Genetic Diversity and Population Structure of Hemiculter leucisculus (Basilesky, 1855) in Xinjiang Tarim River
Abstract
:1. Introduction
2. Materials and Methods
2.1. Sampling and DNA Extraction
2.2. RAD Library Construction and Sequencing
2.3. Genetic Diversity and Population Structure
2.4. SSR Loci Detection and SSR Marker Development
3. Results
3.1. RAD Sequencing and Data Quality
3.2. Genetic Diversity and Genetic Differentiation Analysis
3.3. Population Structure Analysis
3.4. Frequency of SSRs in H. leucisculus
3.5. SSR Marker Development and Characterization
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Li, Q.; Zhao, J. Primary study on age, growth and life history types of Hemiculter leucisculus. In Proceedings of the Seventh General Meeting of the Ichthyology Branch of the Chinese Society for Marine and Lake Marsh Zoology and Symposium on the 110th Birthday Anniversary of Professor Zhu Yuanding, Shanghai, China, 22–24 October 2006. [Google Scholar]
- Xie, Z.Y.; Wu, X.F.; Zhuang, L.H.; Li, D.S. Investigation of the biology of Hemiculter leucisculus (Basilewsky) in Fen River Reservoir. Period. Ocean. Univ. China 1986, 4, 54–69. [Google Scholar]
- Li, B.L.; Wang, Y.T. Biology of sliver fish in Dalai Lake. Chin. J. Fish. 1995, 2, 46–49. [Google Scholar]
- O’Connell, M.; Dillon, M.C.; Wright, J.M.; Bentzen, P.; Merkouris, S.; Seeb, J. Genetic structuring among Alaskan Pacific herring populations identified using microsatellite variation. J. Fish Biol. 1998, 53, 150–163. [Google Scholar] [CrossRef]
- Pandolfi, V.C.F.; Yamachita, A.L.Y.; Souza, F.P.D.; Godoy, S.M.D.; Lima, E.C.S.D.; Felicaiano, D.C.; Pereira, U.D.P.; Povh, J.A.; Ayres, D.R.; Bignardi, A.B.; et al. Development of microsatellite markers and evaluation of genetic diversity of the Amazonian ornamental fish Pterophyllum scalare. Aquac. Int. 2021, 29, 2435–2449. [Google Scholar] [CrossRef]
- Willing, E.; Hoffmann, M.; Klein, J.D.; Weigel, D.; Dreyer, C. Paired-end RAD-seq for de novo assembly and marker design without available reference. Bioinformatics 2011, 27, 2187–2193. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Excoffier, L.; Lischer, H.E.L. Arlequin suite ver 3.5: A new series of programs to perform population genetics analyses under Linux and Windows. Mol. Ecol. Resour. 2010, 10, 564–567. [Google Scholar] [CrossRef]
- Pembleton, L.; Cogan, N.O.I.; Forster, J.W. StAMPP: An R package for calculation of genetic differentiation and structure of mixed-ploidy level populations. Mol. Ecol. Resour. 2013, 13, 946–952. [Google Scholar] [CrossRef]
- Yang, J.; Lee, S.H.; Goddard, M.E.; Visscher, P.M. GCTA: A tool for genome-wide complex trait analysis. Am. J. Hum. Genet. 2011, 88, 76–82. [Google Scholar] [CrossRef] [Green Version]
- Ginestet, C. ggplot2: Elegant Graphics for Data Analysis. J. R. Stat. Soc. 2011, 174, 245–246. [Google Scholar] [CrossRef]
