Next Article in Journal
Pedigree-Based Estimation of Y-STR Mutation and Male Differentiation Rates: Application to Historical Remains Identification
Next Article in Special Issue
The Genetic Diversity of African Common Bean Germplasm: A Systematic Review of Reported Molecular Studies
Previous Article in Journal
The Role of miR-326-3p in Regulating Differentiation and Thermogenesis Genes in Goat Brown Adipocytes
Previous Article in Special Issue
Genetic Characterization of Wild Soybean Collected from Zhejiang Province in China
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Genetic Interrelationship Among Newly-Bred Mutant Lines of Wheat Using Diagnostic Simple Sequence Repeat Markers and Phenotypic Traits Under Drought

1
African Centre for Crop Improvement (ACCI), University of KwaZulu-Natal, Private Bag X01, Scottsville, Pietermaritzburg 3201, South Africa
2
Limpopo Department of Agriculture and Rural Development, Towoomba Research Centre, Bela-Bela 0480, South Africa
*
Author to whom correspondence should be addressed.
Genes 2025, 16(10), 1210; https://doi.org/10.3390/genes16101210
Submission received: 14 August 2025 / Revised: 6 October 2025 / Accepted: 11 October 2025 / Published: 14 October 2025
(This article belongs to the Special Issue Genetic and Morphological Diversity in Plants)

Abstract

Background/Objectives: Induced mutagenesis is vital in genetic enhancement and trait discovery, for genetic analysis and breeding of novel crop varieties with desirable product profiles. Understanding the genetic relationships among newly developed mutant genotypes enables targeted selection and genetic recombination. Therefore, the objective of the current study was to assess the genetic diversity among mutant bread wheat genotypes developed through ethyl methanesulfonate (EMS) mutagenesis using phenotypic traits and diagnostic simple sequence repeat (SSR) markers to identify novel mutants and traits for breeding. Methods: Sixteen advanced (M6) mutant lines, one parental genotype, and three check varieties were genetically profiled using ten diagnostic SSR markers. The genotypes were evaluated for agronomic traits under drought-stressed (DS) and non-stressed (NS) conditions using a 10 × 2 alpha lattice design with two replications. Results: The SSR markers revealed a total of 21 alleles, with an average of 2.10 alleles per locus. An average polymorphic information content (PIC) of 0.51 was computed, revealing moderate informativeness of the genetic markers. Significant (p < 0.05) differences were observed among the test genotypes for key agronomic traits under NS and DS conditions. Grain yield positively and significantly (p < 0.001) correlated with plant height (r = 0.79), number of productive tillers (r = 0.82), root biomass (r = 0.77), shoot biomass (r = 0.74), spike length (r = 0.74), total biomass (r = 0.74), and thousand-seed weight (r = 0.64), under DS conditions. Principal component analysis explained 78.03 and 87.14% genotype variation for assessed agronomic traits under DS and NS conditions, with total biomass, shoot biomass, root biomass, productive tiller, plant height and grain yield as key traits contributing the most variation in the test genotypes. Conclusions: Wheat mutants LMA16, LMA44, and LMA53 were identified as genetically distinct and high yielders under drought stress conditions and recommended for production in rain-fed environments. The selected mutants are a valuable source of genes for wheat improvement programs.

1. Introduction

Common wheat (Triticum aestivum L., 2n = 6× = 42, AABBDD) is a vital commodity crop contributing to food and nutrition security and economies globally. With an annual production of more than 797 million tons, wheat contributes approximately 21% of the global food supply [1]. It serves as a major source of protein and energy to approximately 4 billion people [2]. Wheat grains are rich in proteins (i.e., glutenin and gliadin), carbohydrates, vitamins (i.e., riboflavin, thiamine, and niacin), essential minerals (i.e., Cu, Mg, Zn, Fe, and P), and fiber [3,4]. Other key and notable nutritional profiles of wheat include high contents of phenolic acids, flavonoids, anthocyanins, and carotenoids [5,6]. Thus, wheat is a vital source of essential nutrients and bioactive compounds for human well-being.
Global food demand is increasing rapidly and is projected to double by 2050 due to population growth and urbanization [7,8]. To meet the demand, wheat production must increase by more than 60% by the year 2050 to feed more than 9 billion people [9,10]. It is forecasted that climate change, which manifests in various forms including prolonged periods of drought, extreme temperatures, and flooding, will intensify and cause significant yield losses in wheat [11,12]. Drought stress is a major climate-change-driven environmental constraint affecting sustainable wheat production and productivity worldwide, with yield losses varying between 50 and 90% [13]. Climate change will pose significant challenges for wheat production, especially under rainfed production systems.
Genetic gains for grain yield in wheat are reported to be slower under drought-prone environments compared to irrigated conditions [14]. For example, genetic gains of 40 kg ha−1 yr−1 were reported under rainfed and drought-prone conditions compared to high yield gains of 160 kg ha−1 yr−1 under irrigated conditions [15]. Joudi, et al. [16] reported genetic yield gains of 20 kg ha−1 yr−1 and 31 kg ha−1 yr−1 in wheat under dry-land and irrigated conditions, respectively. It is estimated that agricultural land surface temperature will increase by 0.06 °C annually, accompanied by a reduction in rainfall by 16.0 mm per annum [17]. The decrease in rainfall and increase in temperature threaten rainfed wheat production [18]. The projected decline in grain yield due to climate change poses a significant threat to food security and the long-term sustainability of wheat cultivation. There is an urgency for the development of innovative solutions to enhance wheat production, resilience, and sustainability.
Breeding of wheat varieties that combine high grain yield and stability under drought stress conditions is crucial to boost yield gains to ensure food security and enhance climate resilience in wheat production systems. To develop high-yielding and climate-smart wheat varieties, mutagenesis has played a key role in generating new genetic stocks for the improvement of economic traits, including grain yield and quality, phenological traits and disease resistance, and heat and drought tolerance [19,20]. Chemical mutagenesis using ethyl methanesulfonate (EMS) is a widely used approach for breeding novel wheat mutants. For example, Komura, et al. [21] used EMS to create early-flowering wheat mutants, while a short-stature wheat mutant line with enhanced grain yield was developed by [22]. Recently, Kumar, et al. [23] developed an EMS-mutagenized wheat population with improved agronomic traits (i.e., grain yield, tiller number, and peduncle length) and increased micronutrient content (i.e., Ca, Cu, Fe, and Zn). Furthermore, EMS mutagenesis aided the development of wheat mutant lines resistant to both Fusarium crown rot and head blight [24]. In South Africa, OlaOlorun, et al. [25] developed a wheat population with enhanced root biomass allocation, drought tolerance, and improved yield potential. Overall, these findings validate the potential of EMS mutagenesis in the development of novel wheat varieties to enhance genetic gains for key traits, which is crucial to safeguarding food security.
Understanding the genetic diversity in wheat genetic resources, including mutant genotypes, is crucial for germplasm preservation and identification of diverse parental lines. Phenotypic analysis based on morphological traits has been used for germplasm characterization in wheat [26,27]. Molecular-marker-based genetic analysis complements traditional phenotyping of crop genetic resources independent of environmental factors compared to classical phenotyping. Among the various molecular marker systems, SSR markers have been widely used in genetic diversity studies, genome mapping, QTL mapping, and marker-assisted selection, including in drought tolerance breeding programs [28,29]. SSR markers are highly polymorphic, co-dominant, chromosome-specific, and are spread across the genome. SSR-based genetic analysis enables the identification of key genes linked to various agronomic traits in wheat [30]. For example, Khan et al. [31] identified marker Xbarc49 with association with stay-green under heat stress conditions. Three SSR markers, gwm165, gwm325, and gwm539, were reported to be linked with plant height in wheat [32].
Wheat is a key commodity crop in South Africa, which is extensively produced under rainfed conditions [33]. For example, production of winter/intermediate wheat production occurs mainly under dryland conditions of the Free State province. Dryland spring wheat is mainly produced in the Western Cape province, characterised by hot and dry summers [34,35]. South Africa is a water-scarce country, and climate modelling using decision support system for agrotechnology transfer (DSSAT) indicated a high probability of declining wheat production in major production areas due to climate-change-driven declines in rainfall and recurring droughts [36]. Nxumalo, et al. [37] used the Standardized Precipitation Index (SPI) to project increased drought frequencies and reported significant yield losses in wheat across South Africa, with the Western Cape and Northern Cape being particularly vulnerable. To mitigate the effects of climate change on wheat cultivation, especially in dryland production areas of South Africa, the African Centre for Crop Improvement initiated a breeding program to develop new generation wheat varieties that are drought-tolerant and high-yielding. Mutation breeding using EMS was applied to the highly drought and heat-tolerant wheat cultivar LM43 sourced from the International Maize and Wheat Improvement Centre (CIMMYT) [25,38]. This aided the development of 16 novel mutants with desirable agronomic traits, including high yield performance, drought tolerance and enhanced root and shoot biomass allocation. The novel mutants are valuable genetic resources for the selection of novel mutants and traits to introgress genes to widely cultivated varieties for abiotic stress tolerance and the development of locally adapted varieties. Therefore, the objective of the current study was to assess the genetic diversity among mutant bread wheat genotypes developed through ethyl methanesulfonate (EMS) mutagenesis using phenotypic traits and diagnostic simple sequence repeat (SSR) markers to identify novel mutants and traits for breeding.

