Next Article in Journal
Immune Ageing Clocks: A Methods-Oriented Review of Tasks, Modalities, Models, and Recalibration
Next Article in Special Issue
Senescent Stroma-Derived Glutamine: A Driver of Aggressiveness in Prostate and Ovarian Cancer Cells
Previous Article in Journal
TRPA1 Expressed by Hepatocytes and Liver Macrophages Does Not Mediate Inflammatory Infiltration and Steatosis in a Mouse Model of Chronic Alcohol-Induced Liver Injury
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Cells
Volume 15
Issue 5
10.3390/cells15050420
cells-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

TIA1 Mutant Mouse Model Exhibits Motor Deficits and Neurodegenerative Characteristics of Amyotrophic Lateral Sclerosis

by
Li-Hong Mao
1,†,‡,
Yu-Ning Song
2,‡,
Jing-Qi Zhang
1,
Yun-Ting Shao
1,
Zhang-Li Wang
1,
Na Yang
1,
Wen-Xuan Zhang
1,
Ying-Rui Zhang
1,
Xiao-Yan Gao
3,
Jia-Yi Li
1,4,* and
Lin Yuan
1,*
1
Laboratory of Research in Parkinson’s Disease and Related Disorders, Health Sciences Institute, China Medical University, Shenyang 110122, China
2
Key Laboratory of Zoonosis Research, Ministry of Education, Jilin University, Changchun 130062, China
3
Science Experiment Center, China Medical University, Shenyang 110122, China
4
Neural Plasticity and Repair Unit, Wallenberg Neuroscience Center, Department of Experimental Medical Science, Lund University, 221 84 Lund, Sweden
*
Authors to whom correspondence should be addressed.
†
Current address: School of Basic Medical Sciences, Kunming Medical University, Kunming 650500, China.
‡
These authors contributed equally to this work.
Cells 2026, 15(5), 420; https://doi.org/10.3390/cells15050420
Submission received: 15 January 2026 / Revised: 19 February 2026 / Accepted: 25 February 2026 / Published: 27 February 2026
(This article belongs to the Special Issue Cellular Senescence and Transformation: Unraveling the Biological Links Between Aging and Cancer)
Browse Figures
Versions Notes

Highlights

What are the main findings?
  • Motor neuron death in TIA1Δ mice occurs prior to detectable TDP-43 phosphorylation.
  • TDP-43 accumulates and mislocalizes in the absence of phosphorylation in TIA1Δ mice, which may represent a speculative pre-aggregation-like disease stage.
What are the implications of the main findings?
  • The TIA1Δ mouse model provides a unique tool to dissect early, phosphorylation-independent toxic mechanisms potentially relevant to TDP-43 proteinopathy.
  • Cautious interpretation of the TIA1Δ mouse model’s limitations is necessary when extrapolating its findings to human TDP-43 proteinopathy.

Abstract

Background: Amyotrophic lateral sclerosis (ALS) is a devastating neurodegenerative disease that primarily affects the motor neurons. T cell intracellular antigen 1 (TIA1) is a risk gene for ALS pathogenesis. To elucidate TIA1-mediated disease mechanisms, a mouse model recapitulating clinical and pathological features of ALS is needed. TIA1 mutations are rare in human ALS, and mutations are heterozygous, while this study uses a homozygous TIA1 mutant mouse model to amplify pathogenic effects for experimental tractability. Methods: To explore the mechanisms by which mutant TIA1 causes ALS neurodegeneration, we generated a TIA1 mutant mouse by introducing ALS-causing mutations into the endogenous animal via cytosine base editors. Next, behavioral experiments (open-field and rotarod tests) assessed motor function and analyzed pathologies using morphological assessments. Results: Our TIA1Δ mouse model phenocopies select pivotal features of ALS, including TAR DNA-binding protein 43 (TDP-43) accumulation, motor neuron loss, neuroinflammation in the lumbar spinal cord, and muscle atrophy. Notably, this homozygous mutation design with reduced TIA1 expression differs from human heterozygous TIA1 mutations. Conclusions: This work provides a foundation for understanding the TIA1-ALS relationship and for developing strategies to treat this intractable neurodegenerative disorder. Caution is warranted extrapolating findings to human ALS pathogenesis due to model design differences.

Graphical Abstract

1. Introduction

Amyotrophic lateral sclerosis (ALS) is a progressive neurodegenerative disease disorder characterized by the selective progressive loss of both upper and lower motor neurons, causing loss of motor function, skeletal muscle atrophy, and the pathological accumulation and mislocalization of TAR DNA-binding protein 43 (TDP-43) aggregates in affected neurons [1,2,3]. In addition to motor neuron degeneration, reactive gliosis, including the activation of astrocytes and microglia, is a prominent pathological feature in the spinal cord anterior horn of ALS patients and animal models [4]. Most ALS patients (90–95%) are sporadic, with no clear familial inheritance, while approximately 5–10% are familial ALS (fALS) caused by heredity [5]. Despite incomplete elucidation of ALS pathogenesis, genetic factors are well established as core drivers of disease initiation and progression [1,6], and the identification of ALS-associated genes has become pivotal for unraveling disease mechanisms and developing targeted therapeutic strategies. To date, a growing list of genes has been identified linked to ALS, including T-cell restricted intracellular antigen 1 (TIA1), Chromosome 9 Open Reading Frame 72 (C9ORF72), superoxide dismutase 1 (SOD1), TDP-43, and Fused-in-Sarcoma (FUS) [7,8,9,10]. Given the genetic complexity of ALS, gene-editing technology has emerged as a favored approach for dissecting the pathogenic contributions of individual ALS-associated genes and their interactions.
TIA1 was recently identified as a novel fALS-associated gene [11], with pathogenic mutations predominantly localized to its C-terminal low-complexity domain (LCD)—a region critical for the protein’s biophysical properties and biological functions. TIA1 is an RNA-binding protein (RBP) containing RNA recognition motifs (RRMs) and a C-terminal LCD; it exerts essential roles in the post-transcriptional regulation of RNA metabolism (including splicing, stability, and translation) and the dynamic assembly and disassembly of stress granules (SGs)—membrane-less organelles formed in response to cellular stress [12,13,14]. Pathogenic TIA1 mutations (e.g., P362L, A381T, and E384K) within the LCD alter the protein’s liquid–liquid phase separation (LLPS) capacity, disrupt SG homeostasis, and induce the formation of aberrant, insoluble protein aggregates [13,15]. For instance, the ALS-linked TIA1 P362L and E384K variants promote the transition of phase-separated TIA1 droplets into irreversible amyloid fibrils, a process closely associated with cellular proteotoxic stress [16]. These findings implicate TIA1 dysfunction, driven by LCD mutations, as a key pathogenic event in ALS, mediated by impaired RNA metabolism and disrupted SG dynamics. However, the in vivo pathogenic consequences of TIA1 mutations remain poorly characterized, and no mouse models carrying multi-site TIA1 LCD mutations have been generated to investigate their role in ALS pathogenesis. The multi-site mutation strategy used herein is not intended to model human genetic complexity directly, but to amplify biological phenotypes for experimental tractability, as increased genetic perturbation does not equate to physiological ALS etiology.
In this study, we generated a novel TIA1 mutant mouse model using cytosine base editors (CBEs), inducing three consecutive mutations in the TIA1 LCD: P362L, P363F, and a premature stop codon at Q364 (TIA1-P362L/P363F/Q364X, hereafter referred to as TIA1Δ). This homozygous multi-site mutant model is distinct from heterozygous TIA1 mutations in human ALS patients and is designed for mechanistic interrogation rather than direct clinical recapitulation. To investigate potential therapeutic targets for the devastating disease caused by TIA1Δ in ALS, future research will focus on understanding the precise mechanism by which TIA1 mutations cause motor neuron death and investigating potential therapeutic strategies to modulate TIA1 function in ALS.

2. Materials and Methods

2.1. Ethical Statement

The Institute of Cancer Research (ICR) mice used in this study were obtained from Jilin University. The mice for experiments were kept and studied in accordance with the China Medical University Laboratory Animal Welfare Ethical Guidelines. These mice were housed in cages in groups of 3–4 per cage with free access to food and water and under a 12 h light–dark cycle with standard humidity (55 ± 3%) and temperature (23 ± 3 °C) conditions. All experiments involving mice were approved by the Ethics Committee of China Medical University, approval number CMU2023643.

2.2. In Vitro Transcription and Zygote Injection with Cas9 and sgRNA

The vector was linearized and in vitro transcribed to mRNA using the mMachine SP6 Kit (Ambion, Foster City, CA, USA, Cat. No. AM1340). Subsequently, the products were then purified using the RNase Mini Kit (Qiagen) in compliance with the manufacturer’s guidelines.
To prepare the vector for in vitro transcription of sgRNA, the sgRNAs were designed and then cloned into the BbsI-linearized vector. The sequence of paired sgRNAs is listed as follows. F: 5′-TAGGGCCACCACCTCAAGGGCAGAA-3′. R: 5′-AAACTTCTGCCCTTGAGGTGGTGGC-3′. Then, T7 primers were used to amplify the PCR products, which were transcribed in vitro with the T7 RNA Synthesis Kit (Ambion, Cat. No. AM1344). Synthesized mRNA was purified by the miRNeasy Mini Kit (Qiagen, Hilden, Germany, Cat. No. 217004) in vitro, and both transcribed sgRNA and Cas9 mRNA were injected into the cytoplasm of pronuclear stage embryos. Then, these injected zygotes were transferred into the oviduct of the recipient mice. The F0 pups were produced after 20–22 days of pregnancy. F1 homozygous offspring were used to experiment in this study.

2.3. Genotyping of TIA1 Mutations in Pups

To test the mutation in TIA1 mice, genomic DNA was extracted from the tails of newborn pups using the TIANamp Genomic DNA Kit (TIANGEN, Cat. No. 4992254, Beijing, China). Then, the target genomic DNA was amplified using the following primers. F: 5′-CTCCTGACGGAGGATCCTTAT-3′. R: 5′-CTGGCATTTGTACTGACTGATTTG-3′. The PCR products were sequenced by Sheng-gong (Shanghai, China) to identify the mutation in Tia1.

2.4. Behavioral Tests

An open-field test was used to evaluate the spontaneous activity of mice. Briefly, mice were placed in the 50 × 50 cm test box for 1 h to adapt to the surroundings and then monitored. SMART V3.0 Software (Harvard Apparatus, Hollis Ton, MA, USA) was used to track the trajectory of the mice for 5 min, including the total distance traveled, the mean speed in the total zone, and the total time in the outer or inner zone. The rotarod test is a commonly used laboratory animal behavior test to assess motor coordination and balance in mice. In the rotarod test, the rotating rod gradually accelerated the rotation speed from 4 rpm to 40 rpm within 5 min (IITC Life Science). The latency time to fall and speed at fall were recorded. Both behavioral tests were performed three times in the formal experiment.

2.5. Creatine Kinase Activity Assay

Creatine kinase, also known as creatine phosphokinase (CPK), is an enzyme that mainly exists in the heart and skeletal muscle. Creatine kinase activity assay is widely used to evaluate creatine kinase levels in serum or plasma. The 3- and 12-month-old wild-type (WT) and TIA1Δ mice were on an empty stomach for over 8 h. Non-anticoagulant whole blood was collected and placed on ice for 1 h; then it was centrifugated (4 °C; 2000 g; 20 min), and the supernatant was collected in a new tube. Next, creatine kinase assays were performed using the kit (Nanjing Jian Cheng Bio, Nanjing, Jiangsu, China, A032-1-1) according to the instructions.

2.6. Tissue Preparation

In this study, 3- and 12-month-old mice were used, including male and female mice. Male and female mice were included in all groups, with attempts to balance sex distribution across genotypes; due to limited sample size, sex was not included as a separate statistical factor, which is a study limitation. Mice were anesthetized with sodium pentobarbital (50 mg/kg), and then the hearts were perfused with cold 0.9% sodium chloride (NaCl) for 5 min. The brains and lumbar spinal cords of the mice were dissected and fixed in 4% PFA for 24 h. The brain and spinal cord were washed with phosphate-buffered saline (PBS) and transferred to 30% sucrose in 0.1 M PBS. Brain and lumbar spinal cord sections were cut on a sliding microtome (Leica, Wetzlar, Germany, SM2010R), which was segmented into 8 ordered series of sections to facilitate the analysis of different indices after specific staining. We employed a series of stained sections to evaluate each index, such as TDP-43, CHAT, Iba1, GFAP, etc. And the slices were stored at 4 °C in cryoprotectant solution including 30% sucrose, 30% ethylene glycol, and 0.001% sodium azide.

2.7. Immunofluorescence

The lumbar spinal cord was cut on a cryostat (Leica, SM2010R) at a thickness of 30 μm. The slides underwent heat-induced epitope retrieval in citrate buffer (pH = 6.0) at 70 °C for 1 h and were permeabilized with 0.3% Triton X-100 for 30 min at room temperature. Next, the slices were blocked with 10% normal goat serum at room temperature for 1 h and then incubated with primary antibodies (Choline acetyltransferase, ChAT, 1:500) overnight at 4 °C. The secondary antibodies (Alex-488) were used to incubate the slides at room temperature for 1 h, and DAPI was used to stain the nuclei specifically. Images were obtained using a confocal laser microscope (X-light, Nikon, Tokyo, Japan). A minimum of 15 non-adjacent lumbar spinal cord sections per animal were analyzed. In all longitudinal lumbar slices, the motor neurons that expressed ChAT were manually counted from the 20× image using ImageJ software (version 1.53). This counting method yields comparative, rather than absolute, estimates of motor neuron number, with variability across lumbar segments minimized through the analysis of consistent anterior horn regions.

2.8. Immunohistochemical Staining

A series of lumbar spinal cord slices were pretreated for heat-induced epitope retrieval in citrate buffer (pH = 6.0) at 70 °C for 60–90 min after incubating with 3% H2O2 for 10 minutes and blocking with 10% normal horse serum or goat serum for 1 h at room temperature. These lumbar spinal cord slices were stained and incubated with primary antibodies (Table 1) overnight at 4 °C, then with biotinylated secondary antibodies at room temperature for 1 h. After the secondary antibody incubation, the slices were rinsed and incubated with avidin–biotin complex (ABC) (Vector Laboratories, Newark, CA, USA, Catalog No. PK-6100) and 3,3′-diaminobenzidine (DAB) (Vector Laboratories, SK-4100) solutions. Finally, the lumbar spinal cord slices were sealed with neutral balsam for microscopic observation.

2.9. Western Blot (WB)

Mouse brain tissue was homogenized, and homogenization supernatant was collected using radioimmunoprecipitation assay buffer containing 1% protease and phosphatase following centrifugation at 13,000 g for 30 min at 4 °C. Subsequently, the supernatant was mixed with a 5× loading buffer and denatured for 10 min in a 95 °C water bath. Samples with the same amount of protein were separated by gel electrophoresis and transferred to the polyvinylidene difluoride membrane using a 12% SDS-PAGE gel. The membrane was blocked in 5% skimmed milk powder with 0.1% Tween-20 added to TBS (TBST) for 1 h, then incubated with primary antibody (anti-TDP-43, ab109535, 1:5000; anti-TIA1, ab140595, 1:5000; anti-GAPDH, 60004-1-Ig, 1:10,000; anti-pTDP-43, 22309-1-AP, 1:2000; anti-FUS, CY6589, 1:500; anti-G3BP1, 66486-1-Ig, 1:10,000) diluted with TBST overnight at 4 °C, followed by incubation with horseradish peroxidase (HRP)-conjugated secondary antibody. The membranes were colored with ECL chemiluminescence substrate (Tanon, Shanghai, China, cat#180-5001) and imaged by a chemiluminescence imaging analysis system (Tanon, Shanghai, China, 5500). The intensity of bands was quantified using ImageJ software, and the protein levels were normalized to the reference protein for statistical analysis.

