TLR-Mediated Cytokine Gene Expression in Chicken Peripheral Blood Mononuclear Cells as a Measure to Characterize Immunobiotics
Abstract
1. Introduction
2. Materials and Methods
2.1. PBMC Culture and Stimulation
2.2. RNA Isolation and RT-qPCR
2.3. Quantitative Reverse Transcription PCR (RT-qPCR)
2.4. Relative Quantification of Gene Expression and Statistical Analysis
3. Results
3.1. Variance Analysis (One-Way ANOVA)
3.2. Hierarchical Clustering
3.3. Cytokine Gene Expression Analysis
3.3.1. Pro-Inflammatory Cytokines (IL-1β, IL-6, and IL-8)
3.3.2. Th1/Th2 Cytokines (IL-2, IL-3, and IL-4)
3.3.3. Th1-Regulators (IL-10, IL12p40, and IFN-ɣ)
4. Discussion
4.1. Hierarchical Clustering
4.2. Gene Expression Patterns
4.2.1. Pro-Inflammatory Cytokines (IL-1β, IL-6, and IL-8)
4.2.2. Th1/Th2 Cytokines (IL-2, IL-3, and IL-4)
4.2.3. Th1-Regulators (IL-10, IL12p40, and IFN-ɣ)
4.3. Cytokine Gene Stimulated by Immunobiotics
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Data Availability Statement
Conflicts of Interest
References
- Fitch, F.W. Cell-mediated immunity. In Encyclopedia of Immunology, 2nd ed.; Academic Press: London, UK, 1998; pp. 501–504. [Google Scholar]
- Dinarello, C.A. Historical insights into cytokines. Eur. J. Immunol. 2007, 37, S34–S45. [Google Scholar] [CrossRef] [Scilit]
- Giansanti, F.; Giardi, M.; Botti, D. Avian cytokines-an overview. Curr. Pharm. Des. 2006, 12, 3083–3099. [Google Scholar] [CrossRef] [Scilit]
- Kaiser, P.; Stäheli, P. Avian cytokines and chemokines. In Avian Immunology; Academic Press: San Diego, CA, USA, 2014; pp. 189–204. [Google Scholar]
- Wigley, P.; Kaiser, P. Avian cytokines in health and disease. Braz. J. Poult. Sci. 2003, 5, 1–14. [Google Scholar]
- Kumar, H.; Kawai, T.; Akira, S. Pathogen recognition by the innate immune system. Int. Rev. Immunol. 2011, 30, 16–34. [Google Scholar] [CrossRef] [Scilit]
- Keestra, A.M.; de Zoete, M.R.; Bouwman, L.I.; Vaezirad, M.M.; van Putten, J.P. Unique features of chicken Toll-like receptors. Dev. Comp. Immunol. 2013, 41, 316–323. [Google Scholar]
- Broom, L.J.; Kogut, M.H. The role of the gut microbiome in shaping the immune system of chickens. Vet. Immunol. Immunop. 2018, 204, 44–51. [Google Scholar]
- Paul, M.S.; Brisbin, J.T.; Abdul-Careem, M.F.; Sharif, S. Immunostimulatory properties of Toll-like receptor ligands in chickens. Vet. Immunol. Immunop. 2013, 152, 191–199. [Google Scholar] [CrossRef] [Scilit]
- Clancy, R. Immunobiotics and the probiotic evolution. FEMS Immunol. Med. Microbiol. 2003, 38, 9–12. [Google Scholar] [CrossRef] [Scilit]
- Lebeer, S.; Vanderleyden, J.; De Keersmaecker, S.C. Host interactions of probiotic bacterial surface molecules: Comparison with commensals and pathogens. Nat. Rev. Microbiol. 2010, 8, 171–184. [Google Scholar] [CrossRef] [Scilit]
- Pietrzak, E.; Dunislawska, A.; Siwek, M.; Zampiga, M.; Sirri, F.; Meluzzi, A.; Tavaniello, S.; Maiorano, G.; Slawinska, A. Splenic Gene Expression Signatures in Slow-Growing Chickens Stimulated in Ovo with Galactooligosaccharides and Challenged with Heat. Animals 2020, 10, 474. [Google Scholar] [CrossRef] [Scilit]