2. Materials and Methods

2.1. Plant Materials

The present study evaluated 20 bread wheat genotypes, comprising 16 advanced mutants (M6) selected with superior agronomic performance and root biomass allocation under drought stress and non-stress conditions. The other four genotypes include the mutant parental genotype sourced from the International Maize and Wheat Improvement Centre (CIMMYT) and three varieties. The names and pedigree of the genotypes are presented in Table 1.

2.2. Genotyping

Selection of SSR Markers and Genotyping

To assess the genetic diversity of the 20 wheat genotypes, ten diagnostic SSR markers were used (Table 2). The markers were selected based on their informativeness and ability to discern wheat genotypes under heat and terminal drought tolerance [39,40,41]. Seeds of the selected genotypes were grown in seedling trays until the 4-leaf stage. DNA of leaf samples was extracted from two-week-old seedlings using the modified cetyltrimethylammonium bromide (CTAB) protocol. Leaf tissues were placed into microcentrifuge tubes and mixed with 500 μL of CTAB buffer, and it was incubated for 30 min in a hot water bath at 70 °C. Tubes were centrifuged at 3500 rpm for 10 min. After the centrifugation, the supernatant was collected and transferred into a microcentrifuge tube, then chloroform: isoamyl alcohol (24:1) was added to the microcentrifuge tube and mixed gently. Then the DNA was precipitated and separated from the solution by adding ethanol. The DNA pellet was dried and resuspended in a solution of TE buffer to stabilize and preserve the DNA. The quality of the DNA was estimated using a Nano-drop® ND-1000 spectrophotometer (Nanodrop Products, Wilmington, DE, USA).

2.3. PCR Amplification

Polymerase chain reaction (PCR) was performed using 12 µL of reaction mixture containing 1 × PCR buffer 2.5 mm Mg2+, 0.2 µL each of dinucleotidetriphosphates. The PCR began with initial denaturation at 94 °C for 2 min, followed by 33 cycles of denaturation at 94 °C for 30 s each. Further, PRC annealing was performed at 63 °C for 30 s, followed by extension at 72 °C for 45 s, with a final extension step at 72 °C lasting 20 min. The resultant products were labelled using a fluorescent marker and separated with capillary electrophoresis using an ABI 3130 automatic sequencer (Applied Bioscience, Foster City, CA, USA), and GeneMapper 4.1 was used for fragment analysis.

2.4. Phenotyping Protocols

Two separate experiments were conducted under drought-stress (DS) and non-stress (NS) conditions in a controlled glasshouse and field environments. The glasshouse experiment was conducted at the Controlled Environment Facility (CEF) of the University of KwaZulu-Natal (29.6213° S, 30.3966° E). The average day/night temperatures in the glasshouse were maintained at 25 °C/15 °C, whereas the relative humidity was 45% and 60% during the study, respectively. The greenhouse experiment was laid out in a 10 × 2 alpha lattice design with two replications. Ten seeds were planted in 5 L capacity plastic pots using composted pine bark growth media, and they were thinned to 5 plants per pot 3 weeks after emergence. Automated drip irrigation was used to supply water and fertilizer directly to the pots. The fertilizer application was integrated into a computerized drip irrigation system, with a rate of 300 kg N ha−1 and 200 kg P2O5 ha−1. DS was imposed at 50% flowering until physiological maturity by withholding irrigation until the soil water content reached 30% field capacity. Plants were watered regularly for NS conditions to maintain soil moisture close to field capacity. A tensiometer (GTDSMM500, General Tools and Instruments, Secaucus, NJ, USA) was used to measure soil moisture levels in the pot during the experiment.
The field experiment was carried out at Ukulinga Research Farm (29°40′ S, 30°24′ E) of the University of KwaZulu-Natal, Pietermaritzburg, South Africa. The field experiment was laid out as a 10 × 2 alpha lattice design with two replications. The genotypes were grown in a specially designed plastic mulch rainout with an underground drip irrigation system. Each plot was a 1.5 m long single row per genotype, where two seeds were planted per planting station at 10 cm in row spacing and 45 cm between rows. Drought stress was induced at 50% heading by reducing irrigation to 35% capacity, while full irrigation was maintained for the NS conditions. Soil moisture content in the field was measured using a digital moisture sensor (HOBO UX120, Onset, Bourne, MA, USA). Basal fertilizer consisting of nitrogen (N), phosphorus (P), and potassium (K) was applied at a rate of 120:30:30 kg ha−1 (N:P:K) at planting based on the recommendation of wheat production in South Africa [42]. Weeds were removed manually, while aphids and other insect pest infestations were controlled using insecticides.

2.5. Agronomic Data Collection

Agronomic data were collected for the following traits: days to 50% heading (DTH) calculated as the number of days from sowing to the date when half of the plants in a pot or plot had fully developed spikes. Days to 90% maturity (DTM) was calculated as the number of days from sowing to the date when 90% of the plants senesced. Plant height (PH, expressed in cm) was measured from ground level to the top of the spike, excluding the awns. The number of productive tillers (PTN) was recorded at physiological maturity, while shoot biomass (SB, expressed in grams) was measured by weighing the above-ground plant material. After carefully washing the roots, root biomass (RB, g) was measured as the weight of the below-ground plant parts. SB and RB were oven dried for 72 h at 65 °C. Spike length (SL, cm) was measured from the base of the spike to the tip, excluding awns. Two hundred seeds were counted from each genotype, weighed in grams using a digital balance, and multiplied by 5 to obtain the thousand kernel weight (TKW). Grain yield was measured as the mean weight (grams) of grains harvested from a plot. The field data from the field were extrapolated based on five plants to be consistent with the greenhouse data.

2.6. Data Analysis

2.6.1. Agronomic Data Analysis

The agronomic data were subjected to analysis of variance (ANOVA) using GenStat 18th Edition (VSN International, Hempstead, UK). Differences between genotype means were assessed for statistical significance using Fisher’s Least Significant Difference (LSD) test at the 5% significance level. Pearson correlation coefficients were constructed to measure interrelationships among the traits using the corrplot procedure [43] in R version 4.2.0 [44]. Principal component analysis (PCA) was performed with R based on the correlation matrix for both NS and DS conditions, to identify influential traits. PCA biplots were generated for the NS and DS conditions across the testing environments using the factoextra package in R software version 4.3.3 [45].

2.6.2. Marker Data Analysis

Genetic diversity analyses were performed using GenAlex version 6.5 [46]. The following genetic parameters were calculated: the total number of alleles per locus (Na), the number of effective alleles per locus (Ne), observed heterozygosity (Ho), expected heterozygosity (He), and fixation index (FIS). PIC calculated using the formula PIC = 1 − ⅀Pij2, where Pij is the frequency of the jth allele of the ith locus [47]. A dendrogram was constructed from the distance matrix using the neighbour-joining method in the Darwin 6.0.5 software [48]. A tanglegram was used to compare phenotypic and genotypic hierarchical clusters using the “dendextend package” [49] in R software version 4.3.3 [44].

3. Results

3.1. Genetic Diversity Using SSR Markers

3.1.1. Genetic Parameters

Table 3 presents genetic diversity parameters generated using the SSR markers. WMC78 was a monomorphic marker, while the rest were polymorphic. The number of alleles (Na) varied from 1 (WMC78) to 2.67 (Xgwm484, XWMC596, and WMC179) with an average of 1.97. The number of effective alleles (Ne) ranged from 1 (WMC78) to 2.53 (WMC179) with a mean of 1.82 per locus. Shannon’s information index (I) ranged from 0 to 0.90 with an average of 0.54 across all the markers (Table 3). The observed heterozygosity ranged from 0 (markers GWM337, WMC532, and WMC78) to 1.00 (Xgwm132) with a mean of 0.42, while the expected heterozygosity ranged from 0 (WMC78) to 0.57 (WMC179), with an average of 0.35. The fixation index (F) varied from −1 to 1 with an average of 0.24. PIC values varied from 0.00 (WMC78) to 0.83 (XWMC596) with an average of 0.51. The overall results suggest that the SSR markers used in this study were both reliable and useful for genetic analysis.

3.1.2. Principal Coordinate Analysis (PCoA)

Principal coordinate analysis showing genetic relationships among the wheat mutant lines and standard varieties is shown in Figure 1. Principal components 1 (PC1) and 2 (PC2) accounted for 26.10% and 19.92% of the total variation, respectively. There were four (denoted as I, II, III, and IV) distinct genetic groups based on PcoA (Figure 1). The check varieties SST015, SSTO117, and SSTO166, were grouped on the top left quadrant and distinctly separated from the other test genotypes. The mutant lines were grouped into three distinct genetic groups. PCoA did not group the mutants based on their drought tolerance levels, and mutants with different tolerance categories were allocated across the coordinate axes. For example, drought-tolerant mutants such as LMA53 and LMA2 were grouped (i.e., group II) with moderately tolerant mutants such as LMA15 and LMA31. Group III consisted of four mutant lines, while group IV consisted of five mutant lines.