- Alexander, D.H.; Lange, K. Enhancements to the ADMIXTURE algorithm for individual ancestry estimation. BMC Bioinform. 2011, 12, 246. [Google Scholar] [CrossRef] [Green Version]
- Andreas, U.; Ioana, C.; Triinu, K.; Jian, Y.; Brant, C.F.; Maido, R.; Steven, G.R. Primer3—New capabilities and interfaces. Nucleic Acids Res. 2012, 40, e115. [Google Scholar]
- Feng, J.; Zhao, S.; Li, M.; Zhang, C.; Qu, H.; Li, Q.; Li, J.; Lin, Y.; Pu, Z. Genome-wide genetic diversity detection and population structure analysis in sweetpotato (Ipomoea batatas) using RAD-seq. Genomics 2019, 112, 1978–1987. [Google Scholar] [CrossRef]
- Liu, C.; Chen, H.; Ren, Z.; Zhang, C.; Yang, X. Population genetic analysis of the domestic Bactrian camel in China by RAD-seq. Ecol. Evol. 2019, 9, 11232–11242. [Google Scholar] [CrossRef] [PubMed]
- Sherman, K.D.; Paris, J.R.; King, R.A.; Moore, K.A.; Dahlgren, C.P.; Knowles, L.C.; Stump, L.; Tyler, C.R.; Stevens, J.R. RAD-Seq Analysis and in situ Monitoring of Nassau Grouper Reveal Fine-Scale Population Structure and Origins of Aggregating Fish. Front. Mar. Sci. 2020, 7, e157. [Google Scholar] [CrossRef] [Green Version]
- Liu, X.; Zhang, A.; Shang, J.; Zhu, Z.; Tan, F.; Wang, Y.; Jiang, J.; Li, Y.; Zha, D.; Wu, X. Analysis of Genetic Diversity and Population Structure of Eggplant (Solanum melongena L.) Based on RAD-seq. Mol. Plant Breed. 2022, 5692–5702. [Google Scholar]
- Arnold, B.; Corbett-detig, B.R.; Hartl, D.; Bomblies, K. RADseq underestimates diversity and introduces genealogical biases due to nonrandom haplotype sampling. Mol. Ecol. 2013, 22, 3179–3190. [Google Scholar] [CrossRef]
- Nousias, O.; Oikonomou, S.; Manousaki, T.; Papadogiannis, V.; Angelova, N.; Tsaparis, D.; Tsakogiannis, A.; Duncan, N.; Estevez, A.; Tzokas, K.; et al. Linkage mapping, comparative genome analysis, and QTL detection for growth in a non-model teleost, the meagre Argyrosomus regius, using ddRAD sequencing. Sci. Rep. 2022, 12, 5301. [Google Scholar] [CrossRef] [PubMed]
- Dai, Y.; Xiao, H. Review of Studies on the Germplasm Resources of the Schizothoracinae Fishes. Chin. Agric. Sci. Bull. 2011, 32, 38–46. [Google Scholar]
- Ichikawa-Seki, M.; Tokashiki, M.; Opara, M.N.; Iroh, G.; Hayashi, K.; Kumar, U.M.; Itagaki, T. Molecular characterization and phylogenetic analysis of Fasciola gigantica from Nigeria. Parasitol. Int. 2017, 66, 893–897. [Google Scholar] [CrossRef]
- Kolbe, J.J.; Glor, R.E.; Schettino, L.R.; Lara, A.C.; Larson, A.; Losos, B.J. Genetic variation increases during biological invasion by a Cuban lizard. Nature 2004, 431, 177–181. [Google Scholar] [CrossRef]
- Xu, C.; Zhang, W.; Lu, B.; Chen, J. Progress in studies on mechanisms of biological invasion. Biodivers. Sci. 2001, 4, 430–438. [Google Scholar]
- Fang, D.; Gu, Q.; Zhou, C.; Meng, X.; Li, X.; Nie, G. Genetic Diversity of Hemiculter leucisculus in Fountainhead Area of Huaihe River. Fish. Sci. 2018, 5, 665–673. [Google Scholar]
