Multimorbidity Through the Lens of the Eye: Pathogenic Variants for Multiple Systemic Disorders Found in an Autosomal Dominant Congenital Cataract Cohort
Abstract
1. Introduction
2. Materials and Methods
2.1. Phenotyping
2.2. Whole Exome Sequencing (WES) and Bioinformatic Analyses
2.3. Sanger Sequencing
3. Results
- (i)
- A novel pathogenic mis-sense variant in SMO (NM_005631.5: c.1801G>A; p.A601; exon 10; chromosome 7q32.1);
- (ii)
- A known pathogenic mis-sense variant in COL4A3 (NM_000091.5: c.746C>T; p.T255M; exon 13; chromosome 2q36.3);
- (iii)
- A known pathogenic nonsense variant in ACTL9 (NM_178525.5: c.1209C>G; p.Y403*; exon 1; chromosome 19p13.2);
- (iv)
- A pathogenic mis-sense variant in OPA1 (NM_130836.3: c.1257A>G; p.I419M; exon 13; chromosome 3q29).
- (i)
- A novel likely pathogenic variant in RSPH4A (NM_001010892.3: c.1129delG; p.E377Kfs*11; exon 3; chromosome 6q22.1);
- (ii)
- A nonsense variant (NM_ 004563.4: c.424C>T; p.R142*) in PCK2 with uncertain significance;
- (iii)
- A frameshift variant in NOD2 (NM_022162.3: c.3019dup; p.L1007P*; exon 11; chromosome 16).
- (i)
- A novel variant in GJA8 (NM_005267.5: c.77T>C; p.L26P; exon 2; chromosome 1) causing congenital cataract;
- (ii)
- A novel CBS variant (NM_001178008.2: c.1162G>T; p.D388Y; exon 13; chromosome 21).
- (i)
- A novel variant in GJA8 (NM_005267.5: c.601G>A; p.E201K; exon 2; chromosome 1);
- (ii)
- A recurrent heterozygous pathogenic variant in the GALT gene (NM_000155.4: c.584T>C; p.L195P; exon 7; chromosome 9p13.3).
- (i)
- A pathogenic variant in the CRYGD gene (NM_006891.4: c.470G>A; p.W157*; exon 3; chromosome 2q33.3);
- (ii)
- A novel variant in POMGNT1 (NM_001243766.2: c.1666G>A; p.D556N; exon 20; chromosome1p34.1).
- (i)
- A known variant in CRYBA1 (NM_005208.5: c.272_274del; p.G91del; exon 4; chromosome 17);
- (ii)
- A novel variant in CRYAA (NM_000394.4: c.392G>T; p.C131F; exon 3; chromosome 21q22.3).
- (i)
- A mis-sense variant of uncertain significance in CBS (NM_000071.3: c.670C>T; p.R224C; exon 8; chromosome 21q22.3);
- (ii)
- A novel mis-sense variant in NOD2 (NM_022162.3: c.2722G>C; p.G908R; exon 8; chromosome 16) (Figure 3).
- (i)
- A recurrent CHMP4B variant (NM_176812.5: c.481G>C; p.E161Q; exon 3; chromosome 20q11.22), known to cause congenital cataract;
- (ii)
- An LRP5 variant (NM_002335.4: c.3779C>T; p.S1260F; exon 18; chromosome 11) known to cause vitreoretinopathy, primary open-angle glaucoma (POAG), congenital cataract, and osteoporosis–pseudoglioma syndrome (Figure 3).
- (i)
- A recurrent GJA8 variant (NM_005267.5: c.64G>C; p.G22R);
- (ii)
- A novel GJA8 variant (c.70G>C; p.G24L; exon 2; chromosome 1q21.1).