3.1.3. Hierarchical Cluster Analysis

Genetic interrelationships among the 20 wheat genotypes were further assessed using a dendrogram constructed from a genetic distance dissimilarity matrix (Figure 2). The dendrogram grouped the genotypes into three clusters. Clusters I and II comprised the mutant lines, including the parental genotype. Cluster III comprised the check varieties SST0117, SS0116, and SST015.

3.2. Phenotyping Based on Agro-Morphological Traits

3.2.1. Genotypic Variation for Agronomic Performance

Combined analysis of variance revealed significant (p < 0.001) genotypic effects for all traits except RSR, while water regime was significant (p < 0.05) for all recorded traits except DTH and SL (Table 4). Environmental effects were significant (p < 0.001) for recorded traits. The genotype × water regime interaction effect was significant (p < 0.05) for DTH, TB, and TSW, while the genotype × environment interaction effect exerted a significant (p < 0.05) effect on all traits except DTM. The interaction between genotype, environment, and water regime was significant (p < 0.05) for DTM, TB, TSW, and GY.

3.2.2. Agronomic Performance Under Non-Stressed and Drought-Stressed Conditions

Figure 3 presented the combined mean values of the studied agronomic traits among the 20 wheat genotypes evaluated under DS and NS conditions in the glasshouse and field environments. The mean DTH under DS and NS were 70 and 71 days, respectively (Figure 3a). LM43 was early flowering at 57 days, while LM5A and LMA42 were late flowering at 76 days under DS conditions. Under NS conditions, LM43 was early flowering genotype (60 days), followed by SST0117 (62 days), whereas LMA4 and LMA21 were late flowering genotypes at 78 and 79 days, respectively. For DTM, LM43 and SS0166 were early maturing (<100 days), while LMA42 was late maturing at 117 days under DS conditions. Under NS conditions, LM43 was early maturing (112 days), compared to the late-flowering genotypes LMA42, LMA16, and LMA21 (>125 days) (Figure 3b). The mean PH under DS condition was 77.40 cm, with LMA53, LMA2, and LMA16 being the tallest genotypes at 82.91, 82.59 and 81.33 cm and SST015 the shortest genotype (68.18 cm) (Figure 3c). Under NS conditions, the average PH was 82.79 cm with LMA8, LMA5, and LMA44 being the tallest genotypes at 91.37, 89.16, and 88.06 cm and the genotypes SST015, SS0166, and LM43 being the shortest genotypes at 74.79, 74.05, and 72.74 cm, in that sequence.
Under DS conditions, genotypes LMA19 and LMA37 produced high PTN (>13), while LM43, SST0117, and SST015 recorded fewer PTN (<7) (Figure 3d). Under NS condition, LMA16, LMA5 and LMA2 produced high PTN (>17), whereas LM43, SS0166, SST0117 and SST015 produced few PTN (<12). The mean RB under DS condition was 13.92 g, where test genotypes LMA42, LMA2, LMA53, LMA47, LMA6 and LMA16 recorded the highest RB (>16 g), compared to low RB (<9 g) recorded for LM43 and SS0166 (Figure 3e). Under DS condition, LMA19, LMA5 and LMA42 produced the highest SB (>73 g/plant), while LMA29, LM43, SS0166 and SST0117 recorded lower SB (<60 g/plant) (Figure 3g). Under NS condition, genotypes LMA37, LMA16, LMA19, LMA53 and LMA5 recorded higher SB (>100 g/plant), compared to low SB (<80 g/plant) recorded for LM43, LMA29, SST0117 and SS0166. Under DS conditions, LMA44, LMA5, and LMA47 recorded the longest SL (>12 cm), compared to the shortest SL exhibited by LM43 at 9.27 cm. Under NS condition, LMA53, LMA8, LMA37, and LMA5 recorded the longest SL (>12 cm), compared to the shortest SL (<10 cm) recorded for LM43 and SST0117 (Figure 3h). Under DS condition, TB was highest (>87 g/plant) for LMA53, LMA47 and LMA42, while SST015, SST0117, SS0166 and LM43 recorded low TB (<70 g/plant). LMA37 produced the highest TB (>132 g/plant), while SST015 and LM43 recorded low TB (<90 g/plant) under NS conditions. Under DS conditions, LMA2, LMA5 and LMA42 recorded high TSW (>39 g), while SST015 produced lower TSW (<32 g) (Figure 3j). Genotypes LMA47, LMA6, and LMA5 recorded highest TSW (>47 g), while SST0117, LMA29, SST015, and LM43 recorded low TSW (<40 g). Genotypes LMA16, LMA44, and LMA53 recorded the highest GY (>23 g/plot), while SST015, LMA22, SST0117, and LM43 recorded the lowest GY (<13 g/plot) under DS condition (Figure 3k). Genotypes LMA5 and LMA16 recorded the highest GY (40 g/plot) under NS conditions, whereas SST0117, LMA22, and LMA31 recorded low GY (25 g/plot).

3.2.3. Associations Among Phenotypic Traits Under Contrasting Water Regimes

Pearson correlation analysis showing trait association under NS and DS conditions across glasshouse and field environments is presented in Figure 4 and Figure 5. Positive and significant associations were recorded between GY and PH (r = 0.79; p ≤ 0.001), PTN (r = 0.88; p ≤ 0.001), RB (r = 0.77; p ≤ 0.001), SB (r = 0.74; p ≤ 0.001), SL (r = 0.74; p ≤ 0.001), TB (r = 0.70; p ≤ 0.001), and TSW (r = 0.64; p ≤ 0.001) under DS condition. Positive and significant associations (r > 0.70; p ≤ 0.001) were recorded between RB with GY, TB, SL, SB, and RSR under DS conditions. Furthermore, RB showed moderate and positive correlations with PH, PTN, RSR, SB, and TSW under NS conditions but a non-significant association with GY. Trait associations were stronger under DS compared to NS conditions.

3.2.4. Multivariate Relationships

PCA showing the contribution scores and cumulative variations for assessed phenotypic traits under DS and NS conditions is presented in Table 5. Under DS conditions, the first two principal components (PCs) accounted for 78.03% of the total variation. PC1 was positively associated with GY, PH, PTN, RB, PTN, TSW, SB, SL, and TB. The second PC, which contributed 10.68% of the total variation, was positively associated with RSR. However, DTH and DTM contributed negatively. Under NS conditions, the first three PCs contributed 87.14% of the total variation. The first PC explained 61.97% of the total variance, and the major positive contributing traits were GY, PH, PTN, SL, SB, TB, and TSW. RB and RSR contributed negatively to PC2, which accounted for 16.11% of the total variation. PC3 accounted for 9.06% of the total variation, where DTH and DTM contributed negatively.

3.2.5. Principal Component Biplots

The association among the traits and wheat genotypes under DS and NS conditions across glasshouse and field environments was visualized in a principal component biplot (Figure 6 and Figure 7). Narrow angles (<45°) between dimension vectors indicate significant correlation of traits, while the most influential traits to differentiate the genotypes have the longest vector lines. Under the DS condition, all the traits contributed positively to PC1. Narrow angles were observed between GY, PH, RB, PTN, and RSR under DS conditions. Mutant lines LMA16, LMA37, and LMA53 were plotted closer the vector for GY. Under NS conditions, all the traits contributed positively to PC1 except for RSR. LMA53 and LMA37 were plotted closer to vectors of GY, TB, and SB, whereas genotypes LMA16, LMA44, LMA2, and LMA8 were grouped based on high RB.

3.2.6. Cluster Analysis Based on Phenotypic Traits

Figure 8 reveals the clustering of the 20 wheat genotypes for agronomic traits into three distinct clusters under the DS condition. Cluster I consisted of ten genotypes, followed by Cluster III, which consisted of six genotypes, and Cluster II, which consisted of four genotypes. Cluster II genotypes had higher RSR, while Cluster III comprised genotypes with low GY, early flowering, and lower RB. Similarly, under the NS condition, the hierarchical clustering grouped the genotypes into three different clusters (Figure 9). Clusters I, II, and III consisted of eight, seven, and five genotypes, respectively. Cluster I contained genotypes such as LMA2, LMA44, LMA8, and LMA15, which exhibited high RB. Cluster II contained genotypes with higher GY, TB, and SB; cluster III comprised genotypes with low GY and TSW.

3.2.7. Phenotypic and Genotypic Hierarchical Cluster

A tanglegram comparing clustering patterns of the test genotypes based on phenotypic traits and SSR markers under DS conditions is shown in Figure 10. An entanglement score of 0.25 was recorded, indicating low dissimilarity between genetic and phenotypic clustering (Figure 9). SST015 is the only genotype that maintained its position and cluster under drought stress conditions. Under NS conditions, an entanglement score of 0.25 was recorded. Five genotypes (i.e., LMA6, LM43, SST015, LMA31, and LMA29) showed similar match patterns between the two tanglegrams (Figure 11).