- Fan, Q.; He, S. The pattern of upper and middle Yangtze drainges shapes the genetic structure and diversity of Hemiculter leucisculus revealed by mitochondrial DNA locus. Acta Hydrobiol. Sin. 2014, 4, 627–635. [Google Scholar]
- Liu, H.; Li, C.; Xiong, F. Population genetic structure of Neosalanx taihuensis between invasive and original areas revealed by microsatellite DNA. J. Fish. China 2016, 10, 1521–1530. [Google Scholar]
- Shi, W.; Geng, Y.; Ou, X. Genetic diversity and invasion success of alien species: Where are we and where should we go? Biodivers. Sci. 2010, 6, 590–597. [Google Scholar]
- Fang, F.; Chen, X.; Lv, J.; Shi, X.; Feng, X.; Wang, Z.; Li, X. Population Structure and Genetic Diversity of Chinese Honeybee (Apis Cerana Cerana) in Central China. Genes 2022, 13, 1007. [Google Scholar] [CrossRef]
- Fraik, A.K.; McMillan, J.R.; Liermann, M.; Bennett, T.; McHenry, M.L.; McKinney, G.J.; Wells, A.H.; Winans, G.; Kelley, J.L.; Pess, G.R.; et al. The Impacts of Dam Construction and Removal on the Genetics of Recovering Steelhead (Oncorhynchus mykiss) Populations across the Elwha River Watershed. Genes 2021, 12, 89. [Google Scholar] [CrossRef]
- Valenzuela-Aguayo, F.; McCracken, G.R.; Manosalva, A.; Habit, E.; Ruzzante, D.E. Human-induced habitat fragmentation effects on connectivity, diversity, and population persistence of an endemic fish, Percilia irwini, in the Biobío River basin (Chile). Evol. Appl. 2019, 13, 794–807. [Google Scholar] [CrossRef] [Green Version]
- Wu, X.; Luo, J.; Huang, S.; Chen, Z.; Xiao, H.; Zhang, Y. Molecular Phylogeography and Evolutionary History of Poropuntius huangchuchieni (Cyprinidae) in Southwest China. PLoS ONE 2013, 8, e79975. [Google Scholar] [CrossRef] [Green Version]
- Tea, T.; Špoljar, M.; Kattakulov, F.; Tena, R.; Daniel, M. Interactions between Fish and Invertebrates in the Lowland Area of the Sava River following Excessive Change in Hydrological Regime. Hydrobiology 2022, 1, 196–210. [Google Scholar]
- Yang, L.; Hu, J.; Qin, C.; Zhang, Y.; Lu, R.; Meng, X.; Yang, G.; Yan, X.; Zhi, S.; Nie, G. Genetic structure analysis of Pseudorasbora parva in the four major river systems in Yunnan based on mitochondrial Cyt b. J. Fish. China 2020, 3, 339–350. [Google Scholar]
- Soliman, T.; Aly, W.; Fahim, R.M.; Berumen, M.L.; Jenke-Kodama, H.; Bernardi, G. Comparative population genetic structure of redbelly tilapia (Coptodon zillii (Gervais, 1848)) from three different aquatic habitats in Egypt. Ecol. Evol. 2017, 7, 11092–11099. [Google Scholar] [CrossRef] [PubMed]
- Xu, H.; Ye, M.; Song, Y.; Bai, Y. Characteristic Analysis on Hydrological Processes of Tarim River Basin. J. Soil Water Conserv. 2005, 19, 156–159. [Google Scholar]
- Zhou, X.; Yi, S.; Zhao, W.; Zhou, Q.; Shen, J.; Li, D.; Huo, B.; Tang, R. Genetic Diversity and Population Differentiation of Kashgarian Loach (Triplophysa yarkandensis) in Xinjiang Tarim River Basin. Biology 2021, 10, 734. [Google Scholar] [CrossRef]
