et al. Constitutive activation of a plasma membrane H+-ATPase prevents abscisic acid-mediated stomatal closure. EMBO J. 2007, 26, 3216–3226. [Google Scholar] [CrossRef] [Scilit]
- Ding, Y.; Li, H.; Zhang, X.; Xie, Q.; Gong, Z.; Yang, S. OST1 kinase modulates freezing tolerance by enhancing ICE1 stability in Arabidopsis. Dev. Cell 2015, 32, 278–289. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wei, H.; Jing, Y.; Zhang, L.; Kong, D. Phytohormones and their crosstalk in regulating stomatal development and patterning. J. Exp. Bot. 2021, 72, 2356–2370. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Liu, Z.; Jia, Y.; Ding, Y.; Shi, Y.; Li, Z.; Guo, Y.; Gong, Z.; Yang, S. Plasma Membrane CRPK1-Mediated Phosphorylation of 14-3-3 Proteins Induces Their Nuclear Import to Fine-Tune CBF Signaling during Cold Response. Mol. Cell 2017, 66, 117–128.e115. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Xie, C.; Zhou, X.; Deng, X.; Guo, Y. PKS5, a SNF1-related kinase, interacts with and phosphorylates NPR1, and modulates expression of WRKY38 and WRKY62. J. Genet. Genom. = Yi Chuan Xue Bao 2010, 37, 359–369. [Google Scholar] [CrossRef] [Scilit]
- Vahisalu, T.; Kollist, H.; Wang, Y.-F.; Nishimura, N.; Chan, W.-Y.; Valerio, G.; Lamminmäki, A.; Brosché, M.; Moldau, H.; Desikan, R.; et al. SLAC1 is required for plant guard cell S-type anion channel function in stomatal signalling. Nature 2008, 452, 487–491. [Google Scholar] [CrossRef] [Scilit]
- Falhof, J.; Pedersen, J.T.; Fuglsang, A.T.; Palmgren, M. Plasma Membrane H(+)-ATPase Regulation in the Center of Plant Physiology. Mol. Plant 2016, 9, 323–337. [Google Scholar] [CrossRef] [Scilit]
- Yan, S.; McLamore, E.S.; Dong, S.; Gao, H.; Taguchi, M.; Wang, N.; Zhang, T.; Su, X.; Shen, Y. The role of plasma membrane H(+) -ATPase in jasmonate-induced ion fluxes and stomatal closure in Arabidopsis thaliana. Plant J. Cell Mol. Biol. 2015, 83, 638–649. [Google Scholar] [CrossRef] [Scilit]
- Wang, Y.; Noguchi, K.; Ono, N.; Inoue, S.; Terashima, I.; Kinoshita, T. Overexpression of plasma membrane H+-ATPase in guard cells promotes light-induced stomatal opening and enhances plant growth. Proc. Natl. Acad. Sci. USA 2014, 111, 533–538. [Google Scholar] [CrossRef] [Scilit]
- Kim, H.S.; Oh, J.M.; Luan, S.; Carlson, J.E.; Ahn, S.J. Cold stress causes rapid but differential changes in properties of plasma membrane H+-ATPase of camelina and rapeseed. J. Plant Physiol. 2013, 170, 828–837. [Google Scholar] [CrossRef] [Scilit]







| Primer | Sequence (5′-3′) |
|---|---|
| PKS5-F | GAAGGTGCTAAAGTTGATGTATGGTCT |
| PKS5-R | CGTCATCGTGGAACTTGATCTGTTT |
| CBF1-F | GCATGTCTCAACTTCGCTGA |
| CBF1-R | ATCGTCTCCTCCATGTCCAG |
| CBF2-F | TGACGTGTCCTTATGGAGCTA |
| CBF2-R | CTGCACTCAAAAACATTTGCA |
| CBF3-F | GATGACGACGTATCGTTATGGA |
| CBF3-R | TACACTCGTTTCTCAGTTTTACAAAC |
| COR15A-F | GCTTCAGATTTCGTGACGGATAAAAC |
| COR15A-R | GCAAAACATTAAAGAATGTGACGGTG |
| KIN1-F | ACCAACAAGAATGCCTTCCA |
| KIN1-R | CCGCATCCGATACACTCTTT |
| RD29A-F | GCCGAGAAACTTCAGATTGG |
| RD29A-R | CCATTCCTCCTCCTCCTTTC |
| ACTIN2/8-F | GGTAACATTGTGCTCAGTGGTGG |
| ACTIN2/8-R | AACGACCTTAATCTTCATGCTGC |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Sun, C.; Zhu, L.; Cao, L.; Qi, H.; Liu, H.; Zhao, F.; Han, X. PKS5 Confers Cold Tolerance by Controlling Stomatal Movement and Regulating Cold-Responsive Genes in Arabidopsis. Life 2022, 12, 1633. https://doi.org/10.3390/life12101633
Sun C, Zhu L, Cao L, Qi H, Liu H, Zhao F, Han X. PKS5 Confers Cold Tolerance by Controlling Stomatal Movement and Regulating Cold-Responsive Genes in Arabidopsis. Life. 2022; 12(10):1633. https://doi.org/10.3390/life12101633
Chicago/Turabian StyleSun, Chengyan, Lin Zhu, Linlin Cao, Huimin Qi, Huijuan Liu, Fengyun Zhao, and Xiuli Han. 2022. "PKS5 Confers Cold Tolerance by Controlling Stomatal Movement and Regulating Cold-Responsive Genes in Arabidopsis" Life 12, no. 10: 1633. https://doi.org/10.3390/life12101633
APA StyleSun, C., Zhu, L., Cao, L., Qi, H., Liu, H., Zhao, F., & Han, X. (2022). PKS5 Confers Cold Tolerance by Controlling Stomatal Movement and Regulating Cold-Responsive Genes in Arabidopsis. Life, 12(10), 1633. https://doi.org/10.3390/life12101633