4. Discussion

The SSR markers used in the current study detected low allele number (i.e., 21 alleles in total) and alleles per locus (i.e., 2), an indication of low genetic diversity among the mutant lines. Further, low allele number per locus is an indication of ineffective EMS mutagenesis, probably resulting in low mutation rates. Additionally, the low genetic diversity could also be attributed to a common genetic background, especially provided the mutants were derived from LM43 (ROLF07*2/6/PVN//CAR422/ANA/5/BOW/CROW//BUC/PVN/3/YR/4/TRAP#1), a heat and drought tolerant wheat variety developed by CIMMYT and high selection pressure imposed in early generations for desirable agronomic traits. Nonetheless, the mean number of alleles per locus reported in the current study is similar to previous findings by Verma, et al. [50] and Meena, et al. [51] when assaying 81 and 36 wheat genotypes. Contrastingly, Mahmood, et al. [52] and Şen and Sarsu [53] reported a high number of alleles per locus among wheat mutants. The contrasting reports are attributed to differences in optimum dosage, duration, treatment condition, and the number of SSR markers used in each study. Polymorphism information content (PIC) provides insight into allele presence and distribution [54], serving as a measure of marker informativeness. In the present study, the average PIC value was 0.51, indicating that the SSR markers used are reliable and recommendable for genetic analysis of commercial and mutant wheat genotypes. For example, the SSR loci XWMC596, WMC179, and Xgwm484 were the most informative and highly discriminating of the test genotypes (Table 3). These markers have been previously reported to be highly discriminating of wheat genetic resources [27, 55]. Contrastingly, the SSR loci GWM337 and WMC78 were the least informative as detected in the present study. This contrasts with earlier findings by Mkhabela, et al. [56], where these primers exhibited high PIC values among wheat germplasm. The contrast could be attributed to differences in the genetic architecture of the wheat germplasm.
Shannon’s information index is an important measure of genetic diversity within a population. In the current study, the average Shannon’s information index of 0.64 indicated moderate levels of genetic diversity among the test genotypes. Tahir, et al. [57] reported Shannon’s Information index of 0.58 among 20 wheat genotypes using eight SSR markers, agreeing with the present findings. The mean observed heterozygosity value of 0.42 reported in the current study is higher than the values of 0.32 and 0.23 reported by Demirel and Demirel [58] and Urquijo-Zamora, et al. [59] in wheat. The mean heterozygosity of 0.35 also confirmed moderate genetic diversity of the assayed genotypes, and is relatively lower than values of 0.55 and 0.46 reported by Farhangian-Kashani, et al. [54] and Dagnaw, et al. [60] when assessing genetic diversity in wheat using SSR markers. The low genetic diversity of the tested mutants may hinder crop improvement initiatives due to limited allelic variation, which is necessary for effective selection. Despite the low allele frequency and moderate gene diversity, the present study revealed genetically differentiated mutants based on the Hierarchical cluster analysis (Figure 2). The clustering was based on genetic descent and common ancestry, such that commercial-grown wheat varieties SST0117, SS0116, and SST015, and mutant genotypes were grouped distinctly. The mutants LMA6, LMA42, LMA53, LMA29, LMA16, LMA37 and LM43 were genetically differentiated and differentially isolated among the mutants in clusters I and III. Crosses derived from these unique mutants can develop a novel wheat population and increase genetic gains for agronomic traits under dryland and irrigated production environments.
Assessing phenotypic diversity of crop genetic resources is essential for crop improvement to identify variation for economic traits to guide cultivar selection and hybridization to develop novel varieties. The present study revealed significant phenotypic differences for grain yield and its components for assayed commercial and mutant wheat genotypes under constrasting moisture environments (Figure 3). Drought stress induced earliness but reduced grain yield in the test genotypes. In addition, yield component traits were also impaired due to drought stress (Table 4). The contrasting responses of the test genotypes under drought and irrigated conditions allowed for the identification of drought-tolerant wheat genotypes for rainfed environments. For example, LMA16, LMA44, and LMA53 were identified as high yielders under drought stress conditions and recorded grain yields of 26.64, 24.01 and 23.40 g/plot (Table 5). These mutant lines outperformed the commercial check varieties, such as SS0166 and SST0117, which are cultivated and adapted to drought-prone wheat-producing areas of South Africa. Further, these genotypes possessed essential yield contributing traits such as shorter plant stature, higher root biomass, and longer spikes (Table 4). These mutant lines are recommended for cultivation in semi-arid areas of South Africa following multi-environment studies against standard commercial varieties. Further, these mutants could be utilized for breeding programs to enhance drought tolerance. On the contrary, mutant lines LMA5 and LMA16 were the high-yielders under irrigated conditions and produced a grain yield of 42.62 g/plot. These are ideal candidate genotypes for cultivation under irrigated conditions. These mutants exhibited 23% higher grain yield compared to the widely cultivated commercial wheat variety SST015, commonly grown under irrigated wheat-producing areas of South Africa. These genotypes possessed essential yield-component traits including productive tillers, root biomass, and thousand-seed weight and are also recommended for multi-environment trials for registration and commercialization.
Understanding trait correlations is a vital procedure in crop improvement programs to guide simultaneous selection and improvement of desirable traits, and accelerate the development of novel and high-performing varieties. Plant height is an important agronomic trait related to yield performance [61]. In the present study, there were a moderate association between plant height and grain yield, implying limited progress to improve yield gains through selecting for plant height. Productive tiller number is an important indicator that determines wheat productivity and yield potential. A high number of productive tillers is ideal in wheat as it is linked to high biomass production, high spike density, and grain yield [62]. Strong and positive correlations were revealed between productive tillers and grain yield under both drought-stressed and non-stressed conditions (Figure 4) suggesting that selecting for increased tillering capacity could be an effective strategy for improving yield gains. The mutants LMA19 and LMA37 with high tiller numbers are ideal for production under dryland wheat production.
Roots are an essential organ for water and nutrient uptake, which are necessary for crop growth and development. Roots also play a key role in sensing environmental changes and then triggering a response to such stresses [63]. Optimization of root systems is an efficient approach to enhance water and fertilizer use efficiency, supporting crop productivity under adverse conditions [64]. Root biomass showed a high positive correlation with grain yield only under drought stress conditions, suggesting that enhanced root development under drought stress enhances drought tolerance and yield development. Therefore, optimized breeding for high root biomass could enhance wheat productivity in the era of climate change and the mutant lines such as LMA16, LMA6, LMA47, LMA53, LMA2, and LMA42 with high root biomass production under drought stress environments are ideal candidates for future breeding initiatives in South Africa.
Shoot biomass development is an essential indicator to predict yield development. Shoot biomass was highly correlated with grain yield under drought stress conditions, suggesting that increased above-ground biomass favours yield development in the studied wheat population. Therefore, breeding and selection for increased shoot biomass could enhance radiation-use efficiency and boost wheat yields [65]. The mutants LMA19 and LMA5 exhibit higher shoot biomass under drought stress conditions.
Spike length is a key contributor of yield potential in wheat [66]. In the present study, spike length was highly correlated with grain yield under drought stress conditions. This association could be attributed to the potential of high root biomass to extract moisture into deeper layers of the soil under water stressed conditions, thus enhancing spike elongation, florets development and high kernels numbers. Thousand-seed weight is an important wheat grading parameter for quality analysis and directly influences grain yield. In the present study, thousand-seed weight showed moderated and positive correlations with grain yield under drought-stressed and irrigated conditions. Mutant lines such as LMA2, LMA 16 and LMA42 with high root biomass sustained plant hydration and photosynthetic activity during grain development, maintaining continuous assimilate supply to the grains leading to higher thousand seed weight under drought stress. Selecting for seed weight may not lead to significant yield improvements in the studied wheat germplasm. Tanglegram analysis under drought stress and non-stressed conditions revealed one genotype and 5 genotypes that maintained their position, respectively, indicating they maintain stable traits and strong genetic and phenotypic linkages. In contrast, the reduced number of stable genotypes under drought stress indicates that drought stress conditions cause phenotypic plasticity that is not directly linked to SSR marker. This inconsistency indicates the difficulty of genotype-environment interactions during drought and highlights the importance of integrating both molecular and phenotypic data for select stable genotypes [67].

5. Study Limitations and Future

The selected SSR markers are diagnostic and representative and provide useful genetic differentiation. However, the depth of genetic coverage may be limited compared to genome-wide SNP markers. Therefore, it is necessary to validate findings with high-density SNP markers to increase marker density and resolution. The genotype by environment effects may not have been fully captured because of the few locations; therefore, multi-season trials are necessary for assessing stability and genotype × environment interaction.

6. Conclusions

The present study determined genetic diversity, phenotypic diversity, and their interrelationships among selected mutant lines and commercial varieties. High genetic and phenotypic diversity was revealed among check l and mutant wheat varieties. Genotypes LMA16, LMA44, and LMA53 were highly productive under drought stress conditions and are recommended for dry-land wheat production areas of South Africa following multi-environment evaluations. Mutants LMA5 and LMA16 were the best yielders under irrigated conditions and recommended to irrigated wheat production environments in South Africa following multi-environment testing. The identified mutants are genetically unique and differentiated and can serve as valued genetic resources for future wheat improvement programs in South Africa to improve grain yield and drought stress tolerance.

Author Contributions

Conceptualization, A.M., H.S. and J.M.; methodology, A.M.; software, A.M.; validation, J.M. and H.S.; formal analysis, H.S. and J.M.; investigation, A.M.; resources, H.S.; data curation, A.M.; writing—original draft preparation, A.M.; writing—review and editing, J.M. and H.S.; visualization, A.M. and J.M.; supervision, J.M. and H.S.; project administration, H.S.; funding acquisition, A.M. and H.S. All authors have read and agreed to the published version of the manuscript.