- Chen, G. Taitema Lake surface area and main recharge water sources. Water Conserv. Sci. Technol. Econ. 2016, 22, 41–44. [Google Scholar]
- Shi, L.; Tuerxun, H.; Han, G. Effect of Ecological Water Delivery in Lower Reaches of Tarim River on Environmental Dynamic State and Its Control Measures. Xinjiang Agric. Sci. 2008, 45, 926–933. [Google Scholar]
- Moy, K.M.; Brasil, L.S.; Oliveira-Junior, J.M.B.; June, L.; Vieira, T.B.; Dias-Silva, K. Effects of Environmental Changes on Gerromorpha (Heteroptera: Hemiptera) Communities from Amazonian Streams. Hydrobiology 2022, 1, 111–121. [Google Scholar] [CrossRef]
- Fargeot, L.; Loot, G.; Prunier, J.G.; Rey, O.; Charlotte, V.; Blanchet, S. Patterns of Epigenetic Diversity in Two Sympatric Fish Species: Genetic vs. Environmental Determinants. Genes 2021, 12, 107. [Google Scholar] [CrossRef]
- David, D.; Garmona-Catot, G.; Araguas, R.; Vidal, O.; Sanz, N.; Emili, G.; Jose-Luis, G. Gene Flow and Maintenance of Genetic Diversity in Invasive Mosquitofish (Gambusia holbrooki). PLoS ONE 2013, 8, e82501. [Google Scholar]
- Dong, X.; Ju, T.; Grenouillet, G.; Laffaille, P.; Lek, S.; Liu, J. Spatial pattern and determinants of global invasion risk of an invasive species, sharpbelly Hemiculter leucisculus (Basilesky, 1855). Sci. Total Environ. 2019, 711, e134661. [Google Scholar] [CrossRef]
- Chen, P.; Ma, Y.; Xie, C.; Qi, F. Preliminary study on community structure of fishes in Bositeng Lake. Freshw. Fish. 2014, 44, 36–42. [Google Scholar]
- Chen, G.; Qiu, Y.; Li, L. Fish invasions and changes in the fish fauna of the Tarim Basin. Acta Ecol. Sin. 2017, 37, 700–714. [Google Scholar]
- Yang, B.; Xu, Q.; Niu, M.; Lou, X.; Huang, H.; Tong, Z.; Lin, E. Analysis of SSR Information in Transcriptome and Development of SSR Molecular Markers in Rhododendron fortunei. J. Nucl. Agric. Sci. 2018, 32, 2335–2345. [Google Scholar]
- Qu, Z.; Song, H.; Wang, X.; Liu, Y.; Mou, X.; Liu, C.; Hu, Y. Preliminary screening and characterization of microsatellite markers in RAD-seq data of Datnioides pulcher. Freshw. Fish. 2019, 49, 9–15. [Google Scholar]
- Wang, Q.; Guo, W.; Cheng, W.; Deng, G.; Xu, H.; Xia, R. Isolation of microsatellite markers for Pelteobagrus vachellii based on RAD sequencing. Fish. Sci. Technol. Inf. 2021, 48, 250–254. [Google Scholar]
Sample | Before Filter | After Filter | ||||||||
---|---|---|---|---|---|---|---|---|---|---|
Raw Read Data | Clean Date (bp) | Q20 (%) | Q30 (%) | GC (%) | High-Throughput Reading | HQ Clean Data (bp) | Q20 (%) | Q30 (%) | GC (%) | |
THY | 7,680,728 | 2,242,772,518 | 96.49 | 91.01 | 39.66 | 7,352,661 | 2,146,939,680 | 96.81 | 91.41 | 38.86 |
YBZ | 7,215,133 | 2,106,818,865 | 97.03 | 91.88 | 38.83 | 7,084,553 | 2,068,663,228 | 97.17 | 92.05 | 38.74 |
