Administration of Steamed and Freeze-Dried Mature Silkworm Larval Powder Prevents Hepatic Fibrosis and Hepatocellular Carcinogenesis by Blocking TGF-β/STAT3 Signaling Cascades in Rats
Abstract
1. Introduction
2. Materials and Methods
2.1. Reagents and Antibodies
2.2. Animal Experiment
2.3. Preparation of Steamed and Freeze-Dried Mature Silkworm Larval Powder
2.4. Biochemical Analysis
2.5. Histology and Immunohistochemistry
2.6. RNA Isolation and Gene Expression Analysis
2.7. Western Blot Analysis
2.8. Statistical Analysis
3. Results
3.1. Steamed and Freeze-Dried Mature Silkworm Larval Powder (SMSP) Alleviates Liver Injury and Foci Formation in Diethylnitrosamine (DEN)-Treated Rats
3.2. SMSP Prevents Hepatocellular Carcinogenesis in DEN-Treated Rats
3.3. SMSP Attenuates Hepatic Fibrosis in DEN-Treated Rats
3.4. SMSP Inhibits Transforming Growth Factor-β (TGF-β) Signaling Pathway
3.5. SMSP Inhibits Signal Transducer and Activator of Transcription 3 (STAT3)-Mediated Signaling Pathways in the Liver
4. Discussion
Supplementary Materials
Author Contributions
Funding
Conflicts of Interest
References
- Marcellin, P.; Kutala, B.K. Liver diseases: A major, neglected global public health problem requiring urgent actions and large-scale screening. Liver Int. 2018, 38 (Suppl. 1), 2–6. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hernandez-Gea, V.; Friedman, S.L. Pathogenesis of liver fibrosis. Annu. Rev. Pathol. 2011, 6, 425–456. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Friedman, S.L. Evolving challenges in hepatic fibrosis. Nat. Rev. Gastroenterol. Hepatol. 2010, 7, 425–436. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Uemura, M.; Swenson, E.S.; Gaca, M.D.; Giordano, F.J.; Reiss, M.; Wells, R.G. Smad2 and Smad3 play different roles in rat hepatic stellate cell function and alpha-smooth muscle actin organization. Mol. Biol. Cell 2005, 16, 4214–4224. [Google Scholar] [CrossRef] [Scilit]
- Friedman, S.L.; Rockey, D.C.; McGuire, R.F.; Maher, J.J.; Boyles, J.K.; Yamasaki, G. Isolated hepatic lipocytes and Kupffer cells from normal human liver: Morphological and functional characteristics in primary culture. Hepatology 1992, 15, 234–243. [Google Scholar] [CrossRef] [Scilit]
- Friedman, S.L. Molecular regulation of hepatic fibrosis, an integrated cellular response to tissue injury. J. Biol. Chem. 2000, 275, 2247–2250. [Google Scholar] [CrossRef] [Scilit]
- Sanyal, A.J.; Yoon, S.K.; Lencioni, R. The etiology of hepatocellular carcinoma and consequences for treatment. Oncogene 2010, 15 (Suppl. 4), 14–22. [Google Scholar] [CrossRef] [Scilit]
- Verrecchia, F.; Mauviel, A. Transforming growth factor-beta and fibrosis. World J. Gastroenterol. 2007, 13, 3056–3062. [Google Scholar] [CrossRef] [Scilit]
- Leask, A.; Abraham, D.J. TGF-beta signaling and the fibrotic response. FASEB J. 2004, 18, 816–827. [Google Scholar] [CrossRef] [Scilit]
- Bissell, D.M.; Wang, S.S.; Jarnagin, W.R.; Roll, F.J. Cell-specific expression of transforming growth factor-beta in rat liver. Evidence for autocrine regulation of hepatocyte proliferation. J. Clin. Investig. 1995, 96, 447–455. [Google Scholar] [CrossRef] [Scilit]