Funding

The South African Cultivar and Technology Agency (201621790608), National Research Foundation (grant number 130017) South Africa, and University Capacity Development Grant (UCDP) of the University of KwaZulu-Natal.

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

The data supporting the conclusions of this study can be obtained from the corresponding author (J.M.) upon reasonable request.

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. FAO. Available online: https://www.fao.org/faostat/en/#data/QCL (accessed on 1 September 2024).
  2. Alotaibi, M.; El-Hendawy, S.; Mohammed, N.; Alsamin, B.; Refay, Y. Appropriate application methods for salicylic acid and plant nutrients combinations to promote morpho-physiological traits, production, and water use efficiency of wheat under normal and deficit irrigation in an arid climate. Plants 2023, 12, 1368. [Google Scholar] [CrossRef]
  3. Goel, S.; Singh, M.; Grewal, S.; Razzaq, A.; Wani, S.H. Wheat proteins: A valuable resources to improve nutritional value of bread. Front. Sustain. Food Syst. 2021, 5, 769681. [Google Scholar] [CrossRef]
  4. Khalid, A.; Hameed, A.; Tahir, M.F. Wheat quality: A review on chemical composition, nutritional attributes, grain anatomy, types, classification, and function of seed storage proteins in bread making quality. Front. Nutr. 2023, 10, 1053196. [Google Scholar] [CrossRef]
  5. Dhua, S.; Kumar, K.; Kumar, Y.; Singh, L.; Sharanagat, V.S. Composition, characteristics and health promising prospects of black wheat: A review. Trends Food Sci. Technol. 2021, 112, 780–794. [Google Scholar] [CrossRef]
  6. Chakraborty, P.; Dewanjee, S. Unrevealing the mechanisms behind the cardioprotective effect of wheat polyphenolics. Arch. Toxicol. 2024, 98, 3543–3567. [Google Scholar] [CrossRef]
  7. Mottaleb, K.A.; Kruseman, G.; Frija, A.; Sonder, K.; Lopez-Ridaura, S. Projecting wheat demand in China and India for 2030 and 2050: Implications for food security. Front. Nutr. 2023, 9, 1077443. [Google Scholar] [CrossRef] [PubMed]
  8. Yao, Y.; Guo, W.; Gou, J.; Hu, Z.; Liu, J.; Ma, J.; Zong, Y.; Xin, M.; Chen, W.; Li, Q. Wheat2035: Integrating pan-omics and advanced biotechnology for future wheat design. Mol. Plant. 2025, 18, 272–297. [Google Scholar] [CrossRef]
  9. Ma, J.; Li, R.; Wang, H.; Li, D.; Wang, X.; Zhang, Y.; Zhen, W.; Duan, H.; Yan, G.; Li, Y. Transcriptomics analyses reveal wheat responses to drought stress during reproductive stages under field conditions. Front. Plant Sci. 2017, 8, 210582. [Google Scholar] [CrossRef] [PubMed]
  10. Savadi, S.; Prasad, P.; Kashyap, P.; Bhardwaj, S. Molecular breeding technologies and strategies for rust resistance in wheat (Triticum aestivum) for sustained food security. Plant Pathol. 2018, 67, 771–791. [Google Scholar] [CrossRef]
  11. Caparas, M.; Zobel, Z.; Castanho, A.D.; Schwalm, C.R. Increasing risks of crop failure and water scarcity in global breadbaskets by 2030. Environ. Res. Lett. 2021, 16, 104013. [Google Scholar] [CrossRef]
  12. Raimondo, M.; Nazzaro, C.; Marotta, G.; Caracciolo, F. Land degradation and climate change: Global impact on wheat yields. Land. Degrad. Dev. 2021, 32, 387–398. [Google Scholar] [CrossRef]
  13. Dietz, K.J.; Zörb, C.; Geilfus, C.M. Drought and crop yield. Plant Biol. 2021, 23, 881–893. [Google Scholar] [CrossRef]
  14. Crespo-Herrera, L.; Crossa, J.; Huerta-Espino, J.; Vargas, M.; Mondal, S.; Velu, G.; Payne, T.; Braun, H.; Singh, R. Genetic gains for grain yield in CIMMYT’s semi-arid wheat yield trials grown in suboptimal environments. Crop Sci. 2018, 58, 1890–1898. [Google Scholar] [CrossRef] [PubMed]
  15. Gerard, G.S.; Crespo-Herrera, L.A.; Crossa, J.; Mondal, S.; Velu, G.; Juliana, P.; Huerta-Espino, J.; Vargas, M.; Rhandawa, M.S.; Bhavani, S. Grain yield genetic gains and changes in physiological related traits for CIMMYT’s High Rainfall Wheat Screening Nursery tested across international environments. Field Crops Res. 2020, 249, 107742. [Google Scholar] [CrossRef]
  16. Joudi, M.; Ahmadi, A.; Mohammadi, V.; Abbasi, A.; Mohammadi, H. Genetic changes in agronomic and phenologic traits of Iranian wheat cultivars grown in different environmental conditions. Euphytica 2014, 196, 237–249. [Google Scholar] [CrossRef]
  17. Poudel, M.R.; Ghimire, S.; Pandey, M.P.; Dhakal, K.H.; Thapa, D.B.; Poudel, H.K. Evaluation of wheat genotypes under irrigated heat stress drought conditions. J. Biol. Today’s World 2020, 9, 212. [Google Scholar]
  18. Dadrasi, A.; Chaichi, M.; Nehbandani, A.; Soltani, E.; Nemati, A.; Salmani, F.; Heydari, M.; Yousefi, A.R. Global insight into understanding wheat yield and production through Agro-Ecological Zoning. Sci. Rep. 2023, 13, 15898. [Google Scholar] [CrossRef]
  19. Kumar, N.; Nayak, J.K.; Pal, N.; Tyagi, S.; Yadav, R.R.; Joshi, P.; Malik, R.; Dhaka, N.S.; Singh, V.K.; Kumar, S. Development and characterization of an EMS-mutagenized population of wheat (Triticum aestivum L.) for agronomic trait variation and increased micronutrients content. Cereal Res. Commun. 2024, 53, 469–481. [Google Scholar] [CrossRef]
  20. Wang, W.; Guan, X.; Gan, Y.; Liu, G.; Zou, C.; Wang, W.; Zhang, J.; Zhang, H.; Hao, Q.; Ni, F. Creating large EMSpopulations for functional genomics breeding in wheat. J. Integr. Agric. 2024, 23, 484–493. [Google Scholar] [CrossRef]
  21. Komura, S.; Yoshida, K.; Jinno, H.; Oono, Y.; Handa, H.; Takumi, S.; Kobayashi, F. Identification of the causal mutation in early heading mutant of bread wheat (Triticum aestivum L.) using MutMap approach. Mol. Breed. 2024, 44, 41. [Google Scholar] [CrossRef]
  22. Liu, X.; Zheng, S.; Tian, S.; Si, Y.; Ma, S.; Ling, H.-Q.; Niu, J. Natural variant of Rht27, a dwarfing gene, enhances yield potential in wheat. Theor. Appl. Genet. 2024, 137, 128. [Google Scholar] [CrossRef]
  23. Mawcha, K.T.; Ndolo, D.; Yang, W.; Babalola, O.O. Development of EMS Mutagenized Wheat Mutant Lines Resistant to Fusarium Crown Rot and Fusarium Head Blight. Plant Breed. 2024, 12, 121. [Google Scholar] [CrossRef]
  24. OlaOlorun, B.M.; Shimelis, H.; Laing, M.; Mathew, I. Development of wheat (Triticum aestivum L.) populations for drought tolerance and improved biomass allocation through Ethyl Methanesulphonate mutagenesis. Front. Agron. 2021, 3, 655820. [Google Scholar] [CrossRef]
  25. Gharib, M.; Qabil, N.; Salem, A.; Ali, M.; Awaad, H.; Mansour, E. Characterization of wheat landraces and commercial cultivars based on morpho-phenological and agronomic traits. Cereal Res. Commun. 2021, 49, 149–159. [Google Scholar] [CrossRef]
  26. Spanic, V.; Lalic, Z.; Berakovic, I.; Jukic, G.; Varnica, I. Morphological characterization of 1322 winter wheat (Triticum aestivum L.) varieties from EU referent collection. Agriculture 2024, 14, 551. [Google Scholar] [CrossRef]
  27. Mohi-Ud-Din, M.; Hossain, M.A.; Rohman, M.M.; Uddin, M.N.; Haque, M.S.; Dessoky, E.S.; Alqurashi, M.; Aloufi, S. Assessment of genetic diversity of bread wheat genotypes for drought tolerance using canopy reflectance-based phenotyping and SSR marker-based genotyping. Sustainability 2022, 14, 9818. [Google Scholar] [CrossRef]
  28. Sallam, M.; Al-Ashkar, I.; Al-Doss, A.; Al-Gaadi, K.A.; Zeyada, A.M.; Ghazy, A. Assessing Heat Stress Tolerance of Wheat Genotypes through Integrated Molecular and Physio-Biochemical Analyses. Agronomy 2024, 14, 1999. [Google Scholar] [CrossRef]
  29. Bavandpouri, F.; Farshadfar, E.; Cheghamirza, K.; Farshadfar, M.; Bihamta, M.R.; Mahdavi, A.M.; Jelodar, N. Identification of molecular markers associated with genomic regions controlling agronomic traits in bread wheat genotypes under different moisture conditions. Plant Mol. Biol. Rep. 2025, 43, 631–651. [Google Scholar] [CrossRef]