- Slawinska, A.; Mendes, S.; Dunislawska, A.; Siwek, M.; Zampiga, M.; Sirri, F.; Meluzzi, A.; Tavaniello, S.; Maiorano, G. Avian model to mitigate gut-derived immune response and oxidative stress during heat. Biosystems 2019, 178, 10–15. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Chiang, H.-I.; Berghman, L.R.; Zhou, H. Inhibition of NF-kB 1 (NF-kBp50) by RNA interference in chicken macrophage HD11 cell line challenged with Salmonella enteritidis. Genet. Mol. Biol. 2009, 32, 507–515. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Slawinska, A.; Siwek, M.Z.; Bednarczyk, M.F. Effects of synbiotics injected in ovo on regulation of immune-related gene expression in adult chickens. Am. J. Vet. Res. 2014, 75, 997–1003. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Rothwell, L.; Young, J.R.; Zoorob, R.; Whittaker, C.A.; Hesketh, P.; Archer, A.; Smith, A.L.; Kaiser, P. Cloning and characterization of chicken IL-10 and its role in the immune response to Eimeria maxima. J. Immunol. 2004, 173, 2675–2682. [Google Scholar] [CrossRef] [Scilit]
- Brisbin, J.T.; Gong, J.; Parvizi, P.; Sharif, S. Effects of lactobacilli on cytokine expression by chicken spleen and cecal tonsil cells. Clin. Vaccine. Immunol. 2010, 17, 1337–1343. [Google Scholar] [CrossRef] [Scilit]
- De Boever, S.; Vangestel, C.; De Backer, P.; Croubels, S.; Sys, S.U. Identification and validation of housekeeping genes as internal control for gene expression in an intravenous LPS inflammation model in chickens. Vet. Immunol. Immunopathol. 2008, 122, 312–317. [Google Scholar] [CrossRef] [Scilit]
- Sevane, N.; Bialade, F.; Velasco, S.; Rebole, A.; Rodriguez, M.L.; Ortiz, L.T.; Canon, J.; Dunner, S. Dietary inulin supplementation modifies significantly the liver transcriptomic profile of broiler chickens. PLoS ONE 2014, 9, e98942. [Google Scholar] [CrossRef] [Scilit]
- Howe, E.; Holton, K.; Nair, S.; Schlauch, D.; Sinha, R.; Quackenbush, J. Mev: Multiexperiment viewer. In Biomedical Informatics for Cancer Research; Springer: Boston, MA, USA, 2010; pp. 267–277. [Google Scholar]
- Shen, J.; Liu, Y.; Ren, X.; Gao, K.; Li, Y.; Li, S.; Yao, J.; Yang, X. Changes in DNA methylation and chromatin structure of pro-inflammatory cytokines stimulated by LPS in broiler peripheral blood mononuclear cells. Poult. Sci. 2016, 95, 1636–1645. [Google Scholar] [CrossRef] [Scilit]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [Scilit]
- Medzhitov, R. Origin and physiological roles of inflammation. Nature 2008, 454, 428–435. [Google Scholar]
- Medzhitov, R.; Horng, T. Transcriptional control of the inflammatory response. Nat. Rev. Immunol. 2009, 9, 692–703. [Google Scholar] [CrossRef] [Scilit]
- Kaiko, G.E.; Horvat, J.C.; Beagley, K.W.; Hansbro, P.M. Immunological decision-making: How does the immune system decide to mount a helper T-cell response? Immunology 2008, 123, 326–338. [Google Scholar] [CrossRef] [Scilit]