4. Discussion
4.1. Genes for Congenital Cataract
4.2. Genes Associated with Other Systemic Disorders
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Ionides, A.; Francis, P.; Berry, V.; Mackay, D.; Bhattacharya, S.; Shiels, A.; Moore, A. Clinical and genetic heterogeneity in autosomal dominant cataract. Br. J. Ophthalmol. 1999, 83, 802–808. [Google Scholar] [CrossRef]
- Churchill, A.; Graw, J. Clinical and experimental advances in congenital and paediatric cataracts. Philos. Trans. R. Soc. B Biol. Sci. 2011, 366, 1234–1249. [Google Scholar] [CrossRef] [PubMed]
- Francis, P.J. The genetics of childhood cataract. J. Med. Genet. 2000, 37, 481–488. [Google Scholar] [CrossRef] [PubMed]
- Shiels, A. Through the Cat-Map Gateway: A Brief History of Cataract Genetics. Genes 2024, 15, 785. [Google Scholar] [CrossRef] [PubMed]
- Berry, V.; Georgiou, M.; Fujinami, K.; Quinlan, R.; Moore, A.; Michaelides, M. Inherited cataracts: Molecular genetics, clinical features, disease mechanisms and novel therapeutic approaches. Br. J. Ophthalmol. 2020, 104, 1331–1337. [Google Scholar] [CrossRef]
- François, J. Genetics of cataract. Ophthalmologica 1982, 184, 61–71. [Google Scholar] [CrossRef]
- Ding, X.; Patel, M.; Herzlich, A.A.; Sieving, P.C.; Chan, C.-C. Ophthalmic Pathology of Nance-Horan Syndrome: Case Report and Review of the Literature. Ophthalmic Genet. 2009, 30, 127–135. [Google Scholar] [CrossRef]
- Loi, M. Lowe syndrome. Orphanet J. Rare Dis. 2006, 1, 16. [Google Scholar] [CrossRef]
- Berry, V.; Pontikos, N.; Ionides, A.; Kalitzeos, A.; Quinlan, R.A.; Michaelides, M. Pathogenic variants in the CYP21A2 gene cause isolated autosomal dominant congenital posterior polar cataracts. Ophthalmic Genet. 2022, 43, 218–223. [Google Scholar] [CrossRef]
- Berry, V.; Ionides, A.; Georgiou, M.; Quinlan, R.A.; Michaelides, M. Multimorbidity due to novel pathogenic variants in the WFS1/RP1/NOD2 genes: Autosomal dominant congenital lamellar cataract, retinitis pigmentosa and Crohn’s disease in a British family. BMJ Open Ophthalmol. 2023, 8, e001252. [Google Scholar] [CrossRef]
- Pontikos, N.; Yu, J.; Moghul, I.; Withington, L.; Blanco-Kelly, F.; Vulliamy, T.; Wong, T.L.E.; Murphy, C.; Cipriani, V.; Fiorentino, A.; et al. Phenopolis: An open platform for harmonization and analysis of genetic and phenotypic data. Bioinformatics 2017, 33, 2421–2423. [Google Scholar] [CrossRef] [PubMed]
- McLaren, W.; Gil, L.; Hunt, S.E.; Riat, H.S.; Ritchie, G.R.S.; Thormann, A.; Flicek, P.; Cunningham, F. The Ensembl Variant Effect Predictor. Genome Biol. 2016, 17, 122. [Google Scholar] [CrossRef] [PubMed]
- Glusman, G.; Caballero, J.; Mauldin, D.E.; Hood, L.; Roach, J.C. Kaviar: An accessible system for testing SNV novelty. Bioinformatics 2011, 27, 3216–3217. [Google Scholar] [CrossRef]
- Cherian, M.; Smith, J.B.; Jiang, X.-Y.; Abraham, E.C. Influence of Protein-Glutathione Mixed Disulfide on the Chaperone-like Function of α-Crystallin. J. Biol. Chem. 1997, 272, 29099–29103. [Google Scholar] [CrossRef] [PubMed]