  30. Khan, A.; Ahmad, M.; Shani, M.Y.; Khan, M.K.R.; Rahimi, M.; Tan, D.K. Identifying the physiological traits associated with DNA marker using genome wide association in wheat under heat stress. Sci. Rep. 2024, 14, 20134. [Google Scholar] [CrossRef]
  31. Knapp, S.; Döring, T.F.; Jones, H.E.; Snape, J.; Wingen, L.U.; Wolfe, M.S.; Leverington-Waite, M.; Griffiths, S. Natural selection towards wild-type in composite cross populations of winter wheat. Front. Plant Sci. 2020, 10, 1757. [Google Scholar] [CrossRef]
  32. Shew, A.; Tack, J.; Nalley, L.; Chaminuka, P. Yield reduction under climate warming varies among wheat cultivars in South Africa. Nat. Commun. 2020, 11, 4408. [Google Scholar] [CrossRef]
  33. Naik, M.; Abiodun, B.J. Projected changes in drought characteristics over the Western Cape, South Africa. Meteorol. Appl. 2020, 27, e1802. [Google Scholar] [CrossRef]
  34. Theron, S.; Archer, E.; Midgley, S.; Walker, S. Agricultural perspectives on the 2015–2018 Western Cape drought, South Africa: Characteristics and spatial variability in the core wheat growing regions. Agric. For. Meteorol. 2021, 304, 108405. [Google Scholar] [CrossRef]
  35. Ajilogba, C.F.; Walker, S. Modeling climate change impact on dryland wheat production for increased crop yield in the Free State, South Africa, using GCM projections and the DSSAT model. Front. Environ. Sci. 2023, 11, 1067008. [Google Scholar] [CrossRef]
  36. Nxumalo, G.; Bashir, B.; Alsafadi, K.; Bachir, H.; Harsányi, E.; Arshad, S.; Mohammed, S. Meteorological drought variability and its impact on wheat yields across South Africa. Int. J. Environ. Res. Public Health 2022, 19, 16469. [Google Scholar] [CrossRef]
  37. Olaolorun, B.M.; Shimelis, H.A.; Hussein, A.; Mathew, I.; Laing, M.D. Optimising the dosage of ethyl methanesulphonate mutagenesis in selected wheat genotypes. S. Afr. J. Plant Soil 2019, 36, 357–366. [Google Scholar] [CrossRef]
  38. Makebe, A.; Shimelis, H.; Mashilo, J. Selection of M5 mutant lines of wheat (Triticum aestivum L.) for agronomic traits and biomass allocation under drought stress and non-stressed conditions. Front. Plant Sci. 2024, 15, 1314014. [Google Scholar] [CrossRef]
  39. Dodig, D.; Zoric, M.; Kobiljski, B.; Savic, J.; Kandic, V.; Quarrie, S.; Barnes, J. Genetic and association mapping study of wheat agronomic traits under contrasting water regimes. Int. J. Mol. Sci. 2012, 13, 6167–6188. [Google Scholar] [CrossRef]
  40. Ateş-Sönmezoğlu, Ö.; Çevik, E.; Terzi-Aksoy, B. Assessment of some bread wheat (Triticum aestivum L.) genotypes for drought tolerance using SSR and ISSR markers. Biotech. Stud. 2022, 31, 45–52. [Google Scholar] [CrossRef]
  41. Sunilkumar, V.; Krishna, H.; Devate, N.B.; Manjunath, K.K.; Chauhan, D.; Singh, S.; Sinha, N.; Singh, J.B.; TL, P.; Pal, D. Marker-assisted selection for transfer of QTLs to a promising line for drought tolerance in wheat (Triticum aestivum L.). Front. Plant Sci. 2023, 14, 1147200. [Google Scholar] [CrossRef] [PubMed]
  42. DAFF: Department of Agriculture, Forestry and Fisheries. Wheat Production Guideline; DAFF: Pretoria, South Africa, 2010. [Google Scholar]
  43. Wei, T.; Simko, V.; Levy, M.; Xie, Y.; Jin, Y.; Zemla, J. Package “corrplot”: Visualization of a Correlation Matrix. Statistician 2017, 56, e24. [Google Scholar]
  44. Team RC. R: A Language and Environment for Statistical Computing; R Foundation for Statistical Computing: Vienna, Austria, 2022. [Google Scholar]
  45. Kassambara, A.; Mundt, F. Factoextra: Extract and Visualize the Results of Multivariate Data Analyses. 2020, pp. 1–84. Available online: https://cran.r-project.org/package=factoextra (accessed on 5 May 2020).
  46. Peakall, R.; Smouse, P.E. GenAlex 6.5: Genetic analysis in Excel. Population software for teaching and research—An update. Bioinformatics 2012, 28, 2537–2539. [Google Scholar] [CrossRef]
  47. Nagy, S.; Poczai, P.; Cernák, I.; Gorji, A.M.; Hegedűs, G.; Taller, J. PICcalc: An online program to calculate polymorphic information content for molecular genetic studies. Biochem. Genet. 2012, 50, 670–672. [Google Scholar] [CrossRef]
  48. Perrier, X.; Jacquemoud-Collet, J. DARwin Software: Dissimilarity Analysis and Representation for Windows. 2006. Available online: http://darwinciradfr/darwin (accessed on 1 March 2013).
  49. Galili, T. Dendextend: An R package for visualizing, adjusting and comparing trees of hierarchical clustering. Bioinformatics 2015, 31, 3718–3720. [Google Scholar] [CrossRef]
  50. Verma, S.; Chaudhary, H.K.; Singh, K.; Kumar, N.; Dhillon, K.S.; Sharma, M.; Sood, V. Genetic diversity dissection and population structure analysis for augmentation of bread wheat (Triticum aestivum L.) germplasm using morpho-molecular markers. Genet. Resour. Crop Evol. 2024, 71, 4093–4114. [Google Scholar] [CrossRef]
  51. Meena, V.K.; Sharma, R.; Chand, S.; Kumar, M.; Kumar, N.; Jain, N.; Singh, A. Elucidating molecular diversity in spring wheat (Triticum aestivum L. em. Thell.) under terminal heat stress environment using morpho-physiological traits and SSR markers. Indian J. Genet. Plant Breed. 2022, 82, 47–55. [Google Scholar] [CrossRef]
  52. Mahmood, M.A.; Al-falahi, A.; Hamedullah, M.S.; Al-Hattab, Z.N. Molecular evaluation of salt tolerance induced by sodium azide in immature embryos of two wheat cultivars. J. Biotechnol. Res. Ctr. 2019, 13, 44–51. [Google Scholar] [CrossRef]
  53. Şen, A.; Sarsu, F. Genetic diversity in sodium azide induced wheat mutants studied by SSR markers. Trak. Univ. J. Nat. Sci. 2018, 19, 129–135. [Google Scholar] [CrossRef]
  54. Farhangian-Kashani, S.; Azadi, A.; Khaghani, S.; Changizi, M.; Gomarian, M. Association analysis and evaluation of genetic diversity in wheat genotypes using SSR markers. Biol. Futura. 2021, 72, 441–452. [Google Scholar] [CrossRef] [PubMed]
  55. Ahmed, S.F.; Ahmed, J.U.; Hasan, M.; Mohi-Ud-Din, M. Assessment of genetic variation among wheat genotypes for drought tolerance utilizing microsatellite markers and morpho-physiological characteristics. Heliyon 2023, 9, e21629. [Google Scholar] [CrossRef]
  56. Mkhabela, S.S.; Shimelis, H.; Mashilo, J. Genetic differentiation of selected drought and heat tolerant wheat genotypes using simple sequence repeat markers and agronomic traits. S. Afr. J. Plant Soil 2020, 37, 211–219. [Google Scholar] [CrossRef]
  57. Tahir, O.; Bangash, S.A.K.; Ibrahim, M.; Shahab, S.; Khattak, S.H.; Ud Din, I.; Khan, M.N.; Hafeez, A.; Wahab, S.; Ali, B. Evaluation of agronomic performance and genetic diversity analysis using simple sequence repeats markers in selected wheat lines. Sustainability 2022, 15, 293. [Google Scholar] [CrossRef]
  58. Demirel, S.; Demirel, F. Molecular identification and population structure of emmer and einkorn wheat lines with different ploidy levels using SSR markers. Genet. Resour. Crop Evol. 2024, 71, 363–372. [Google Scholar] [CrossRef]
  59. Urquijo-Zamora, L.; Pereira-Lorenzo, S.; Romero-Rodríguez, Á.; Lombardero-Fernández, M.; Ramos-Cabrer, A.M.; Fernández-Otero, C.I. Genetic diversity of local wheat (triticum aestivum L.) and traceability in the production of galician bread (protected geographical indication) by microsatellites. Agriculture 2024, 15, 51. [Google Scholar] [CrossRef]
  60. Dagnaw, T.; Mulugeta, B.; Haileselassie, T.; Geleta, M.; Ortiz, R.; Tesfaye, K. Genetic diversity of durum wheat (Triticum turgidum L. ssp. Durum, desf) germplasm as revealed by morphological and SSR markers. Genes 2023, 14, 1155. [Google Scholar] [CrossRef]