2.10. α-Bungarotoxin Staining

The motor endplates are highly specialized morphology and structure connections between muscle cells and nerve terminals. Impaired motor endplates lead to the failure of neural signal transmission, thereby affecting normal muscle contraction. To detect the integrity of the motor endplates, the gastrocnemius muscles of 3-month-old mice were fixed with 4% PFA for 24 h and cut into 50 μm using a cryostat microtome (CM1950, Leica, Wetzlar, Germany). Muscle sections were permeabilized with 0.3% Triton 100× for 30 min, blocked with normal goat serum for 1 h, and incubated overnight with anti-rabbit neurofilament antibody (Sigma, St. Louis, MO, USA, NO142, 1:200). Alexa-488-conjugated neurofilament (1:1000) and Alexa-555-conjugated α-bungarotoxin (Invitrogen, Carlsbad, CA, USA, T1175, 1:1000), a gift from Ge Bai’s Laboratory of Zhejiang University, were incubated for 2 h at room temperature. α-bungarotoxin was used to detect the acetylcholine receptors in muscle. Confocal images were obtained using 20× objectives on a confocal laser scanning microscope (X-light V3, Nikon, Tokyo, Japan). At least 50 randomly selected motor endplates were quantified from 3 mice in each group.

2.11. Morphological and Histological Analysis

To evaluate histomorphological and collagen deposition of muscle, Masson’s staining and the hematoxylin–eosin staining (HE) were performed using the kit according to the manufacturer’s instructions (Solarbio, Beijing, China, G1346). Briefly, the muscle tissue was fixed in 4% paraformaldehyde for 24 h. After the standard dehydration and embedding procedures, it was cut into 5 μm thick paraffin sections and dewaxed in water. Sections were mordant-stained by immersing them in a mordant solution for an hour at 60 °C in an incubator, followed by a 10 min washing under running tap water. Celestite Blue Solution, Mayer Hematoxylin Solution, Acid Differentiation Solution, Ponceau-Acid Fuchsin Solution, Phosphomolybdic Acid Solution, Aniline Blue Solution, and Acetic Acid Solution were used to stain the samples for 2–10 min each after staining. Hematoxylin dye was used to stain the nucleus for HE staining, and then eosin was used to stain the cytoplasm.

2.12. RNA Extraction and Quantitative PCR

Total RNA was isolated from cultured cells with TRIzol reagent (ThermoFisher Scientific, Waltham, MA, USA) following the manufacturer’s instructions. cDNA was synthesized by reverse transcription using oligo(dT) primers. Quantitative real-time PCR was performed with the TB Green Premix Ex Taq kit (TAKARA, Kusatsu, Shiga, Japan, RR820A). All reactions were run in technical triplicate, and 18S rRNA was used as the endogenous control for normalization. Relative mRNA expression levels were calculated using the comparative ΔΔCq method. The primer sequences are provided in Table 2.

2.13. Quantitative and Statistical Analysis

We employed a series of stained sections to evaluate each index, such as TDP-43, CHAT, Iba1, GFAP, etc. In all longitudinal lumbar slices, the motor neurons that express ChAT were manually counted from a 20× image, and Iba1- and GFAP-positive cells were manually counted from 10× image. The intensity of TDP-43 staining in the cortex and spinal cord was quantified by grayscale value analysis. Only the cell nuclei stained with hematoxylin were counted, aiming to minimize the number of tagged neurons that were counted more than once. The data are shown as the average number of cells in each section. All data were collected and analyzed by an investigator blinded to the genotype and experimental groups. Visual inspection was used to evaluate the normality and homogeneity of variance assumptions required for parametric analyses; formal hypothesis tests for these assumptions were not applied.
All data were analyzed by GraphPad Prism 8.0.2. An independent-sample unpaired, two-tailed Student’s test, two-way analysis of variance (ANOVA), and Tukey’s post hoc test were used to analyze experimental data. In all cases where two-way ANOVA revealed significant main effects, we performed multiple comparisons tests to compare selected groups of interest. All values were presented as the mean ± standard deviation (SD), and the significance level for all analyzes was set at p < 0.05. Normality was assessed using Shapiro–Wilk test, and homogeneity of variance was evaluated using Levene’s test. Parametric tests were applied accordingly.