- Shiels, A.; Bennett, T.M.; Knopf, H.L.S.; Yamada, K.; Yoshiura, K.; Niikawa, N.; Shim, S.; Hanson, P.I. CHMP4B, a Novel Gene for Autosomal Dominant Cataracts Linked to Chromosome 20q. Am. J. Hum. Genet. 2007, 81, 596–606. [Google Scholar] [CrossRef]
- Zhou, Y.; Bennett, T.M.; White, T.W.; Shiels, A. Charged multivesicular body protein 4b forms complexes with gap junction proteins during lens fiber cell differentiation. FASEB J. 2023, 37, e22801. [Google Scholar] [CrossRef]
- Carvalho, B.; Marques, C.J.; Santos-Silva, R.; Fontoura, M.; Carvalho, D.; Carvalho, F. Congenital Adrenal Hyperplasia Due to 21-Hydroxylase Deficiency: An Update on Genetic Analysis of CYP21A2 Gene. Exp. Clin. Endocrinol. Diabetes 2021, 129, 477–481. [Google Scholar] [CrossRef]
- Pallan, P.S.; Wang, C.; Lei, L.; Yoshimoto, F.K.; Auchus, R.J.; Waterman, M.R.; Guengerich, F.P.; Egli, M. Human Cytochrome P450 21A2, the Major Steroid 21-Hydroxylase. J. Biol. Chem. 2015, 290, 13128–13143. [Google Scholar] [CrossRef]
- Zheng, Y.; Wang, P.; Li, S.; Long, Y.; Jiang, Y.; Guo, D.; Jia, X.; Liu, M.; Zeng, Y.; Xiao, X.; et al. Clinical and genetic landscape of optic atrophy in 826 families: Insights from 50 nuclear genes. Brain 2024, 148, 1604–1620. [Google Scholar] [CrossRef]
- Nasca, A.; Rizza, T.; Doimo, M.; Legati, A.; Ciolfi, A.; Diodato, D.; Calderan, C.; Carrara, G.; Lamantea, E.; Aiello, C.; et al. Not only dominant, not only optic atrophy: Expanding the clinical spectrum associated with OPA1 mutations. Orphanet J. Rare Dis. 2017, 12, 89. [Google Scholar] [CrossRef]
- Takahashi, H.; Kanesaki, H.; Igarashi, T.; Kameya, S.; Yamaki, K.; Mizota, A.; Kudo, A.; Miyagoe-Suzuki, Y.; Takeda, S.; Takahashi, H. Reactive gliosis of astrocytes and Müller glial cells in retina of POMGnT1-deficient mice. Mol. Cell Neurosci. 2011, 47, 119–130. [Google Scholar] [CrossRef] [PubMed]
- Xu, M.; Yamada, T.; Sun, Z.; Eblimit, A.; Lopez, I.; Wang, F.; Manya, H.; Xu, S.; Zhao, L.; Li, Y.; et al. Mutations in POMGNT1 cause non-syndromic retinitis pigmentosa. Hum. Mol. Genet. 2016, 25, 1479–1488. [Google Scholar] [CrossRef] [PubMed]
- Clement, E.M.; Godfrey, C.; Tan, J.; Brockington, M.; Torelli, S.; Feng, L.; Brown, S.C.; Jimenez-Mallebrera, C.; Sewry, C.A.; Longman, C.; et al. Mild POMGnT1 mutations underlie a novel limb-girdle muscular dystrophy variant. Arch. Neurol. 2008, 65, 137–141. [Google Scholar] [CrossRef] [PubMed]
- Cavodeassi, F.; Creuzet, S.; Etchevers, H.C. The hedgehog pathway and ocular developmental anomalies. Hum. Genet. 2019, 138, 917–936. [Google Scholar] [CrossRef]
- Twigg, S.R.F.; Hufnagel, R.B.; Miller, K.A.; Zhou, Y.; McGowan, S.J.; Taylor, J.; Craft, J.; Taylor, J.C.; Santoro, S.L.; Huang, T.; et al. A Recurrent Mosaic Mutation in SMO, Encoding the Hedgehog Signal Transducer Smoothened, Is the Major Cause of Curry-Jones Syndrome. Am. J. Hum. Genet. 2016, 98, 1256–1265. [Google Scholar] [CrossRef]
- Zhang, J.; Li, Y.; Fan, Y.; Wu, D.; Xu, J. Compound heterozygous mutations in SMO associated with anterior segment dysgenesis and morning glory syndrome. Gene 2019, 713, 143973. [Google Scholar] [CrossRef]
- Sohar, E. A heredo-familial syndrome characterized by renal disease, inner ear deafness, and ocular changes. Harefuah 1954, 47, 161–162. [Google Scholar]
- Savige, J. Heterozygous Pathogenic COL4A3 and COL4A4 Variants (Autosomal Dominant Alport Syndrome) Are Common, and Not Typically Associated with End-Stage Kidney Failure, Hearing Loss, or Ocular Abnormalities. Kidney Int. Rep. 2022, 7, 1933–1938. [Google Scholar] [CrossRef]
- Truong, B.T.; Yarza, T.K.L.; Bootpetch Roberts, T.; Roberts, S.; Xu, J.; Steritz, M.J.; Tobias-Grasso, C.A.M.; Azamian, M.; Lalani, S.R.; Mohlke, K.L.; et al. Exome sequencing reveals novel variants and unique allelic spectrum for hearing impairment in Filipino cochlear implantees. Clin. Genet. 2019, 95, 634–636. [Google Scholar] [CrossRef]
- Mallett, A.J.; McCarthy, H.J.; Ho, G.; Holman, K.; Farnsworth, E.; Patel, C.; Fletcher, J.T.; Mallawaarachchi, A.; Quinlan, C.; Bennetts, B.; et al. Massively parallel sequencing and targeted exomes in familial kidney disease can diagnose underlying genetic disorders. Kidney Int. 2017, 92, 1493–1506. [Google Scholar] [CrossRef]
- Belamkar, A.; Luo, Q.; Mahajan, N.; Abhyankar, S.; Jones, B.A.; Sodhi, R.K.; Pattabiraman, P.P.; Levi, M.; Bhatwadekar, A.D. Characterization of the Ocular Phenotype in a Col4a3 Knockout Mouse Model of Alport Syndrome. Investig. Ophthalmol. Vis. Sci. 2024, 65, 29. [Google Scholar] [CrossRef] [PubMed]
- Dai, J.; Zhang, T.; Guo, J.; Zhou, Q.; Gu, Y.; Zhang, J.; Hu, L.; Zong, Y.; Song, J.; Zhang, S.; et al. Homozygous pathogenic variants in ACTL9 cause fertilization failure and male infertility in humans and mice. Am. J. Hum. Genet. 2021, 108, 469–481. [Google Scholar] [CrossRef]
- De Jesús-Rojas, W.; Meléndez-Montañez, J.; Muñiz-Hernández, J.; Marra-Nazario, A.; Alvarado-Huerta, F.; Santos-López, A.; Ramos-Benitez, M.J.; Mosquera, R.A. The RSPH4A Gene in Primary Ciliary Dyskinesia. Int. J. Mol. Sci. 2023, 24, 1936. [Google Scholar] [CrossRef]
- Fan, J.; Lerner, J.; Wyatt, M.K.; Cai, P.; Peterson, K.; Dong, L.; Wistow, G. The klotho-related protein KLPH (lctl) has preferred expression in lens and is essential for expression of clic5 and normal lens suture formation. Exp. Eye Res. 2018, 169, 111–121. [Google Scholar] [CrossRef] [PubMed]
- Allegrini, D.; Autelitano, A.; Fogagnolo, P.; De Cillà, S.; Piozzi, E.; Mazza, M.; Paci, S.; Montanari, C.; Riva, E.; Rossetti, L. Lens opacities in glycogenoses type I and III. Can. J. Ophthalmol. 2015, 50, 480–484. [Google Scholar] [CrossRef]
- Xu, M.; Yang, J.; Sun, J.; Xing, X.; Liu, Z.; Liu, T. A novel mutation in PCK2 gene causes primary angle-closure glaucoma. Aging 2021, 13, 23338–23347. [Google Scholar] [CrossRef] [PubMed]
- De Zeeuw, P.; Treps, L.; García-Caballero, M.; Harjes, U.; Kalucka, J.; De Legher, C.; Brepoels, K.; Peeters, K.; Vinckier, S.; Souffreau, J.; et al. The gluconeogenesis enzyme PCK2 has a non-enzymatic role in proteostasis in endothelial cells. Commun. Biol. 2024, 7, 618. [Google Scholar] [CrossRef]
- Strober, W.; Watanabe, T. NOD2, an intracellular innate immune sensor involved in host defense and Crohn’s disease. Mucosal Immunol. 2011, 4, 484–495. [Google Scholar] [CrossRef]
- Schnitzler, F.; Friedrich, M.; Wolf, C.; Angelberger, M.; Diegelmann, J.; Olszak, T.; Beigel, F.; Tillack, C.; Stallhofer, J.; Göke, B.; et al. The NOD2 p.Leu1007fsX1008 Mutation (rs2066847) Is a Stronger Predictor of the Clinical Course of Crohn’s Disease than the FOXO3A Intron Variant rs12212067. PLoS ONE 2014, 9, e108503. [Google Scholar] [CrossRef]
- Kozich, V.; Kraus, J.P. Cystathionine β-Synthase (CBS) Deficiency: Genetics. In Encyclopedia of Life Sciences; Wiley: Hoboken, NJ, USA, 2006. [Google Scholar] [CrossRef]
- Harvey Mudd, S.S.; Levy, H.L.; Kraus, J.P. Disorders of Transsulfuration. In The Online Metabolic and Molecular Bases of Inherited Disease; McGraw-Hill Education: New York, NY, USA, 2019. [Google Scholar] [CrossRef]
- Persa, C.; Osmotherly, K.; Chao-Wei Chen, K.; Moon, S.; Lou, M.F. The distribution of cystathionine β-synthase (CBS) in the eye: Implication of the presence of a trans-sulfuration pathway for oxidative stress defense. Exp. Eye Res. 2006, 83, 817–823. [Google Scholar] [CrossRef]
- Dobrowolski, S.F.; Banas, R.A.; Suzow, J.G.; Berkley, M.; Naylor, E.W. Analysis of Common Mutations in the Galactose-1-Phosphate Uridyl Transferase Gene. J. Mol. Diagn. 2003, 5, 42–47. [Google Scholar] [CrossRef] [PubMed]
- Koh, K.; Ishiura, H.; Beppu, M.; Shimazaki, H.; Ichinose, Y.; Mitsui, J.; Kuwabara, S.; Tsuji, S.; Takiyama, Y. Novel mutations in the ALDH18A1 gene in complicated hereditary spastic paraplegia with cerebellar ataxia and cognitive impairment. J. Hum. Genet. 2018, 63, 1009–1013. [Google Scholar] [CrossRef] [PubMed]
- Wolthuis, D.F.G.J.; Van Asbeck, E.; Mohamed, M.; Gardeitchik, T.; Lim-Melia, E.R.; Wevers, R.A.; Morava, E. Cutis laxa, fat pads and retinopathy due to ALDH18A1 mutation and review of the literature. Eur. J. Paediatr. Neurol. 2014, 18, 511–515. [Google Scholar] [CrossRef]
- Ai, M.; Heeger, S.; Bartels, C.F.; Schelling, D.K. Clinical and Molecular Findings in Osteoporosis-Pseudoglioma Syndrome. Am. J. Human Genet. 2005, 77, 741–753. [Google Scholar] [CrossRef]
- Gong, Y.; Slee, R.B.; Fukai, N.; Rawadi, G.; Roman-Roman, S.; Reginato, A.M.; Wang, H.; Cundy, T.; Glorieux, F.H.; Osteoporosis-Pseudoglioma Syndrome Collaborative Group. LDL receptor-related protein 5 (LRP5) affects bone accrual and eye development. Cell 2001, 107, 513–523. [Google Scholar] [CrossRef]
- Kitic, N.; Chapron, T.; Metge-Galatoire, F.; Chehaibou, I.; Caputo, G.; Abdelmassih, Y. Early-onset of familial exudative vitreoretinopathy: Clinical Characteristics, Management, and Outcomes. Retina 2024, 44, 669–679. [Google Scholar] [PubMed]
- Van Reeuwijk, J. POMT2 mutations cause dystroglycan hypoglycosylation and Walker-Warburg syndrome. J. Med. Genet. 2005, 42, 907–912. [Google Scholar] [CrossRef]