  61. Gao, Z.; Wang, Y.; Tian, G.; Zhao, Y.; Li, C.; Cao, Q.; Han, R.; Shi, Z.; He, M. Plant height and its relationship with yield in wheat under different irrigation regime. Irrig. Sci. 2020, 38, 365–371. [Google Scholar] [CrossRef]
  62. Ding, Y.-G.; Zhang, X.-B.; Quan, M.; Li, F.-J.; Tao, R.-R.; Min, Z.; Li, C.-Y.; Zhu, X.-K.; Guo, W.-S.; Ding, J.-F. Tiller fertility is critical for improving grain yield, photosynthesis, and nitrogen efficiency in wheat. J. Integr. Agric. 2023, 22, 2054–2066. [Google Scholar] [CrossRef]
  63. Zaman, Z.; Iqbal, R.; Jabbar, A.; Zahra, N.; Saleem, B.; Kiran, A.; Maqbool, S.; Rasheed, A.; Naeem, M.K.; Khan, M.R. Genetic signature controlling root system architecture in diverse spring wheat germplasm. Physiol. Plant. 2024, 176, e14183. [Google Scholar] [CrossRef]
  64. Lynch, J.P. Root phenotypes for improved nutrient capture: An underexploited opportunity for global agriculture. New Phytol. 2019, 223, 548–564. [Google Scholar] [CrossRef]
  65. Jimenez-Berni, J.A.; Deery, D.M.; Rozas-Larraondo, P.; Condon, A.G.; Rebetzke, G.J.; James, R.A.; Bovill, W.D.; Furbank, R.T.; Sirault, X.R. High throughput determination of plant height, ground cover, and above-ground biomass in wheat with LiDAR. Front. Plant Sci. 2018, 9, 237. [Google Scholar] [CrossRef]
  66. Khan, M.A.; Yousaf, M.W.; Ahmed, H.G.M.-D.; Fatima, N.; Alam, B. Assessing genetic diversity for some Pakistani bread wheat (Triticum aestivum L.) genotypes under drought stress based on yield traits. Genet. Resour. Crop Evol. 2024, 71, 3563–3573. [Google Scholar] [CrossRef]
  67. Sandeep, N.; Kumar, B.; Chavan, A.L. Microsatellite Marker–Driven Genetic Diversity and Breeding Potential Assessment in Okra (Abelmoschus esculentus (L.) Moench): A Multi-parent Approach. Plant Mol. Biol. Rep. 2025, 24, 1496–1511. [Google Scholar] [CrossRef]
Figure 1. Principal coordinate analysis (PCoA) showing genetic relationships of check wheat varieties and mutant lines based on 10 simple sequence repeat markers.
Figure 1. Principal coordinate analysis (PCoA) showing genetic relationships of check wheat varieties and mutant lines based on 10 simple sequence repeat markers.
Genes 16 01210 g001
Figure 2. Dendrogram showing genetic diversity among the 20 wheat genotypes, which included check varieties and mutant lines, using 10 polymorphic Simple Sequence Repeat markers.
Figure 2. Dendrogram showing genetic diversity among the 20 wheat genotypes, which included check varieties and mutant lines, using 10 polymorphic Simple Sequence Repeat markers.
Genes 16 01210 g002
Figure 3. Mean values for agronomic traits of 20 wheat genotypes evaluated under drought-stressed (DS) and non-stressed (NS) conditions across glasshouse and field conditions. DTH: days to 50% heading, DTM: days to 90% maturity, PH: plant height, PTN: productive tiller number, RB: root biomass, RSR: root-shoot ratio, SB: shoot biomass, SL: spike length, TB: total biomass, TSW: thousand seed weight, GY: grain yield. DS, drought stress, NS, non-stressed. (a) days to 50% heading; (b) days to 90% maturity; (c) Plant height; (d) productive tiller number; (e) root biomass; (f) root-shoot ratio; (g) Shoot biomass; (h) Spike length; (i) Total biomass; (j) Thousand seed weight; (k) Grain yield.
Figure 3. Mean values for agronomic traits of 20 wheat genotypes evaluated under drought-stressed (DS) and non-stressed (NS) conditions across glasshouse and field conditions. DTH: days to 50% heading, DTM: days to 90% maturity, PH: plant height, PTN: productive tiller number, RB: root biomass, RSR: root-shoot ratio, SB: shoot biomass, SL: spike length, TB: total biomass, TSW: thousand seed weight, GY: grain yield. DS, drought stress, NS, non-stressed. (a) days to 50% heading; (b) days to 90% maturity; (c) Plant height; (d) productive tiller number; (e) root biomass; (f) root-shoot ratio; (g) Shoot biomass; (h) Spike length; (i) Total biomass; (j) Thousand seed weight; (k) Grain yield.
Genes 16 01210 g003
Figure 4. Correlation coefficient of phenotypic traits of 20 wheat genotypes evaluated under non-stressed conditions across glasshouse and field environments. DTH: days to 50% heading; DTM: days to 90% maturity; PH: plant height; PTN: productive tiller number; SB: shoot biomass; RB: root biomass; TB: total biomass; RSR: root–shoot ratio; SL: spike length; TSW: thousand-seed weight; GY: grain yield; *: significant at p < 0.05; **: p < 0.01; ***: p < 0.001.
Figure 4. Correlation coefficient of phenotypic traits of 20 wheat genotypes evaluated under non-stressed conditions across glasshouse and field environments. DTH: days to 50% heading; DTM: days to 90% maturity; PH: plant height; PTN: productive tiller number; SB: shoot biomass; RB: root biomass; TB: total biomass; RSR: root–shoot ratio; SL: spike length; TSW: thousand-seed weight; GY: grain yield; *: significant at p < 0.05; **: p < 0.01; ***: p < 0.001.
Genes 16 01210 g004
Figure 5. Correlation coefficient of phenotypic traits of 20 wheat genotypes evaluated under drought-stressed conditions across glasshouse and field environments. DTH: days to 50% heading; DTM: days to 90% maturity; PH: plant height; PTN: productive tiller number; SB: shoot biomass; RB: root biomass; TB: total biomass; RSR: root–shoot ratio; SL: spike length; TSW: thousand-seed weight; GY: grain yield; *: significant at p < 0.05; **: p < 0.01; ***: p < 0.001.
Figure 5. Correlation coefficient of phenotypic traits of 20 wheat genotypes evaluated under drought-stressed conditions across glasshouse and field environments. DTH: days to 50% heading; DTM: days to 90% maturity; PH: plant height; PTN: productive tiller number; SB: shoot biomass; RB: root biomass; TB: total biomass; RSR: root–shoot ratio; SL: spike length; TSW: thousand-seed weight; GY: grain yield; *: significant at p < 0.05; **: p < 0.01; ***: p < 0.001.
Genes 16 01210 g005
Figure 6. Principal component biplot depicts the grouping of 20 bread wheat genotypes evaluated under DS conditions. DTH, days to 50% heading; DTM, days to 90% maturity; PH, plant height; PTN, productive tiller number; SB, shoot biomass; RB, root biomass; TB, total biomass; RSR, root–shoot ratio; SL, spike length; TSW, thousand-seed weight; GY, grain yield.
Figure 6. Principal component biplot depicts the grouping of 20 bread wheat genotypes evaluated under DS conditions. DTH, days to 50% heading; DTM, days to 90% maturity; PH, plant height; PTN, productive tiller number; SB, shoot biomass; RB, root biomass; TB, total biomass; RSR, root–shoot ratio; SL, spike length; TSW, thousand-seed weight; GY, grain yield.
Genes 16 01210 g006
Figure 7. Principal component biplot depicts grouping of 20 bread wheat genotypes evaluated under NS conditions. DTH, days to 50% heading; DTM, days to 90% maturity; PH, plant height; PTN, productive tiller number; SB, shoot biomass; RB, root biomass; TB, total biomass; RSR, root–shoot ratio; SL, spike length; TSW, thousand-seed weight; GY, grain yield.
Figure 7. Principal component biplot depicts grouping of 20 bread wheat genotypes evaluated under NS conditions. DTH, days to 50% heading; DTM, days to 90% maturity; PH, plant height; PTN, productive tiller number; SB, shoot biomass; RB, root biomass; TB, total biomass; RSR, root–shoot ratio; SL, spike length; TSW, thousand-seed weight; GY, grain yield.
Genes 16 01210 g007
Figure 8. Hierarchical clustering of 20 wheat genotypes based on phenotypic traits measured under drought stress (DS) conditions.
Figure 8. Hierarchical clustering of 20 wheat genotypes based on phenotypic traits measured under drought stress (DS) conditions.
Genes 16 01210 g008