- Whelan, A.O.; Villarreal-Ramos, B.; Vordermeier, H.M.; Hogarth, P.J. Development of an antibody to bovine IL-2 reveals multifunctional CD4 T EM cells in cattle naturally infected with bovine tuberculosis. PLoS ONE 2011, 6, e29194. [Google Scholar] [CrossRef] [Scilit]
- Kaiser, M.; Cheeseman, J.; Kaiser, P.; Lamont, S. Cytokine expression in chicken peripheral blood mononuclear cells after in vitro exposure to Salmonella enterica serovar Enteritidis. Poult. Sci. 2006, 85, 1907–1911. [Google Scholar] [CrossRef] [Scilit]
- Kirthika, P.; Ali, M.A.; Behera, P.; Subudhi, P.K.; Tolenkhomba, T.C.; Gali, J.M. Dynamics of cytokine gene expression in peripheral blood mononuclear cells of indigenous and exotic breeds of pigs in India. Anim. Sci. J. 2017, 88, 1794–1800. [Google Scholar] [CrossRef] [Scilit]
- Qadis, A.Q.; Goya, S.; Yatsu, M.; Yoshida, Y.-U.; Ichijo, T.; Sato, S. Effects of a bacteria-based probiotic on subpopulations of peripheral leukocytes and their interleukin mRNA expression in calves. J. Vet. Med. Sci. 2014, 76, 189–195. [Google Scholar] [CrossRef] [Scilit]
- Siwek, M.; Wragg, D.; Slawinska, A.; Malek, M.; Hanotte, O.; Mwacharo, J.M. Insights into the genetic history of Green-legged Partridgelike fowl: mtDNA and genome-wide SNP analysis. Anim. Genet. 2013, 44, 522–532. [Google Scholar] [CrossRef] [Scilit]
- Slawinska, A.; Dunislawska, A.; Kowalczyk, A.; Lukaszewicz, E.; Siwek, M. Mucosal and systemic immune responses modulated by in ovo-delivered bioactive compounds in distinct chicken genotypes. Dev. Comp. Immunol. 2021, submitted. [Google Scholar]
- O’garra, A.; Murphy, K.M. From IL-10 to IL-12: How pathogens and their products stimulate APCs to induce Th 1 development. Nat. Immunol. 2009, 10, 929–932. [Google Scholar] [CrossRef] [Scilit]
- Cope, A.; Le Friec, G.; Cardone, J.; Kemper, C. The Th1 life cycle: Molecular control of IFN-γ to IL-10 switching. Trends Immunol. 2011, 32, 278–286. [Google Scholar] [CrossRef] [Scilit]
- Sampath, V. Bacterial endotoxin-lipopolysaccharide; structure, function and its role in immunity in vertebrates and invertebrates. Agric. Nat. Resour. 2018, 52, 115–120. [Google Scholar] [CrossRef] [Scilit]
- Lu, Y.-C.; Yeh, W.-C.; Ohashi, P.S. LPS/TLR4 signal transduction pathway. Cytokine 2008, 42, 145–151. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Redl, H.; Bahrami, S.; Schlag, G.; Traber, D.L. Clinical detection of LPS and animal models of endotoxemia. Immunobiology 1993, 187, 330–345. [Google Scholar] [CrossRef] [Scilit]
- Schimpl, A.; Berberich, I.; Kneitz, B.; Krämer, S.; Santner-Nanan, B.; Wagner, S.; Wolf, M.; Hünig, T. IL-2 and autoimmune disease. Cytokine Growth Factor Rev. 2002, 13, 369–378. [Google Scholar] [CrossRef] [Scilit]
- Stocking, C.; Ostertag, W. Interleukin 3: A Multilineage Hematopoietic Growth Factor. In Growth Factors, Differentiation Factors, and Cytokines; Springer: Berlin/Heidelberg, Germany, 1990; pp. 115–128. [Google Scholar]
- Di Carlo, F.J.; Fiore, J.V. On the composition of zymosan. Science 1958, 127, 756–757. [Google Scholar] [CrossRef] [Scilit]