- Jones, J.L.; McComish, B.J.; Staffieri, S.E.; Souzeau, E.; Kearns, L.S.; Elder, J.E.; Charlesworth, J.C.; Mackey, D.A.; Ruddle, J.B.; Taranath, D.; et al. Pathogenic genetic variants identified in Australian families with paediatric cataract. BMJ Open Ophthalmol. 2022, 7, e001064. [Google Scholar] [CrossRef]



| Genes | HGVSc | HGVSp | GERP | CADD | REVEL | AlphaMissense | In Silico Pathogenicity |
|---|---|---|---|---|---|---|---|
| SMO | c.1801G>A | p.A601T | 5.8 | 28.1 | Uncertain /0.53 | Benign Supporting/0.24 | Novel/Likely Pathogenic |
| COL4A3 | c.764C>T | p.T255M | 5.6 | 27.1 | Benign Moderate/ 0.30 | Benign Moderate/0.09 | Likely Pathogenic |
| ACTL9 | c.1209C>G | p.Y403* | 4.5 | 36.0 | - | - | VUS (ClinVar-Pathogenic) |
| OPA1 | c.1257A>G | p.I419M | 5.7 | 24.4 | Pathogenic Moderate /0.94 | Uncertain/0.55 | Recurrent/Likely Pathogenic |
| RSPH4A | c.1129delG | p.E377Kfs*11 | 5.3 | 26.1 | - | - | Likely Pathogenic |
| PCK2 | c.424C>T | p.R142* | 5.40 | 26.1 | - | - | VUS |
| NOD2 | c.3019dup | p. L1007P* | 5.5 | 35.0 | - | - | VUS |
| CBS | c.1162G>T | p.D388Y | 4.7 | 32.0 | Pathogenic Moderate /0.87 | Uncertain/0.55 | Novel/Likely Pathogenic |
| GJA8 | c.77T>C | p.L26P | 5.0 | 25.5 | Pathogenic/Strong/0.99 | Pathogenic/Strong/0.99 | Novel/Likely Pathogenic |
| GALT | c.584T>C | p. L195P | 4.78 | 26.1 | Pathogenic Moderate /0.92 | Uncertain | Recurrent/Pathogenic |
| GJA8 | c.601G>A | p.E201K | 4.8 | 27.0 | Pathogenic/Strong/0.99 | Pathogenic/Strong/0.99 | Novel/Pathogenic |
| ALDH18A1 | c.1448G>A | p.R483H | 5.5 | 32.0 | Pathogenic Moderate /0.85 | Pathogenic/Moderate/0.98 | Likely Pathogenic |
| POMGNT1 | c.1666G>A | p.D556N | 6.0 | 27.0 | Uncertain /0.48 | Benign Moderate/0.13 | Conflicting |
| CRYAA | c.392G>T | p.C131F | 3.7 | 25.0 | - | Pathogenic/Moderate/0.97 | Novel/Likely Pathogenic |
| CBS | c.670C>T | p.R224C | 4.6 | 27.5 | Pathogenic Moderate /0.93 | Benign Supporting/0.21 | Novel Pathogenic/Moderate |
| NOD2 | c.2722G>C | p. G908R | 5.9 | 31.0 | - | Pathogenic Supporting/0.84 | VUS |
| CHMP4B | c.481G>C | E161Q | 6.0 | 32.0 | Uncertain /0.63 | Pathogenic Supporting/0.87 | Recurrent/Pathogenic |
| LRP5 | c.3779C>T | p.S1260F | 4.3 | 26.2 | Pathogenic Moderate /0.87 | Uncertain/0.6 | Pathogenic/Strong |
| POMT2 | c.1721A>G | p.Y574C | 5.67 | 26.3 | Pathogenic Supporting /0.76 | Benign Supporting/0.26 | VUS |
| GJA8 | c.64G>C | p.G22R | 5.03 | 29 | Pathogenic/Strong/0.98 | Pathogenic/Moderate/0.99 | Recurrent/Pathogenic |
| GJA8 | c.70G>C | p.V24L | 5.03 | - | Pathogenic Moderate /0.86 | Pathogenic Supporting/0.78 | Novel/Pathogenic |
| GJA8 | c.590C>T | S197F | 4.8 | 26 | Pathogenic/Strong/0.98 | Pathogenic/Moderate/0.99 | Novel/Pathogenic |
| Gene | Forward Primers | Reverse Primers |
|---|---|---|
| SMO | ttcttcacgctccttcccta | cagaaatatcctggggcagt |
| COL4A3 | tttacttacgggccaagctg | aaggacgggaaggaatcaat |
| ACTL9 | gcaaggagctgttccagtgt | catggggaaggtgggttta |
| OPA1 | gggttgcaattcatttcagtg | gagccatgcctgatgtcac |
| RSPH4A | actgcacccagccaattt | tgcaataacaatttgtgcaggta |
| PCK2 | aaagtgggtctagggacaagg | catgctgaatggaagcacat |
| NOD2 | tgcaggtacttaaccactatcct | tcagatccttcacatgcaga |
| CBS | accagtgaggtccaggagag | gggggatcaggataaggaca |
| GJA8 | tctgcacaaaggaagcactg | gacacagaggccacagacaa |
| GALT | gggtttcttggctgagtctg | tgctaaggcctcctagcaagt |
| ALDH18A1 | cctgccaggtctgctacttt | cgttgtgcacatgtaccctaga |
| POMGNT1 | gtgggacacacccatgaagt | ttgaagattccagagcaaagg |
| CRYAA | caggggcatgaatccataaa | gggaagcaaaggaagacaga |
| CBS | aaatccccaattctcacatcc | aggagttcaccaaggagagg |
| NOD2 | ttgggttaagtttggccatc | ggacaagggacatttccaag |
| CHMP4B | acccctcacagggagtcatt | aagggtcctgatgaatgtgc |
| LRP5 | ttctcccagcctctcttctg | cttgttgggcctaaaagaca |
| POMT2 | ttatgggagatggaggcttg | catgctgaatggaagcacat |
| Patient | ADCC and Other Identified Pathologies | Gene (Variant) | Inheritance | Pathologies Associated with Gene in the Literature |
|---|---|---|---|---|
| 1. | Posterior polar cataract, Horner’s pupils, vaso-vagal syncope, and paroxysmal orthostatic tachycardia syndrome. | SMO (p.A601T) | AR | Curry–Jones syndrome |
| Anterior segment dysgenesis | ||||
| Morning glory disc anomaly | ||||
| Congenital cataract | ||||
| COL4A3 (p.T255M) | AD/AR | Alport syndrome (including haematuria) | ||
| Eye abnormalities | ||||
| Hearing loss | ||||
| Kidney failure | ||||
| ACTL9 (p.Y403*) | AR | Fertilization failure | ||
| OPA1 (p.I419M) | AD/AR | High myopia | ||
| Vitreoretinal detachment | ||||
| Behr syndrome with early-onset optic atrophy | ||||
| Sensorimotor neuropathy | ||||
| Ataxia | ||||
| Congenital cataract | ||||
| 2. | Bilateral congenital cataract, reduced kidney function, and high cholesterol. | RSPH4A (p.E377Kfs*11) | AD/AR | Primary ciliary dyskinesia |
| PCK2 (p.R142*) | AR | Primary angle-closure glaucoma | ||
| NOD2 (p. L1007P*) | AD/AR | Crohn’s disease | ||
| 3. | Congenital cataract (no further information) | CYP21A2 (p.Q319*) | AR | Congenital adrenal hyperplasia |
| Congenital cataract | ||||
| CBS (p.D388Y) | AR | Homocystinuria with ocular complications | ||
| Osteoporosis | ||||
| Vascular complications | ||||
| Intellectual disability | ||||
| Congenital cataract | ||||
| GJA8 (p.L26P) | AD/AR | Congenital cataract | ||
| 4. | Congenital cataract (no further information) | CRYAA (p.A152del) | AD/AR | Congenital cataract |
| Microcornea | ||||
| GALT (p.E201K) | AR | Galactosemia | ||
| Vitreous haemorrhage | ||||
| Amblyopia | ||||
| Congenital cataract | ||||
| GJA8 (p.L26P) | AD/AR | Congenital cataract | ||
| 5. | Congenital cataract (no further information) | CRYAA (p.R116C) | AD/AR | Congenital cataract |
| Microcornea | ||||
| ALDH18A1 (p.R483H) | AD/AR | Warburg micro syndrome | ||
| Retinopathy | ||||
| Microcephaly | ||||
| Congenital cataract | ||||
| 6. | Bilateral congenital pulverulent cataract, bilateral aphakia, previous bilateral retinal detachment, glaucoma suspect, naevus, hypertension, high cholesterol, and kidney stones. | CRYGD (p.W157*) | AD/AR | Congenital cataract |