Figure 9. Hierarchical clustering of 20 wheat genotypes based on phenotypic traits measured under NS conditions.
Figure 9. Hierarchical clustering of 20 wheat genotypes based on phenotypic traits measured under NS conditions.
Genes 16 01210 g009
Figure 10. Tanglegram comparison of phenotypic and genotypic hierarchical clusters of 20 wheat genotypes based on 10 SSR markers and phenotypic traits measured under drought stress conditions.
Figure 10. Tanglegram comparison of phenotypic and genotypic hierarchical clusters of 20 wheat genotypes based on 10 SSR markers and phenotypic traits measured under drought stress conditions.
Genes 16 01210 g010
Figure 11. Tanglegram comparison of phenotypic and genotypic hierarchical clusters of 20 wheat genotypes based on 10 SSR markers and phenotypic traits measured under non-stress conditions.
Figure 11. Tanglegram comparison of phenotypic and genotypic hierarchical clusters of 20 wheat genotypes based on 10 SSR markers and phenotypic traits measured under non-stress conditions.
Genes 16 01210 g011
Table 1. List of wheat mutant lines and check varieties used in this study.
Table 1. List of wheat mutant lines and check varieties used in this study.
Entry No.GenotypePedigreeSource
1LMA2MutantACCI
2LMA5MutantACCI
3LMA6MutantACCI
4LMA8MutantACCI
5LMA15MutantACCI
6LMA16MutantACCI
7LMA19MutantACCI
8LMA21MutantACCI
9LMA22MutantACCI
10LMA29MutantACCI
11LMA31MutantACCI
12LMA37MutantACCI
13LMA42MutantACCI
14LM43ROLF07*2/6/PVN//CAR422/ANA/5/
BOW/CROW//BUC/PVN/3/YR/4/TRAP#1
CIMMYT
15LMA44MutantACCI
16LMA47MutantACCI
17LMA53MutantACCI
18SS0166PBRSensako
19SST0117PBRSensako
20SST015PBRSensako
ACCI—African Centre for Crop improvement; CIMMYT—International Maize and Wheat Improvement Center; PBR—Plant Breeder’s Right. * indicates repeated crossing (backcrossing).
Table 2. List of the ten SSR markers used in the study.
Table 2. List of the ten SSR markers used in the study.
Marker NameChromosome
Location
Primer Sequence
Xgwm1326AF: ACCAAATCGAAACACATCAGG
R: CATATCAAGGTCTCCTTCCCC
Xgmw4842DF: ACATCGCTCTTCACAAACCC
R: AGTTCCGGTCATGGCTAGG
XWMC5967AF: TCAGCAACAAACATGCTCGG
R: CCCGTGTAGGCGGTAGCCTCTT
Wmc1796AF: CATGGTGGCCATGAGTGGAGGT
R: CATGATCTTGCGTGTGCGTAGG
GWM3371DF: CCTCTTCCTCCCTCATTAGC
R: TGCTAACTGGCCTTTGCC
Wms1696AF: ACCACTGCAGAGAACACATACG
R: GTGCTCTGCTCTAAGTGTGGG
Wms302DF: ATCTTAGCATAGAAGGGAGTGGG
R: TTCTGCACCCTGGGTGAT
Wmc1772AF: AGGGCTCTCTTTAATTCTTGCT
R: GGTCTATCGTAATCCACCTGTA
Wmc5322BF: GATACATCAAGATCGTGCCAAA
R: GGGAGAAATCATTAACGAAGGG
Wmc783BF: AGTAAATCCTCCCTTCGGCTTC
R: AGCTTCTTTGCTAGTCCGTTGC
F—Forward, R—Reverse primer.
Table 3. Genetic diversity parameters generated by 10 SSR markers.
Table 3. Genetic diversity parameters generated by 10 SSR markers.
MarkersProduct Size (bp)NaNeIHoHeFPIC
WMS30217–2442.001.930.670.890.48−0.830.49
Xgwm13297–2442.002.000.691.000.50−1.000.50
Xgwm484170–1923.002.170.710.330.400.310.68
XWMC596159–1753.002.310.760.110.430.770.83
WMS169143–1572.001.790.610.760.43−0.690.43
WMC179216–3763.002.530.900.980.57−0.760.77
GWM337189–2041.001.270.210.000.151.000.28
WMC532178–1972.001.670.370.000.221.000.50
WMC782661.001.000.000.000.000.000.00
WMC177200–2092.001.560.430.160.300.500.61
Mean-2.101.820.540.420.350.240.51
SE-0.170.150.080.090.050.150.09
Na = number of observed alleles; Ne = number of effective alleles; I = Shannon’s information index; Ho = observed heterozygosity; He = average gene diversity within genotypes; F = fixation index; PIC = polymorphic information content; SE = standard error.
Table 4. Mean squares and significant tests for agronomic traits of 20 wheat genotypes evaluated in the glasshouse and field environments under drought-stressed and non-stressed conditions.
Table 4. Mean squares and significant tests for agronomic traits of 20 wheat genotypes evaluated in the glasshouse and field environments under drought-stressed and non-stressed conditions.
Changed.f.DTHDTMPHPTNRBRSRSBSLTBTSWGY
Rep141.00 *302.50 *0 ns3.86 ns0.97 ns0.00 ns442.29 *0.00 ns845.3 *18.975.67 ns
Genotype (G)19173.50 **171.80 **146.83 **57.77 **46.96 **0.00 *665.76 **6.75 **960.89 **54.19 **213.76 **
Water regime (W)19.51 ns10,530.02 **1163.61 **868.81574.77 **0.01 *27,490.10 **0.28 ns35,594.95 **2381.70 **7523.40 **
Environment (E)113,634.56 **41,473.60 **50,673.62 **12,147.32 **1493.82 **0.04 **13,381.70 **846.98 **14,525.25 **9905.34 **7789.16 **
G × W1915.41 *17.64 ns23.36 ns5.93 ns14.10 ns0.00 ns77.31 ns0.97 ns145.04 ns14.27 *27.70 ns
G × E1915.68 *44.11 ns180.60 **48.97 **22.92 *0.00 ns149.51 *2.43 *240.85 **35.83 **222.45 **
W × E171.5 *6416.03 **108.28 *537.14 **36.08 ns0.00 ns1440.00 **1.85 ns2822.40 **130.52 **29.63 ns
G × W × E196.39 ns52.67 *17.99 ns4.8165.85 ns0.00 ns77.72 ns1.25 ns151.47 *21.60 *65.32 *
Residual797.71529.2122.053.54211.75075.61.06186.488.28229.99
Rep: replications; df: degrees of freedom; DTH: days to 50% heading; DTM: days to 90% maturity; PH: plant height; PTN: productive tiller number; RB: root biomass; RSR: root–shoot ratio; SB: shoot biomass; SL: spike length; TB: total biomass; TSW: thousand-seed weight; GY: grain yield; *: significant at 5% probability level; **: significant at 1% probability level; ns: non-significant.
Table 5. Principal component scores, proportion and cumulative variance of agronomic traits assessed among 20 bread wheat genotypes evaluated under drought-stress (DS) and non-stress (NS) conditions across field and glasshouse environments.
Table 5. Principal component scores, proportion and cumulative variance of agronomic traits assessed among 20 bread wheat genotypes evaluated under drought-stress (DS) and non-stress (NS) conditions across field and glasshouse environments.
Drought StressedNon-Stressed
TraitsPC1PC2PC1PC2PC3
DTH0.29−0.410.250.05−0.67
DTM0.26−0.550.290.06−0.58
GY0.320.220.310.020.27
PH0.310.290.33−0.030.02
PTN0.300.150.36−0.080.10
RB0.340.210.21−0.620.04
RSR0.240.51−0.07−0.73−0.13
SB0.33−0.210.360.070.24
SL0.300.020.340.20−0.02
TB0.33−0.140.360.090.17
TSW0.29−0.090.31−0.150.16
Eigenvalue7.411.186.821.771.00
Proportion of total variance (%)67.3510.6861.9716.119.06
Cumulative variance (%)67.3578.0361.9778.0887.14
DTH, days to 50% heading; DTM, days to 90% maturity; PH, plant height; PTN, productive tiller number; SB, shoot biomass; RB, root biomass; TB, total biomass; RSR, root–shoot ratio; SL, spike length; TSW, thousand-seed weight; GY, grain yield; bold-face fonts denote significant loading scores.
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Makebe, A.; Shimelis, H.; Mashilo, J. Genetic Interrelationship Among Newly-Bred Mutant Lines of Wheat Using Diagnostic Simple Sequence Repeat Markers and Phenotypic Traits Under Drought. Genes 2025, 16, 1210. https://doi.org/10.3390/genes16101210

AMA Style

Makebe A, Shimelis H, Mashilo J. Genetic Interrelationship Among Newly-Bred Mutant Lines of Wheat Using Diagnostic Simple Sequence Repeat Markers and Phenotypic Traits Under Drought. Genes. 2025; 16(10):1210. https://doi.org/10.3390/genes16101210

Chicago/Turabian Style

Makebe, Athenkosi, Hussein Shimelis, and Jacob Mashilo. 2025. "Genetic Interrelationship Among Newly-Bred Mutant Lines of Wheat Using Diagnostic Simple Sequence Repeat Markers and Phenotypic Traits Under Drought" Genes 16, no. 10: 1210. https://doi.org/10.3390/genes16101210

APA Style

Makebe, A., Shimelis, H., & Mashilo, J. (2025). Genetic Interrelationship Among Newly-Bred Mutant Lines of Wheat Using Diagnostic Simple Sequence Repeat Markers and Phenotypic Traits Under Drought. Genes, 16(10), 1210. https://doi.org/10.3390/genes16101210

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop