MicroRNA-Induced Regulation of the IGF-1 System in Various Types of Cancer
Abstract
1. Introduction
2. MicroRNA-Induced Regulation of IGF-1
3. MicroRNA-Induced Regulation of IGF-1: Breast Cancer
4. MicroRNA-Induced Regulation of IGF-1: Gastric and Colorectal Cancer
5. MicroRNA-Induced Regulation of IGF-1: Lung Cancer
6. MicroRNA-Induced Regulation of IGF-1: Hepatic and Pancreatic Cancer
7. MicroRNA-Induced Regulation of IGF-1: Osteosarcoma
8. Future Perspectives and Clinical Applications
9. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Rinderknecht, E.; Humbel, R.E. The Amino Acid Sequence of Human Insulin-like Growth Factor I and Its Structural Homology with Proinsulin. J. Biol. Chem. 1978, 253, 2769–2776. [Google Scholar] [CrossRef]
- Philippou, A.; Maridaki, M.; Pneumaticos, S.; Koutsilieris, M. The Complexity of the IGF1 Gene Splicing, Posttranslational Modification and Bioactivity. Mol. Med. 2014, 20, 202–214. [Google Scholar] [CrossRef]
- Philippou, A.; Christopoulos, P.F.; Koutsilieris, M. Clinical Studies in Humans Targeting the Various Components of the IGF System Show Lack of Efficacy in the Treatment of Cancer. Mutat. Res./Rev. Genet. Toxicol. 2017, 772, 105–122. [Google Scholar] [CrossRef]
- Gkioka, E.; Msaouel, P.; Philippou, A.; Vlaghogiannis, N.I.; Vogkou, C.T.; Margiolis, A.; Koutsilieris, M. Review: The Role of Insulin-like Growth Factor-1 Signaling Pathways in Uterine Leiomyoma. In Vivo 2015, 29, 637–649. [Google Scholar]
- Philippou, A.; Barton, E.R. Optimizing IGF-I for Skeletal Muscle Therapeutics. Growth Horm. IGF Res. 2014, 24, 157–163. [Google Scholar] [CrossRef]
- Barton, E.R. The ABCs of IGF-I Isoforms: Impact on Muscle Hypertrophy and Implications for Repair. Appl. Physiol. Nutr. Metab. 2006, 31, 791–797. [Google Scholar] [CrossRef]
- Philippou, A.; Halapas, A.; Maridaki, M.; Koutsilieris, M. Type I Insulin-like Growth Factor Receptor Signaling in Skeletal Muscle Regeneration and Hypertrophy. J. Musculoskelet. Neuronal Interact. 2007, 7, 208–218. [Google Scholar]
- Chen, J.; Yuan, K.; Mao, X.; Miano, J.M.; Wu, H.; Chen, Y. Serum Response Factor Regulates Bone Formation via IGF1 and Runx2 Signals. J. Bone Miner. Res. 2012, 27, 1659–1668. [Google Scholar] [CrossRef] [PubMed]
- Höppener, J.W.M.; de Pagter-Holthuizen, P.; van Kessel, A.H.M.G.; Jansen, M.; Kittur, S.D.; Antonarakis, S.E.; Lips, C.J.M.; Sussenbach, J.S. The Human Gene Encoding Insulin-like Growth Factor I Is Located on Chromosome 12. Hum. Genet. 1985, 69, 157–160. [Google Scholar] [CrossRef] [PubMed]
- Karagiannis, A.K.; Philippou, A.; Tseleni-Balafouta, S.; Zevolis, E.; Nakouti, T.; Tsopanomichalou-Gklotsou, M.; Psarras, V.; Koutsilieris, M. IGF-IEc Expression Is Associated With Advanced Differentiated Thyroid Cancer. Anticancer Res. 2019, 39, 2811–2819. [Google Scholar] [CrossRef] [PubMed]
- Mourmouras, N.; Philippou, A.; Christopoulos, P.; Kostoglou, K.; Grivaki, C.; Konstantinidis, C.; Serafetinides, E.; Delakas, D.; Koutsilieris, M. Differential Expression of IGF-I Transcripts in Bladder Cancer. Anticancer Res. 2018, 38, 3453–3459. [Google Scholar] [CrossRef] [PubMed]
- Alexandraki, K.I.; Philippou, A.; Boutzios, G.; Theohari, I.; Koutsilieris, M.; Delladetsima, I.K.; Kaltsas, G.A. IGF-IEc Expression Is Increased in Secondary Compared to Primary Foci in Neuroendocrine Neoplasms. Oncotarget 2017, 8, 79003–79011. [Google Scholar] [CrossRef][Green Version]
- Philippou, A.; Armakolas, A.; Panteleakou, Z.; Pissimissis, N.; Nezos, A.; Theos, A.; Kaparelou, M.; Armakolas, N.; Pneumaticos, S.G.; Koutsilieris, M. IGF1Ec Expression in MG-63 Human Osteoblast-like Osteosarcoma Cells. Anticancer Res. 2011, 31, 4259–4265. [Google Scholar] [PubMed]
- Philippou, A.; Armakolas, A.; Koutsilieris, M. Evidence for the Possible Biological Significance of the Igf-1 Gene Alternative Splicing in Prostate Cancer. Front. Endocrinol. 2013, 4, 31. [Google Scholar] [CrossRef]
- Ahtiainen, J.P.; Hulmi, J.J.; Lehti, M.; Kraemer, W.J.; Nyman, K.; Selänne, H.; Alen, M.; Komulainen, J.; Kovanen, V.; Mero, A.A.; et al. Effects of Resistance Training on Expression of IGF-I Splice Variants in Younger and Older Men. Eur. J. Sport Sci. 2016, 16, 1055–1063. [Google Scholar] [CrossRef]
- Moustogiannis, A.; Philippou, A.; Zevolis, E.; Taso, O.S.; Giannopoulos, A.; Chatzigeorgiou, A.; Koutsilieris, M. Effect of Mechanical Loading of Senescent Myoblasts on Their Myogenic Lineage Progression and Survival. Cells 2022, 11, 3979. [Google Scholar] [CrossRef]
- Shimatsu, A.; Rotwein, P. Mosaic Evolution of the Insulin-like Growth Factors. Organization, Sequence, and Expression of the Rat Insulin-like Growth Factor I Gene. J. Biol. Chem. 1987, 262, 7894–7900. [Google Scholar] [CrossRef]
- Brisson, B.K.; Barton, E.R. New Modulators for IGF-I Activity within IGF-I Processing Products. Front. Endocrinol. 2013, 4, 42. [Google Scholar] [CrossRef]
- Lee, E.K.; Gorospe, M. Minireview: Posttranscriptional Regulation of the Insulin and Insulin-Like Growth Factor Systems. Endocrinology 2009, 151, 1403–1408. [Google Scholar] [CrossRef]
- Oberbauer, A.M. The Regulation of IGF-1 Gene Transcription and Splicing during Development and Aging. Front. Endocrinol. 2013, 4, 39. [Google Scholar] [CrossRef] [PubMed]
- Bartel, D.P. MicroRNAs. Cell 2004, 116, 281–297. [Google Scholar] [CrossRef]