| Microcornea | ||||
| POMGNT1 (p.D556N) | AR | Muscle–eye–brain disease | ||
| Muscular dystrophy | ||||
| Retinitis pigmentosa | ||||
| Brain malformations | ||||
| Juvenile cataract | ||||
| 7. | Congenital cataract (no further information) | CRYBA1 (p.G91del) | AD | Congenital cataract |
| CRYAA (p.C131F) | AD/AR | Congenital cataract | ||
| 8. | Congenital cataract (no further information) | CBS (p.R224C) | AR | Homocystinuria with ocular complications |
| Osteoporosis | ||||
| Vascular complications | ||||
| Intellectual disability | ||||
| Congenital cataract | ||||
| NOD2 (p.G908R) | AD/AR | Crohn’s disease | ||
| 9. | Bilateral congenital cataract, high amblyopia and grade 1 spondylolysis in all the family members | CHMP4B (E161Q) | AD | Congenital cataract |
| LRP5 (p.S1260F) | AR | Vitreoretinopathy | ||
| primary open-angle glaucoma | ||||
| Osteoporosis–eudoglioma syndrome | ||||
| Congenital cataract | ||||
| 10. | Congenital cataract (no further information) | POMT2 (p.Y574C) | AR | Walker–Warburg syndrome (cataract, microphthalmia, buphthalmos, and Peters anomaly |
| 11. | Congenital cataract (no further information) | GJA8 (G22R) | AD/AR | Microcornea |
| Congenital cataract | ||||
| GJA8 (V24L) | AD/AR | Microcornea | ||
| Congenital cataract | ||||
| 12. | Congenital cataract (no further information) | GJA8 (S197F) | AD/AR | Microcornea |
| Congenital cataract | ||||
| 13. | Congenital cataract (no further information) | GALT (p.L26P) | AR | Galactosemia |
| Vitreous haemorrhage | ||||
| Amblyopia | ||||
| Congenital cataract |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Berry, V.; Ponnekanti, M.B.; Aychoua, N.; Ionides, A.; Tsika, C.; Quinlan, R.A.; Michaelides, M. Multimorbidity Through the Lens of the Eye: Pathogenic Variants for Multiple Systemic Disorders Found in an Autosomal Dominant Congenital Cataract Cohort. Genes 2025, 16, 604. https://doi.org/10.3390/genes16050604
Berry V, Ponnekanti MB, Aychoua N, Ionides A, Tsika C, Quinlan RA, Michaelides M. Multimorbidity Through the Lens of the Eye: Pathogenic Variants for Multiple Systemic Disorders Found in an Autosomal Dominant Congenital Cataract Cohort. Genes. 2025; 16(5):604. https://doi.org/10.3390/genes16050604
Chicago/Turabian StyleBerry, Vanita, Manav B. Ponnekanti, Nancy Aychoua, Alex Ionides, Chrysanthi Tsika, Roy A. Quinlan, and Michel Michaelides. 2025. "Multimorbidity Through the Lens of the Eye: Pathogenic Variants for Multiple Systemic Disorders Found in an Autosomal Dominant Congenital Cataract Cohort" Genes 16, no. 5: 604. https://doi.org/10.3390/genes16050604
APA StyleBerry, V., Ponnekanti, M. B., Aychoua, N., Ionides, A., Tsika, C., Quinlan, R. A., & Michaelides, M. (2025). Multimorbidity Through the Lens of the Eye: Pathogenic Variants for Multiple Systemic Disorders Found in an Autosomal Dominant Congenital Cataract Cohort. Genes, 16(5), 604. https://doi.org/10.3390/genes16050604