QL | 8,504,442 | 2,483,297,035 | 96.27 | 90.56 | 39.95 | 8,247,451 | 2,408,227,372 | 96.53 | 90.86 | 39.36 |
TTMH | 8,201,568 | 2,394,857,739 | 96.96 | 91.78 | 39.41 | 8,031,269 | 2,345,097,675 | 97.11 | 91.96 | 39.29 |
Population Name | Number of Individuals | Ho | He | Pi | FIS |
---|---|---|---|---|---|
THY | 10 | 0.0677 | 0.2010 | 0.001012 | 0.60082 |
YBZ | 10 | 0.0593 | 0.1925 | 0.000964 | 0.63508 |
QL | 10 | 0.0645 | 0.1983 | 0.001097 | 0.60286 |
TTMH | 10 | 0.0774 | 0.2055 | 0.001144 | 0.54973 |
Population Name | THY | YBZ | QL | TTMH |
---|---|---|---|---|
THY | 0 | 0.258 | 0.249 | 0.235 |
YBZ | 0.258 | 0 | 0.251 | 0.237 |
QL | 0.249 | 0.251 | 0 | 0.231 |
TTMH | 0.235 | 0.237 | 0.231 | 0 |
Source of Variation | d.f. | Variance Components | Percentage of Variation |
---|---|---|---|
Among populations | 3 | 0.000402 | 7.69 |
Within populations | 36 | 0.028631 | 92.31 |
Total | 39 | 100 |
Item | Number |
---|---|
Total number of sequences examined | 13,537,492 |
Total size of examined sequences | 604,493,653 |
Total number of identified SSRs | 147,705 |
Number of SSR containing sequences | 126,849 |
Number of sequences containing more than 1 SSR | 17,352 |
Number of SSRs present in compound formation | 11,698 |
ID | Forward Primer (5′-3′) | Reverse Primer (5′-3′) | Tm (°C) | Repeat Motif | Product Size |
---|---|---|---|---|---|
P1 | CCTCACTGAACCCTTAACGC | GCTTGGAAGAACATTGGAGC | 60 | (TG)6 | 223 |
P2 | TCTGGTTGATTGGGAAAAGTG | CACTAACAGGTGCCGTGATG | 60 | (AC)46 | 228 |
P3 | GGTCACCCCAGACATTGTTC | GCAGGAGAAAGCACACTTCC | 60 | (AAG)11 | 196 |
P4 | ACATTGTGGGGACATTTGGT | GGTAGGGGTAGTGTAGGGGG | 60 | (CAT)11 | 144 |
P5 | TGCTGACATGTTTGCATTTG | ATTTTGCTTTGTGAAACCGC | 59 | (CACGTT)18 | 265 |
P6 | TTCATGATTTTCCCTGTCTGC | AGCTGCAGGATCTGATGGAT | 60 | (ATAAC)22 | 231 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Sun, S.; Hu, Z.; Lu, Z.; Liu, L.; Liu, X.; Zhou, Q.; Huo, B.; Li, D.; Tang, R. Genetic Diversity and Population Structure of Hemiculter leucisculus (Basilesky, 1855) in Xinjiang Tarim River. Genes 2022, 13, 1790. https://doi.org/10.3390/genes13101790
Sun S, Hu Z, Lu Z, Liu L, Liu X, Zhou Q, Huo B, Li D, Tang R. Genetic Diversity and Population Structure of Hemiculter leucisculus (Basilesky, 1855) in Xinjiang Tarim River. Genes. 2022; 13(10):1790. https://doi.org/10.3390/genes13101790
Chicago/Turabian StyleSun, Siyuan, Zhenyi Hu, Zhengyi Lu, Lu Liu, Xuan Liu, Qiong Zhou, Bin Huo, Dapeng Li, and Rong Tang. 2022. "Genetic Diversity and Population Structure of Hemiculter leucisculus (Basilesky, 1855) in Xinjiang Tarim River" Genes 13, no. 10: 1790. https://doi.org/10.3390/genes13101790
APA StyleSun, S., Hu, Z., Lu, Z., Liu, L., Liu, X., Zhou, Q., Huo, B., Li, D., & Tang, R. (2022). Genetic Diversity and Population Structure of Hemiculter leucisculus (Basilesky, 1855) in Xinjiang Tarim River. Genes, 13(10), 1790. https://doi.org/10.3390/genes13101790