- Brownlie, R.; Zhu, J.; Allan, B.; Mutwiri, G.K.; Babiuk, L.A.; Potter, A.; Griebel, P. Chicken TLR21 acts as a functional homologue to mammalian TLR9 in the recognition of CpG oligodeoxynucleotides. Mol. Immunol. 2009, 46, 3163–3170. [Google Scholar] [CrossRef] [Scilit]
- Shirota, H.; Klinman, D. CpG Oligodeoxynucleotides as adjuvants for clinical use. In Immunopotentiators in Modern Vaccines; Academic Press: London, UK, 2017; pp. 163–198. [Google Scholar]
- He, H.; Lowry, V.K.; Swaggerty, C.L.; Ferro, P.J.; Kogut, M.H. In vitro activation of chicken leukocytes and in vivo protection against Salmonella enteritidis organ invasion and peritoneal S. enteritidis infection-induced mortality in neonatal chickens by immunostimulatory CpG oligodeoxynucleotide. FEMS Immunol. Med. Microbiol. 2005, 43, 81–89. [Google Scholar] [CrossRef] [Scilit]
- Krieg, A.M.; Love-Homan, L.; Yi, A.-K.; Harty, J.T. CpG DNA induces sustained IL-12 expression in vivo and resistance to Listeria monocytogenes challenge. J. Immunol. 1998, 161, 2428–2434. [Google Scholar]
- Fiorentino, D.F.; Zlotnik, A.; Vieira, P.; Mosmann, T.; Howard, M.; Moore, K.; O’garra, A. IL-10 acts on the antigen-presenting cell to inhibit cytokine production by Th1 cells. J. Immunol. 1991, 146, 3444–3451. [Google Scholar]
- Gantner, B.N.; Simmons, R.M.; Canavera, S.J.; Akira, S.; Underhill, D.M. Collaborative induction of inflammatory responses by dectin-1 and Toll-like receptor 2. J. Exp. Med. 2003, 197, 1107–1117. [Google Scholar] [CrossRef] [Scilit]
- Dillon, S.; Agrawal, S.; Banerjee, K.; Letterio, J.; Denning, T.L.; Oswald-Richter, K.; Kasprowicz, D.J.; Kellar, K.; Pare, J.; van Dyke, T. Yeast zymosan, a stimulus for TLR2 and dectin-1, induces regulatory antigen-presenting cells and immunological tolerance. J. Clin. Investig. 2006, 116, 916–928. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Vendrig, J.C.; Coffeng, L.E.; Fink-Gremmels, J. In vitro evaluation of defined oligosaccharide fractions in an equine model of inflammation. BMC Vet. Res. 2013, 9, 147. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Del Fabbro, S.; Calder, P.; Childs, C. Microbiota-independent immunological effects of Bimuno® galactooligosaccharide in the context of inflammatory bowel diseases. Proc. Nutr. Soc. 2020, 79, E749. [Google Scholar] [CrossRef] [Scilit]
- Searle, L.E.; Jones, G.; Tzortzis, G.; Woodward, M.J.; Rastall, R.A.; Gibson, G.R.; La Ragione, R.M. Low molecular weight fractions of BiMuno® exert immunostimulatory properties in murine macrophages. J. Funct. Foods 2012, 4, 941–953. [Google Scholar] [CrossRef] [Scilit]
- Foligne, B.; Nutten, S.; Grangette, C.; Dennin, V.; Goudercourt, D.; Poiret, S.; Dewulf, J.; Brassart, D.; Mercenier, A.; Pot, B. Correlation between in vitro and in vivo immunomodulatory properties of lactic acid bacteria. World J. Gastroenterol. 2007, 13, 236. [Google Scholar] [CrossRef] [Scilit]
- Bradley, G.L.; Savage, T.F.; Timm, K.I. The effects of supplementing diets with Saccharomyces cerevisiae var. boulardii on male poult performance and ileal morphology. Poult. Sci. 1994, 73, 1766–1770. [Google Scholar]
- Alizadeh, M.; Rodriguez-Lecompte, J.; Yitbarek, A.; Sharif, S.; Crow, G.; Slominski, B. Effect of yeast-derived products on systemic innate immune response of broiler chickens following a lipopolysaccharide challenge. Poult. Sci. 2016, 95, 2266–2273. [Google Scholar] [CrossRef] [Scilit]
- Santovito, E.; Greco, D.; Marquis, V.; Raspoet, R.; D’Ascanio, V.; Logrieco, A.F.; Avantaggiato, G. Antimicrobial Activity of Yeast Cell Wall Products against Clostridium perfringens. Foodborne Pathog. Dis. 2019, 16, 638–647. [Google Scholar] [CrossRef] [Scilit]
- Chou, W.K.; Park, J.; Carey, J.B.; McIntyre, D.R.; Berghman, L.R. Immunomodulatory effects of Saccharomyces cerevisiae fermentation product supplementation on immune gene expression and lymphocyte distribution in immune organs in broilers. Front. Vet. Sci. 2017, 4, 37. [Google Scholar] [CrossRef] [Scilit]
- Laiño, J.; Villena, J.; Kanmani, P.; Kitazawa, H. Immunoregulatory effects triggered by lactic acid bacteria exopolysaccharides: New insights into molecular interactions with host cells. Microorganisms 2016, 4, 27. [Google Scholar] [CrossRef] [Scilit]
- Cerning, J. Exocellular polysaccharides produced by lactic acid bacteria. FEMS Microbiol. Rev. 1990, 7, 113–130. [Google Scholar] [CrossRef] [PubMed]
- Knoshaug, E.; Ahlgren, J.; Trempy, J. Growth associated exopolysaccharide expression in Lactococcus lactis subspecies cremoris Ropy352. J. Dairy Sci. 2000, 83, 633–640. [Google Scholar] [CrossRef] [Scilit]
- Van Kranenburg, R.; Vos, H.R.; Van Swam, I.I.; Kleerebezem, M.; De Vos, W.M. Functional analysis of glycosyltransferase genes from Lactococcus lactis and other gram-positive cocci: Complementation, expression, and diversity. J. Bacteriol. 1999, 181, 6347–6353. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kitazawa, H.; Itoh, T.; Tomioka, Y.; Mizugaki, M.; Yamaguchi, T. Induction of IFN-γ and IL-1α production in macrophages stimulated with phosphopolysaccharide produced by Lactococcus lactis ssp. cremoris. Int. J. Food Microbiol. 1996, 31, 99–106. [Google Scholar]
- Kitazawa, H.; Itoh, T.; Yamaguchi, T. Induction of macrophage cytotoxicity by slime products produced by encapsulated Lactococcus lactis ssp. cremoris. Anim. Sci. Technol. 1991, 62, 861–866. [Google Scholar] [CrossRef] [Scilit]
- Kitazawa, H.; Yamaguchi, T.; Fujimoto, Y.; Itoh, T. Comparative activity of B-cell mitogen, a phosphopolysaccharide, produced by L. lactis ssp. cremoris on various lymphocytes. Anim. Sci. Technol. 1993, 64, 605. [Google Scholar]


| TLR Ligand | Description | chTLR | Dose | Source |
|---|---|---|---|---|
| LPS | Lipopolysaccharide from E. Coli 026:B6 | TLR4 | 2.5 µg/mL | Sigma-Aldrich (L2654) |
| CpG ODN | Short, synthetic, single-stranded DNA molecules, containing unmethylated CpG motifs; these CpG motifs are present at 20-fold greater frequency in bacterial DNA compared to mammalian DNA | TLR21 | 10 µg/mL | Invivogen (tlrl-m362) |
| Pam3CSK4 | Synthetic diacylated lipopeptide (LP); Bacterial lipopoliproteins are strong activators of innate immune responses, present in cell walls of Gram (+) bacteria | TLR2 | 10 ng/mL | Invivogen (tlrl-pm2s-1) |