- Lee, R.C.; Feinbaum, R.L.; Ambros, V. The C. elegans Heterochronic Gene Lin-4 Encodes Small RNAs with Antisense Complementarity to Lin-14. Cell 1993, 75, 843–854. [Google Scholar] [CrossRef] [PubMed]
- Maes, O.C.; An, J.; Sarojini, H.; Wang, E. Murine MicroRNAs Implicated in Liver Functions and Aging Process. Mech. Ageing Dev. 2008, 129, 534–541. [Google Scholar] [CrossRef]
- Hitachi, K.; Tsuchida, K. Role of MicroRNAs in Skeletal Muscle Hypertrophy. Front. Physiol. 2014, 4, 408. [Google Scholar] [CrossRef]
- Mariño, G.; Ugalde, A.P.; Fernández, Á.F.; Osorio, F.G.; Fueyo, A.; Freije, J.M.P.; López-Otín, C. Insulin-like Growth Factor 1 Treatment Extends Longevity in a Mouse Model of Human Premature Aging by Restoring Somatotroph Axis Function. Proc. Natl. Acad. Sci. USA 2010, 107, 16268–16273. [Google Scholar]
- Smith, S.S.; Kessler, C.B.; Shenoy, V.; Rosen, C.J.; Delany, A.M. IGF-I 3 Untranslated Region: Strain-Specific Polymorphisms and Motifs Regulating IGF-I in Osteoblasts. Endocrinology 2013, 154, 253–262. [Google Scholar]
- Pincus, Z.; Smith-Vikos, T.; Slack, F.J. MicroRNA Predictors of Longevity in Caenorhabditis Elegans. PLoS Genet. 2011, 7, e1002306. [Google Scholar]
- de Lencastre, A.; Pincus, Z.; Zhou, K.; Kato, M.; Lee, S.S.; Slack, F.J. MicroRNAs Both Promote and Antagonize Longevity in C. Elegans. Curr. Biol. 2010, 20, 2159–2168. [Google Scholar] [CrossRef] [PubMed]
- Farazi, T.A.; Spitzer, J.I.; Morozov, P.; Tuschl, T. MiRNAs in Human Cancer. J. Pathol. 2010, 223, 102–115. [Google Scholar] [CrossRef] [PubMed]
- MacFarlane, L.-A.; Murphy, P.R. MicroRNA: Biogenesis, Function and Role in Cancer. Curr. Genom. 2010, 11, 537–561. [Google Scholar] [CrossRef]
- Aucher, A.; Rudnicka, D.; Davis, D.M. MicroRNAs Transfer from Human Macrophages to Hepato-Carcinoma Cells and Inhibit Proliferation. J. Immunol. 2013, 191, 6250–6260. [Google Scholar] [PubMed]
- Hynes, N.E.; Watson, C.J. Mammary Gland Growth Factors: Roles in Normal Development and in Cancer. Cold Spring Harb. Perspect. Biol. 2010, 2, a003186. [Google Scholar] [CrossRef] [PubMed]
- Sachdev, D.; Yee, D. The IGF System and Breast Cancer. Endocr.-Relat. Cancer 2001, 8, 197–209. [Google Scholar] [CrossRef] [PubMed]
- Chen, L.; Wang, Q.; Wang, G.; Wang, H.; Huang, Y.; Liu, X.; Cai, X. MiR16 Inhibits Cell Proliferation by Targeting IGF1R and the Raf1–MEK1/2–ERK1/2 Pathway in Osteosarcoma. FEBS Lett. 2013, 587, 1366–1372. [Google Scholar] [CrossRef] [PubMed]
- Josse, C.; Bouznad, N.; Geurts, P.; Irrthum, A.; Huynh-Thu, V.A.; Servais, L.; Hego, A.; Delvenne, P.; Bours, V.; Oury, C. Identification of a MicroRNA Landscape Targeting the PI3K/Akt Signaling Pathway in Inflammation-Induced Colorectal Carcinogenesis. Am. J. Physiol.-Gastrointest. Liver Physiol. 2014, 306, G229–G243. [Google Scholar]
- Sarfstein, R.; Pasmanik-Chor, M.; Yeheskel, A.; Edry, L.; Shomron, N.; Warman, N.; Wertheimer, E.; Maor, S.; Shochat, L.; Werner, H. Insulin-like Growth Factor-I Receptor (IGF-IR) Translocates to Nucleus and Autoregulates IGF-IR Gene Expression in Breast Cancer Cells. J. Biol. Chem. 2012, 287, 2766–2776. [Google Scholar] [CrossRef]
- Png, K.J.; Halberg, N.; Yoshida, M.; Tavazoie, S.F. A MicroRNA Regulon That Mediates Endothelial Recruitment and Metastasis by Cancer Cells. Nature 2011, 481, 190–194. [Google Scholar] [CrossRef]
- Wang, B.; Wang, H.; Yang, Z. MiR-122 Inhibits Cell Proliferation and Tumorigenesis of Breast Cancer by Targeting IGF1R. PLoS ONE 2012, 7, e47053. [Google Scholar]
- Khadka, V.S.; Nasu, M.; Deng, Y.; Jijiwa, M. Circulating MicroRNA Biomarker for Detecting Breast Cancer in High-Risk Benign Breast Tumors. Int. J. Mol. Sci. 2023, 24, 7553. [Google Scholar]
- Ye, X.-M.; Zhu, H.-Y.; Bai, W.-D.; Wang, T.; Wang, L.; Chen, Y.; Yang, A.-G.; Jia, L.-T. Epigenetic Silencing of MiR-375 Induces Trastuzumab Resistance in HER2-Positive Breast Cancer by Targeting IGF1R. BMC Cancer 2014, 14, 134. [Google Scholar]
- Guo, S.T.; Jiang, C.C.; Wang, G.P.; Li, Y.P.; Wang, C.Y.; Guo, X.Y.; Yang, R.H.; Feng, Y.; Wang, F.H.; Tseng, H.-Y.; et al. Correction: MicroRNA-497 Targets Insulin-like Growth Factor 1 Receptor and Has a Tumour Suppressive Role in Human Colorectal Cancer. Oncogene 2025, 44, 2008–2009. [Google Scholar] [CrossRef] [PubMed]
- Kim, S.-J.; Oh, J.-S.; Shin, J.-Y.; Lee, K.-D.; Sung, K.W.; Nam, S.J.; Chun, K.-H. Development of MicroRNA-145 for Therapeutic Application in Breast Cancer. J. Control. Release 2011, 155, 427–434. [Google Scholar] [CrossRef] [PubMed]
- Zhao, X.; Dou, W.; He, L.; Liang, S.; Tie, J.; Liu, C.; Li, T.; Lu, Y.; Mo, P.; Shi, Y.; et al. MicroRNA-7 Functions as an Anti-Metastatic MicroRNA in Gastric Cancer by Targeting Insulin-like Growth Factor-1 Receptor. Oncogene 2012, 32, 1363–1372. [Google Scholar] [CrossRef]
- Qian, X.; Yu, J.; Yin, Y.; He, J.; Wang, L.; Li, Q.; Zhang, L.-Q.; Li, C.-Y.; Shi, Z.-M.; Xu, Q.; et al. MicroRNA-143 Inhibits Tumor Growth and Angiogenesis and Sensitizes Chemosensitivity to Oxaliplatin in Colorectal Cancers. Cell Cycle 2013, 12, 1385–1394. [Google Scholar] [CrossRef]
- Shen, K.; Liang, Q.; Xu, K.; Cui, D.; Jiang, L.; Yin, P.; Lu, Y.; Li, Q.; Liu, J. MiR-139 Inhibits Invasion and Metastasis of Colorectal Cancer by Targeting the Type I Insulin-like Growth Factor Receptor. Biochem. Pharmacol. 2012, 84, 320–330. [Google Scholar] [CrossRef] [PubMed]
- La Rocca, G.; Badin, M.; Shi, B.; Xu, S.; DeAngelis, T.; SeppLorenzinoi, L.; Baserga, R. Mechanism of Growth Inhibition by MicroRNA 145: The Role of the IGFI Receptor Signaling Pathway. J. Cell Physiol. 2009, 220, 485–491. [Google Scholar] [CrossRef]
- Thaker, A.I.; Shaker, A.; Rao, M.S.; Ciorba, M.A. Modeling Colitis-Associated Cancer with Azoxymethane (AOM) and Dextran Sulfate Sodium (DSS). J. Vis. Exp. 2012, 67, 4100. [Google Scholar]
- Peng, Y.; Dai, Y.; Hitchcock, C.; Yang, X.; Kassis, E.S.; Liu, L.; Luo, Z.; Sun, H.-L.; Cui, R.; Wei, H.; et al. Insulin Growth Factor Signaling Is Regulated by MicroRNA-486, an Underexpressed MicroRNA in Lung Cancer. Proc. Natl. Acad. Sci. USA 2013, 110, 15043–15048. [Google Scholar] [CrossRef]
- Gong, M.; Ma, J.; Guillemette, R.; Zhou, M.; Yang, Y.; Yang, Y.; Hock, J.M.; Yu, X. MiR-335 Inhibits Small Cell Lung Cancer Bone Metastases via IGF-IR and RANKL Pathways. Mol. Cancer Res. 2014, 12, 101–110. [Google Scholar] [CrossRef]
- Law, P.T.-Y.; Ching, A.K.-K.; Chan, A.W.-H.; Wong, Q.W.-L.; Wong, C.-K.; To, K.-F.; Wong, N. MiR-145 Modulates Multiple Components of the Insulin-like Growth Factor Pathway in Hepatocellular Carcinoma. Carcinogenesis 2012, 33, 1134–1141. [Google Scholar] [CrossRef]
- Rajpathak, S.N.; Gunter, M.J.; Wylie-Rosett, J.; Ho, G.Y.F.; Kaplan, R.C.; Muzumdar, R.; Rohan, T.E.; Strickler, H.D. The Role of Insulin-like Growth Factor-I and Its Binding Proteins in Glucose Homeostasis and Type 2 Diabetes. Diabetes/Metab. Res. Rev. 2009, 25, 3–12. [Google Scholar] [CrossRef]
- Hung, T.-M.; Ho, C.-M.; Liu, Y.-C.; Lee, J.-L.; Liao, Y.-R.; Wu, Y.-M.; Ho, M.-C.; Chen, C.-H.; Lai, H.-S.; Lee, P.-H. Up-Regulation of MicroRNA-190b Plays a Role for Decreased IGF-1 That Induces Insulin Resistance in Human Hepatocellular Carcinoma. PLoS ONE 2014, 9, e89446. [Google Scholar] [CrossRef]
- Shi, X.; Teng, F. Down-Regulated MiR-28-5p in Human Hepatocellular Carcinoma Correlated with Tumor Proliferation and Migration by Targeting Insulin-like Growth Factor-1 (IGF-1). Mol. Cell Biochem. 2015, 408, 283–293. [Google Scholar] [CrossRef]
- Chakraborty, C.; Doss, C.G.P.; Bandyopadhyay, S. MiRNAs in Insulin Resistance and Diabetes-Associated Pancreatic Cancer: The Minute and Miracle Molecule Moving as a Monitor in the Genomic Galaxy. Curr. Drug Targets 2013, 14, 1110–1117. [Google Scholar] [CrossRef]
- Xu, J.-W.; Wang, T.-X.; You, L.; Zheng, L.-F.; Shu, H.; Zhang, T.-P.; Zhao, Y.-P. Insulin-Like Growth Factor 1 Receptor (IGF-1R) as a Target of MiR-497 and Plasma IGF-1R Levels Associated with TNM Stage of Pancreatic Cancer. PLoS ONE 2014, 9, e92847. [Google Scholar] [CrossRef] [PubMed]
- Huang, J.S.; Egger, M.E.; Grizzle, W.E.; McNally, L.R. MicroRNA-100 Regulates IGF1-Receptor Expression in Metastatic Pancreatic Cancer Cells. Biotech. Histochem. 2013, 88, 397–402. [Google Scholar] [CrossRef] [PubMed]
- Lei, S.; Zeng, Z.; He, Z.; Cao, W. MiRNA7515 Suppresses Pancreatic Cancer Cell Proliferation, Migration and Invasion via Downregulating IGF1 Expression. Oncol. Rep. 2021, 46. [Google Scholar] [CrossRef]
- Nugent, M. MicroRNA Function and Dysregulation in Bone Tumors: The Evidence to Date. Cancer Manag. Res. 2014, 6, 15–25. [Google Scholar] [CrossRef]
- McKinsey, E.L.; Parrish, J.K.; Irwin, A.E.; Niemeyer, B.F.; Kern, H.B.; Birks, D.K.; Jedlicka, P. A Novel Oncogenic Mechanism in Ewing Sarcoma Involving IGF Pathway Targeting by EWS/Fli1-Regulated MicroRNAs. Oncogene 2011, 30, 4910–4920. [Google Scholar] [CrossRef]
- Jung, H.J.; Suh, Y. Regulation of IGF -1 Signaling by MicroRNAs. Front. Genet. 2015, 5, 472. [Google Scholar] [CrossRef] [PubMed]
- Stylianopoulos, T.; Jain, R.K. Combining Two Strategies to Improve Perfusion and Drug Delivery in Solid Tumors. Proc. Natl. Acad. Sci. USA 2013, 110, 18632–18637. [Google Scholar] [CrossRef]
- Kosaka, N.; Iguchi, H.; Ochiya, T. Circulating MicroRNA in Body Fluid: A New Potential Biomarker for Cancer Diagnosis and Prognosis. Cancer Sci. 2010, 101, 2087–2092. [Google Scholar] [CrossRef] [PubMed]
- Mitchell, P.S.; Parkin, R.K.; Kroh, E.M.; Fritz, B.R.; Wyman, S.K.; Pogosova-Agadjanyan, E.L.; Peterson, A.; Noteboom, J.; O’Briant, K.C.; Allen, A.; et al. Circulating MicroRNAs as Stable Blood-Based Markers for Cancer Detection. Proc. Natl. Acad. Sci. USA 2008, 105, 10513–10518. [Google Scholar] [CrossRef] [PubMed]
- Huang, Z.; Huang, D.; Ni, S.; Peng, Z.; Sheng, W.; Du, X. Plasma MicroRNAs Are Promising Novel Biomarkers for Early Detection of Colorectal Cancer. Int. J. Cancer 2010, 127, 118–126. [Google Scholar] [CrossRef] [PubMed]
- Condrat, C.E.; Thompson, D.C.; Barbu, M.G.; Bugnar, O.L.; Boboc, A.; Cretoiu, D.; Suciu, N.; Cretoiu, S.M.; Voinea, S.C. MiRNAs as Biomarkers in Disease: Latest Findings Regarding Their Role in Diagnosis and Prognosis. Cells 2020, 9, 276. [Google Scholar] [CrossRef]

| Type of Cancer | miRNA | Strand/Sequence (5′–3′) | MIMAT ID | Target | Condition |
|---|---|---|---|---|---|
| Breast | MiR-126 [39] | 3p/UCGUACCGUGAGUAAUAAUGCG | MIMAT0000445 | IGFBP-2 | Metastasis |
| MiR-122 [38] | 5p/UGGAGUGUGACAAUGGUGUUUG | MIMAT0000421 | IGF-1R | Cancer biomarker | |
| miR-375 [40] | 3p/UUUGUUCGUUCGGCUCGCGUGA | MIMAT0000728 | IGF-1R | Resistance to therapy | |
| miR-145 [42] | 5p/GUCCAGUUUUCCCAGGAAUCCCU | MIMAT0000437 | IGF-1R | Cancer biomarker | |
| Colorectal | miR-195 [41] | 5p/UAGCAGCACAGAAAUAUUGGC | MIMAT0000461 | IGF-1R | Cancer biomarker |
| miR-497 [41] | 5p/CAGCAGCACACUGUGGUUUGU | MIMAT0002874 | IGF-1R | Sensitivity to apoptosis | |
| miR-143 [44] | 3p/UGAGAUGAAGCACUGUAGCUC | MIMAT0004599 | IGF-1R | Cancer staging | |
| miR-223 [35] | 3p/UGUCAGUUUGUCAAAUACCCCA | MIMAT0000280 | IGF-1R | Inflammatory bowel disease | |
| miR-139 [45] | 5p/UCUACAGUGCACGUGUCUCCAGU | MIMAT0000250 | IGF-1R | Metastasis | |
| miR-145 [46] | 5p/GUCCAGUUUUCCCAGGAAUCCCU | MIMAT0000437 | IGF-1R | Cancer biomarker | |
| Gastric | miR-7 [43] | 5p/UGGAAGACUAGUGAUUUUGUUGU | MIMAT0000252 | IGF-1R | Cancer biomarker |
| Lung | miR-486 [48] | 5p/UCCUGUACUGAGCUGCCCCGAG | MIMAT0002177 | IGF-1R | Cancer biomarker |
| miR-335 [49] | 5p/UCAAGAGCAAUAACGAAAAAUGU | MIMAT0000765 | IGF-1R | Metastasis | |
| Hepatocellular | miR-145 [50] | 5p/GUCCAGUUUUCCCAGGAAUCCCU | MIMAT0000437 | IGF-1R | Cancer biomarker |
| miR-190b [52] | 5p/UGAUAUGUUUGAUAUUUGGGGU | MIMAT0004929 | IGF-1 | Insulin resistance | |
| Pancreatic | miR-7 [54] | 5p/UGGAAGACUAGUGAUUUUGUUGU | MIMAT0000252 | IGF-1R | |
| miR-139 [54] | 5p/UCUACAGUGCACGUGUCUCCAGU | MIMAT0000250 | IGF-1R | ||
| miR-145 [46] | 5p/GUCCAGUUUUCCCAGGAAUCCCU | MIMAT0000437 | IGF-1R | ||
| miR-1 [54] | 3p/UGGAAUGUAAAGAAGUAUGUAU | MIMAT0000416 | IGF-1R | ||
| miR-497 [55] | 5p/CAGCAGCACACUGUGGUUUGU | MIMAT0002874 | IGF-1R | Cancer biomarker | |
| miR-100 [56] | 5p/AACCCGUAGAUCCGAACUUGUG | MIMAT0000098 | IGF-1R | Unknown mechanism | |
| Osteosarcoma | miR- 16 [34] | 5p/UAGCAGCACGUAAAUAUUGGCG | MIMAT0000069 | IGF-1R | Tumor progression |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Triantafyllou, G.; Kategianni, M.; Maridaki, M.; Koutsilieris, M.; Philippou, A. MicroRNA-Induced Regulation of the IGF-1 System in Various Types of Cancer. Genes 2025, 16, 1135. https://doi.org/10.3390/genes16101135
Triantafyllou G, Kategianni M, Maridaki M, Koutsilieris M, Philippou A. MicroRNA-Induced Regulation of the IGF-1 System in Various Types of Cancer. Genes. 2025; 16(10):1135. https://doi.org/10.3390/genes16101135
Chicago/Turabian StyleTriantafyllou, George, Mary Kategianni, Maria Maridaki, Michael Koutsilieris, and Anastassios Philippou. 2025. "MicroRNA-Induced Regulation of the IGF-1 System in Various Types of Cancer" Genes 16, no. 10: 1135. https://doi.org/10.3390/genes16101135
APA StyleTriantafyllou, G., Kategianni, M., Maridaki, M., Koutsilieris, M., & Philippou, A. (2025). MicroRNA-Induced Regulation of the IGF-1 System in Various Types of Cancer. Genes, 16(10), 1135. https://doi.org/10.3390/genes16101135