- Katuri, V.; Tang, Y.; Li, C.; Jogunoori, W.; Deng, C.; Rashid, A.; Sidawy, A.; Evans, S.; Reddy, E.; Mishra, B. Critical interactions between TGF-β signaling/ELF, and E-cadherin/β-catenin mediated tumor suppression. Oncogene 2006, 25, 1871. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Chakraborty, D.; Sumova, B.; Mallano, T.; Chen, C.W.; Distler, A.; Bergmann, C.; Ludolph, I.; Horch, R.E.; Gelse, K.; Ramming, A.; et al. Activation of STAT3 integrates common profibrotic pathways to promote fibroblast activation and tissue fibrosis. Nat. Commun. 2017, 8, 1130. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Huang, G.; Yan, H.; Ye, S.; Tong, C.; Ying, Q.L. STAT3 phosphorylation at tyrosine 705 and serine 727 differentially regulates mouse ESC fates. Stem. Cells Transl. Med. 2014, 32, 1149–1160. [Google Scholar] [CrossRef] [Scilit]
- Zhao, C.; Wang, W.; Yu, W.; Jou, D.; Wang, Y.; Ma, H.; Xiao, H.; Qin, H.; Zhang, C.; Lu, J.; et al. A novel small molecule STAT3 inhibitor, LY5, inhibits cell viability, colony formation, and migration of colon and liver cancer cells. Oncotarget 2016, 7, 12917–12926. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lin, L.; Hutzen, B.; Li, P.K.; Ball, S.; Zuo, M.; DeAngelis, S.; Foust, E.; Sobo, M.; Friedman, L.; Bhasin, D.; et al. A novel small molecule, LLL12, inhibits STAT3 phosphorylation and activities and exhibits potent growth-suppressive activity in human cancer cells. Neoplasia 2010, 12, 39–50. [Google Scholar] [CrossRef] [Scilit]
- Dauer, D.J.; Ferraro, B.; Song, L.; Yu, B.; Mora, L.; Buettner, R.; Enkemann, S.; Jove, R.; Haura, E.B. Stat3 regulates genes common to both wound healing and cancer. Oncogene 2005, 24, 3397. [Google Scholar] [CrossRef] [Scilit]
- Wynn, T.A. Cellular and molecular mechanisms of fibrosis. J. Pathol. 2008, 214, 199–210. [Google Scholar] [CrossRef] [Scilit]
- Ogata, H.; Chinen, T.; Yoshida, T.; Kinjyo, I.; Takaesu, G.; Shiraishi, H.; Iida, M.; Kobayashi, T.; Yoshimura, A. Loss of SOCS3 in the liver promotes fibrosis by enhancing STAT3-mediated TGF-beta1 production. Oncogene 2006, 25, 2520–2530. [Google Scholar] [CrossRef] [Scilit]
- Wang, Z.; Li, J.; Xiao, W.; Long, J.; Zhang, H. The STAT3 inhibitor S3I-201 suppresses fibrogenesis and angiogenesis in liver fibrosis. Lab. Investig. 2018, 98, 1600–1613. [Google Scholar] [CrossRef] [Scilit]
- Yan, Y.; Ma, L.; Zhou, X.; Ponnusamy, M.; Tang, J.; Zhuang, M.A.; Tolbert, E.; Bayliss, G.; Bai, J.; Zhuang, S. Src inhibition blocks renal interstitial fibroblast activation and ameliorates renal fibrosis. Kidney Int. 2016, 89, 68–81. [Google Scholar] [CrossRef] [Scilit]
- Colomiere, M.; Ward, A.C.; Riley, C.; Trenerry, M.K.; Cameron-Smith, D.; Findlay, J.; Ackland, L.; Ahmed, N. Cross talk of signals between EGFR and IL-6R through JAK2/STAT3 mediate epithelial–mesenchymal transition in ovarian carcinomas. Br. J. Cancer 2009, 100, 134. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ramos-Elorduy, J.; Moreno, J.M.P.; Prado, E.E.; Perez, M.A.; Otero, J.L.; De Guevara, O.L. Nutritional value of edible insects from the state of Oaxaca, Mexico. J. Food Compos. Anal. 1997, 10, 142–157. [Google Scholar] [CrossRef] [Scilit]
- Consortium, T.I.S.G. The genome of a lepidopteran model insect, the silkworm Bombyx mori. Insect Biochem. Mol. 2008, 38, 1036–1045. [Google Scholar]
- Ji, S.D.; Kim, N.S.; Kweon, H.Y.; Choi, B.H.; Yoon, S.M.; Kim, K.Y.; Koh, Y.H. Nutrient compositions of Bombyx mori mature silkworm larval powders suggest their possible health improvement effects in humans. J. Asia Pac. Entomol. 2016, 19, 1027–1033. [Google Scholar] [CrossRef] [Scilit]
- Tabunoki, H.; Ono, H.; Ode, H.; Ishikawa, K.; Kawana, N.; Banno, Y.; Shimada, T.; Nakamura, Y.; Yamamoto, K.; Satoh, J.; et al. Identification of key uric acid synthesis pathway in a unique mutant silkworm Bombyx mori model of Parkinson’s disease. PLoS ONE 2013, 8, e69130. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kim, Y.S.; Kim, K.Y.; Kang, P.D.; Cha, J.Y.; Heo, J.S.; Park, B.K.; Cho, Y.S. Effect of Silkworm (Bombyx mori) Excrement Powder on the Alcoholic Hepatotoxicit in Rats. J. Life Sci. 2008, 18, 1342–1347. [Google Scholar] [CrossRef] [Scilit]
- Hong, K.S.; Yun, S.M.; Cho, J.M.; Lee, D.Y.; Ji, S.D.; Son, J.G.; Kim, E.H. Silkworm (Bombyx mori) powder supplementation alleviates alcoholic fatty liver disease in rats. J. Funct. Foods 2018, 43, 29–36. [Google Scholar] [CrossRef] [Scilit]
- Cho, J.M.; Kim, K.Y.; Ji, S.D.; Kim, E.H. Protective Effect of Boiled and Freeze-dried Mature Silkworm Larval Powder Against Diethylnitrosamine-induced Hepatotoxicity in Mice. J. Cancer Prev. 2016, 21, 173–181. [Google Scholar] [CrossRef] [Scilit]
- Ji, S.D.; Kim, N.S.; Lee, J.Y.; Kim, M.J.; Kweon, H.Y.; Sung, G.B.; Kang, P.D.; Kim, K.Y. Development of processing technology for edible mature silkworm. J. Entomol. Sci. 2015, 53, 38–43. [Google Scholar]
- Kim, E.H.; Bae, J.S.; Hahm, K.B.; Cha, J.Y. Endogenously synthesized n-3 polyunsaturated fatty acids in fat-1 mice ameliorate high-fat diet-induced non-alcoholic fatty liver disease. Biochem. Pharm. 2012, 84, 1359–1365. [Google Scholar] [CrossRef] [Scilit]
- Han, Y.M.; Hahm, K.B.; Park, J.M.; Hong, S.P.; Kim, E.H. Paradoxically augmented anti-tumorigenic action of proton pump inhibitor and GastrininAPCMin/+ intestinal polyposis model. Neoplasia 2014, 16, 73–83. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Canbay, A.; Bechmann, L.; Gerken, G. Lipid metabolism in the liver. Z. Gastroenterol. 2007, 45, 35–41. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Guzińska-Ustymowicz, K.; Pryczynicz, A.; Kemona, A.; Czyżewska, J. Correlation between proliferation markers: PCNA, Ki-67, MCM-2 and antiapoptotic protein Bcl-2 in colorectal cancer. Anticancer Res. 2009, 29, 3049–3052. [Google Scholar] [PubMed]
- Bishayee, A. The inflammation and liver cancer. In Inflammation and Cancer; Springer: Berlin/Heidelberg, Germany, 2014; pp. 401–435. [Google Scholar]
- Xu, F.; Liu, C.; Zhou, D.; Zhang, L. TGF-beta/SMAD pathway and its regulation in hepatic fibrosis. J. Histochem. Cytochem. 2016, 64, 157–167. [Google Scholar] [CrossRef] [Scilit]
- O’Rourke, J.M.; Sagar, V.M.; Shah, T.; Shetty, S. Carcinogenesis on the background of liver fibrosis: Implications for the management of hepatocellular cancer. World J. Gastroenterol. 2018, 24, 4436–4447. [Google Scholar] [CrossRef] [Scilit]
- Nunez Lopez, O.; Bohanon, F.J.; Wang, X.; Ye, N.; Corsello, T.; Rojas-Khalil, Y.; Chen, H.; Zhou, J.; Radhakrishnan, R.S. STAT3 inhibition suppresses hepatic stellate cell fibrogenesis: HJC0123, a potential therapeutic agent for liver fibrosis. RSC Adv. 2016, 6, 100652–100663. [Google Scholar] [CrossRef] [Scilit]
- Kasembeli, M.M.; Bharadwaj, U.; Robinson, P.; Tweardy, D.J. Contribution of STAT3 to Inflammatory and Fibrotic Diseases and Prospects for its Targeting for Treatment. Int. J. Mol. Sci. 2018, 19. [Google Scholar] [CrossRef] [Scilit]
- Verna, L.; Whysner, J.; Williams, G.M. N-nitrosodiethylamine mechanistic data and risk assessment: Bioactivation, DNA-adduct formation, mutagenicity, and tumor initiation. Pharm. 1996, 71, 57–81. [Google Scholar] [CrossRef] [Scilit]
- Fuchs, B.C.; Hoshida, Y.; Fujii, T.; Wei, L.; Yamada, S.; Lauwers, G.Y.; McGinn, C.M.; DePeralta, D.K.; Chen, X.; Kuroda, T.; et al. Epidermal growth factor receptor inhibition attenuates liver fibrosis and development of hepatocellular carcinoma. Hepatology 2014, 59, 1577–1590. [Google Scholar] [CrossRef] [Scilit]
- Rattana, S.; Katisart, T.; Sungthong, B.; Butiman, C. Acute and sub-acute toxicities of Thai Silkworm Powder (Bombyx mori Linn.) from three races in male Wistar rats and in vitro antioxidant activities. Phcog. J. 2017, 9. [Google Scholar] [CrossRef] [Scilit]
- Reagan-Shaw, S.; Nihal, M.; Ahmad, N. Dose translation from animal to human studies revisited. FASEB J. 2008, 22, 659–661. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sengupta, P. The laboratory rat: relating its age with human’s. Int. J. Prev. Med. 2013, 4, 624–630. [Google Scholar] [PubMed]
- Dejong, C.H.; van de Poll, M.C.; Soeters, P.B.; Jalan, R.; Olde Damink, S.W. Aromatic amino acid metabolism during liver failure. J. Nutr. 2007, 137, 1579S–1585S. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lukey, M.J.; Katt, W.P.; Cerione, R.A. Targeting amino acid metabolism for cancer therapy. Drug. Discov. Today 2017, 22, 796–804. [Google Scholar] [CrossRef] [Scilit]
- Lee, D.-Y.; Kim, E.-H. Therapeutic Effects of Amino Acids in Liver Diseases: Current Studies and Future Perspectives. J. Cancer Prev. 2019, 24, 72. [Google Scholar] [CrossRef] [Scilit]
- Freudenberg, A.; Petzke, K.J.; Klaus, S. Dietary L-leucine and L-alanine supplementation have similar acute effects in the prevention of high-fat diet-induced obesity. J. Amino Acids 2013, 44, 519–528. [Google Scholar] [CrossRef] [Scilit]
- Rivera, C.A.; Bradford, B.U.; Hunt, K.J.; Adachi, Y.; Schrum, L.W.; Koop, D.R.; Burchardt, E.R.; Rippe, R.A.; Thurman, R.G. Attenuation of CCl(4)-induced hepatic fibrosis by GdCl(3) treatment or dietary glycine. Am. J. Physiol. Gastrl. 2001, 281, G200–G207. [Google Scholar]
- Senthilkumar, R.; Viswanathan, P.; Nalini, N. Effect of glycine on oxidative stress in rats with alcohol induced liver injury. Pharmazie 2004, 59, 55–60. [Google Scholar]
- Sim, W.-C.; Yin, H.-Q.; Choi, H.-S.; Choi, Y.-J.; Kwak, H.C.; Kim, S.-K.; Lee, B.-H. L-serine supplementation attenuates alcoholic fatty liver by enhancing homocysteine metabolism in mice and rats. J. Nutr. 2014, 145, 260–267. [Google Scholar] [CrossRef] [Scilit]
- Ji, S.D.; Kim, N.S.; Kweon, H.Y.; Choi, B.H.; Kim, K.Y.; Koh, Y.H. Nutrition composition differences among steamed and freeze-dried mature silkworm larval powders made from 3 Bombyx mori varieties weaving different colored cocoons. Int. J. Indust. Entomol. 2016, 33, 6–14. [Google Scholar] [CrossRef] [Scilit]
- Kim, D.K.; Kang, Y.K.; Lee, M.Y.; Lee, K.-G.; Yeo, J.-H.; Lee, W.B.; Kim, Y.S.; Kim, S.S. Neuroprotection and enhancement of learning and memory by BF-7. J. Health Sci. 2005, 51, 317–324. [Google Scholar] [CrossRef] [Scilit]
- Knight, D.; Mutsaers, S.E.; Prele, C.M. STAT3 in tissue fibrosis: Is there a role in the lung? Pulm. Pharm. 2011, 24, 193–198. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wang, H.; Lafdil, F.; Kong, X.; Gao, B. Signal transducer and activator of transcription 3 in liver diseases: A novel therapeutic target. Int. J. Biol. Sci. 2011, 7, 536. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Friedman, S.L. Hepatic stellate cells: Protean, multifunctional, and enigmatic cells of the liver. Physiol. Rev. 2008, 88, 125–172. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Nieto, N. Oxidative-stress and IL-6 mediate the fibrogenic effects of rodent Kupffer cells on stellate cells. Hepatology 2006, 44, 1487–1501. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kovalovich, K.; DeAngelis, R.A.; Li, W.; Furth, E.E.; Ciliberto, G.; Taub, R. Increased toxin-induced liver injury and fibrosis in interleukin-6-deficient mice. Hepatology 2000, 31, 149–159. [Google Scholar] [CrossRef] [Scilit]
- Pang, M.; Ma, L.; Gong, R.; Tolbert, E.; Mao, H.; Ponnusamy, M.; Chin, Y.E.; Yan, H.; Dworkin, L.D.; Zhuang, S. A novel STAT3 inhibitor, S3I-201, attenuates renal interstitial fibroblast activation and interstitial fibrosis in obstructive nephropathy. Kidney Int. 2010, 78, 257–268. [Google Scholar] [CrossRef] [Scilit]
- Dong, Y.; Lu, B.; Zhang, X.; Zhang, J.; Lai, L.; Li, D.; Wu, Y.; Song, Y.; Luo, J.; Pang, X.; et al. Cucurbitacin E, a tetracyclic triterpenes compound from Chinese medicine, inhibits tumor angiogenesis through VEGFR2-mediated Jak2-STAT3 signaling pathway. Carcinogenesis 2010, 31, 2097–2104. [Google Scholar] [CrossRef] [Scilit]
- Zehender, A.; Huang, J.; Gyorfi, A.H.; Matei, A.E.; Trinh-Minh, T.; Xu, X.; Li, Y.N.; Chen, C.W.; Lin, J.; Dees, C.; et al. The tyrosine phosphatase SHP2 controls TGFbeta-induced STAT3 signaling to regulate fibroblast activation and fibrosis. Nat. Commun. 2018, 9, 3259. [Google Scholar] [CrossRef] [Scilit]
- Massagué, J. TGFβ signalling in context. Nature 2012, 13, 616. [Google Scholar] [CrossRef] [Scilit]
- Ten Dijke, P.; Hill, C.S. New insights into TGF-β–Smad signalling. Trends Biochem. Sci. 2004, 29, 265–273. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Gilboa, L.; Wells, R.G.; Lodish, H.F.; Henis, Y.I. Oligomeric structure of type I and type II transforming growth factor β receptors: Homodimers form in the ER and persist at the plasma membrane. J. Cell Biol. 1998, 140, 767–777. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ghafoory, S.; Varshney, R.; Robison, T.; Kouzbari, K.; Woolington, S.; Murphy, B.; Xia, L.; Ahamed, J. Platelet TGF-β1 deficiency decreases liver fibrosis in a mouse model of liver injury. Blood Adv. 2018, 2, 470–480. [Google Scholar] [CrossRef] [Scilit]
- Datto, M.B.; Frederick, J.P.; Pan, L.; Borton, A.J.; Zhuang, Y.; Wang, X.F. Targeted disruption of Smad3 reveals an essential role in transforming growth factor beta-mediated signal transduction. Mol. Cell Biol. 1999, 19, 2495–2504. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Yang, X.; Letterio, J.J.; Lechleider, R.J.; Chen, L.; Hayman, R.; Gu, H.; Roberts, A.B.; Deng, C. Targeted disruption of SMAD3 results in impaired mucosal immunity and diminished T cell responsiveness to TGF-beta. EMBO J. 1999, 18, 1280–1291. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Choy, L.; Skillington, J.; Derynck, R. Roles of autocrine TGF-beta receptor and Smad signaling in adipocyte differentiation. J. Cell Biol. 2000, 149, 667–682. [Google Scholar] [CrossRef] [Scilit] [PubMed]






| Gene | Forward | Reverse | Size (bp) | |
|---|---|---|---|---|
| qRT-PCR | TNF-α | ACTGAACTTCGGGGTGATCG | GCTTGGTGGTTTGCTACGAC | 153 |
| Col1a1 | CAACCTCAAGAAGTCCCTGC | AGGTGAATCGACTGTTGCCT | 77 | |
| Acta2 | ACTGGGACGACATGGAAAAG | GCCACATACATGGCAGGGACATTG | 172 | |
| TGF-β | GCGGACTACTACGCCAAAGA | TGCTTCCCGAATGTCTGACG | 129 | |
| PAI-1 | CGTCTTCCTCCACAGCCATT | GTTGGATTGTGCCGAACCAC | 97 | |
| CTGF | ACCCAACTATGATGCGAGCC | GCCCATCCCACAGGTCTTAG | 77 | |
| IL-6 | TCCTACCCCAACTTCCAATGCTC | TTGGATGGTCTTGGTCCTTAGCC | 79 | |
| CYP2E1 | AAACAGGGTAATGAGGCCCG | AGGCTGGCCTTTGGTCTTTT | 78 | |
| 18s rRNA | GCAATTATTCCCCATGAACG | GGCCTCACTAAACCATCCAA | 111 | |
| RT-PCR | c-Fos | TACTACCATTCCCCAGCCGA | GCGTATCTGTCAGCTCCCTC | 409 |
| HIF-1α | GCCCCAGATTCAAGATCAGCC | ATTCATCAGTGGTGGCAGTTGCG | 392 | |
| c-Myc | ACTCGGTGCAGCCCTATTTC | GTAGCGACCGCAACATAGGA | 187 | |
| p53 | CCCCTGAAGACTGGATAACTGT | GGTGGAAGCCATAGTTGCCT | 348 | |
| Oct1 | GTCACATCTGTGTCCGGTGT | CACTAGCCCCACTGTGAAGG | 195 | |
| 18s rRNA | CCCAACTTCTTAGAGGGACAAGT | TAGTCAAGTTCGACCGTCTTCTC | 350 |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Lee, D.-Y.; Yun, S.-M.; Song, M.-Y.; Ji, S.-D.; Son, J.-G.; Kim, E.-H. Administration of Steamed and Freeze-Dried Mature Silkworm Larval Powder Prevents Hepatic Fibrosis and Hepatocellular Carcinogenesis by Blocking TGF-β/STAT3 Signaling Cascades in Rats. Cells 2020, 9, 568. https://doi.org/10.3390/cells9030568
Lee D-Y, Yun S-M, Song M-Y, Ji S-D, Son J-G, Kim E-H. Administration of Steamed and Freeze-Dried Mature Silkworm Larval Powder Prevents Hepatic Fibrosis and Hepatocellular Carcinogenesis by Blocking TGF-β/STAT3 Signaling Cascades in Rats. Cells. 2020; 9(3):568. https://doi.org/10.3390/cells9030568
Chicago/Turabian StyleLee, Da-Young, Sun-Mi Yun, Moon-Young Song, Sang-Deok Ji, Jong-Gon Son, and Eun-Hee Kim. 2020. "Administration of Steamed and Freeze-Dried Mature Silkworm Larval Powder Prevents Hepatic Fibrosis and Hepatocellular Carcinogenesis by Blocking TGF-β/STAT3 Signaling Cascades in Rats" Cells 9, no. 3: 568. https://doi.org/10.3390/cells9030568
APA StyleLee, D.-Y., Yun, S.-M., Song, M.-Y., Ji, S.-D., Son, J.-G., & Kim, E.-H. (2020). Administration of Steamed and Freeze-Dried Mature Silkworm Larval Powder Prevents Hepatic Fibrosis and Hepatocellular Carcinogenesis by Blocking TGF-β/STAT3 Signaling Cascades in Rats. Cells, 9(3), 568. https://doi.org/10.3390/cells9030568