| Zymosan | Cell wall preparation of S. cerevisiae | TLR2 and TLR6 | 10 µg/mL | Invivogen (tlrl-zyn) |
| GOS | Galactooligosaccharides, oligosaccharides composed of galactose units, produced from milk lactose | Uncharacterized | 100 µg/mL | In-house |
| L. lactis subsp. cremoris | Lactic Acid Bacteria (LAB), Gram-positive, belong to Eubacteriales order, Streptococcaceae family, used as probiotic and in diary products | Putative TLR2 | 1.25 × 108/mL | In-house |
| S. cerevisiae | Eucaryotic, single-cell fungus (yeast), antagonistic to pathogenic bacteria, known probiotic in many medical applications | Putative TLR2 and TLR6 | 1.25 × 108/mL | In-house |
| Gene | NCBI ID | Primer (5’->3’) | References |
|---|---|---|---|
| IL-1β | 395196 | F: GGAGGTTTTTGAGCCCGTC R: TCGAAGATGTCGAAGGACTG | [12] |
| IL-2 | 373958 | F: GCTTATGGAGCATCTCTATCATCA R: GGTGCACTCCTGGGTCTC | [13] |
| IL-3 | 474356 | F: GCAGCAATGAAGCCATACCT R: GTGACTGCATTCTCTTCCCCT | This study 1 |
| IL-4 | 416330 | F: GCTCTCAGTGCCGCTGATG R: GGAAACCTCTCCCTGGATGTC | [13] |
| IL-6 | 395337 | F: AGGACGAGATGTGCAAGAAGTTC R: TTGGGCAGGTTGAGGTTGTT | [14] |
| IL-8 | 396495 | F: AAGGATGGAAGAGAGGTGTGCTT R: GCTGAGCCTTGGCCATAAGT | [15] |
| IL-10 | 428264 | F: CATGCTGCTGGGCCTGAA R: CGTCTCCTTGATCTGCTTGATG | [16] |
| IL-12p40 | 404671 | F: TTGCCGAAGAGCACCAGCCG R: CGGTGTGCTCCAGGTCTTGGG | [17] |
| IFN-ɣ | 396054 | F: ACACTGACAAGTCAAAGCCGC R: AGTCGTTCATCGGGAGCTTG | [17] |
| ACTB | 396526 | F: CACAGATCATGTTTGAGACCTT R: CATCACAATACCAGTGGTACG | [18] |
| G6PDH | AI981686 | F: CGGGAACCAAATGCACTTCGT R: GGCTGCCGTAGAGGTATGGGA | [19] |
| Gene | 3 h | 6 h | 9 h |
|---|---|---|---|
| IL-1β | <0.001 | <0.001 | <0.001 |
| IL-2 | ns | <0.05 | ns |
| IL-3 | ns | ns | ns |
| IL-4 | ns | ns | ns |
| IL-6 | <0.001 | <0.001 | <0.001 |
| IL-8 | <0.001 | <0.05 | <0.05 |
| IL-10 | <0.001 | <0.001 | <0.001 |
| IL-12p40 | <0.001 | <0.001 | <0.001 |
| IFN-ɣ | ns | ns | ns |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Slawinska, A.; Dunislawska, A.; Plowiec, A.; Gonçalves, J.; Siwek, M. TLR-Mediated Cytokine Gene Expression in Chicken Peripheral Blood Mononuclear Cells as a Measure to Characterize Immunobiotics. Genes 2021, 12, 195. https://doi.org/10.3390/genes12020195
Slawinska A, Dunislawska A, Plowiec A, Gonçalves J, Siwek M. TLR-Mediated Cytokine Gene Expression in Chicken Peripheral Blood Mononuclear Cells as a Measure to Characterize Immunobiotics. Genes. 2021; 12(2):195. https://doi.org/10.3390/genes12020195
Chicago/Turabian StyleSlawinska, Anna, Aleksandra Dunislawska, Arkadiusz Plowiec, José Gonçalves, and Maria Siwek. 2021. "TLR-Mediated Cytokine Gene Expression in Chicken Peripheral Blood Mononuclear Cells as a Measure to Characterize Immunobiotics" Genes 12, no. 2: 195. https://doi.org/10.3390/genes12020195
APA StyleSlawinska, A., Dunislawska, A., Plowiec, A., Gonçalves, J., & Siwek, M. (2021). TLR-Mediated Cytokine Gene Expression in Chicken Peripheral Blood Mononuclear Cells as a Measure to Characterize Immunobiotics. Genes, 12(2), 195. https://doi.org/10.3390/genes12020195