3. Results

3.1. Generation of a Gene TIA1Δ Mice Line Carrying TIA1 Mutations

The sgRNA-directed CBE system is an efficient tool for gene modification. To create a novel ALS mouse model with the Tia1 gene mutation, sgRNA targeting TIA1 LCD was designed (Figure 1A). DNA amplification and sequencing were performed to validate the TIA1 mutant mice. We found three consecutive amino acids changed in the LCD domain: 362 proline, 363 proline, and 364 glutamine to leucine, phenylalanine, and a stop codon, respectively (TIA1-P362L/P363F/Q364X, hereinafter, TIA1Δ) (Figure 1B). These mice are homozygous (Figure 1A,B). Compared to WT mice, TIA1 protein expression was significantly decreased in the olfactory bulb, cortex, striatum, and hippocampus of the TIA1Δ mice (Figure 1C–G). Interestingly, TIA1 expression in the substantia nigra was unaltered in both TIA1Δ and WT mice (Figure 1C,H). Western blot analysis of the cortex and striatum in 3-month-old mice revealed a significant decrease in TIA1 expression in TIA1Δ mice relative to WT (Figure 1I–K). TIA1 protein levels in the lumbar spinal cord also had a lower expression (Figure 1L,M). Furthermore, we observed a decrease in TIA1 mRNA levels across various brain regions (olfactory bulb, cortex, striatum, and hippocampus) and the spinal cord, except for the substantia nigra (Figure 1N–S).

3.2. Impairment of Motor Function in TIA1Δ Mice

ALS is a motor neuron disease characterized by the degeneration of both upper and lower motor neurons, leading to muscle weakness and eventual paralysis [17]. An open-field test and a rotarod test were performed to evaluate the impairment in motor function of the TIA1Δ mice. The open-field test was used primarily to evaluate general locomotor activity; analysis was focused on ambulatory parameters indicative of motor function. Both 3- and 12-month-old TIA1Δ mice exhibited reduced total distances traveled and average movement speed in the open-field test (Figure 2A–C), suggesting a propensity for TIA1Δ mice to exhibit reduced locomotion, and the TIA1Δ mice spent more time in the periphery than in the center (Figure 2D,E). The movement ability of the TIA1Δ mice decreased significantly in the rotarod test (Figure 2F,G). The above findings suggest that TIA1Δ mice display some motor impairments that are similar to those seen in ALS. To rule out the impact of weight changes on motor performance, we measured the mice’s body weight and found no significant differences in 3- and 12-month-old TIA1Δ mice compared to WT mice (Figure 2H). Indeed, based on the appearance of the mice, we found that TIA1Δ mice preferred to have their legs curled up (Figure 2I). The presence of pronounced hindlimb tremors following tail elevation in TIA1Δ mice is indicative of neurological dysfunction (Supplementary Video S1). The morphology and appearance of the spleen (Figure 2J,K), lung (Figure 2L), kidney (Figure 2M), quadriceps muscle (Figure 2N), liver (Figure 2O), gastrocnemius muscle (Figure 2P), and heart (Figure 2Q) of 3-month-old WT and TIA1Δ mice were also compared; a difference was only observed in that the lengths of spleens in TIA1Δ mice were shorter than in WT mice (Figure 2K).

3.3. TDP-43 Expression Was Increased in TIA1Δ Mice

Previous studies have shown that TDP-43 has been identified as the main component of protein inclusions in the cytoplasm of motor neurons affected by ALS [18,19]. The TDP-43 level was detected in the motor cortex of 3- and 12-month-old TIA1Δ mice (Figure 3A–D). The results indicated that there was no significant difference between 3-month-old TIA1Δ and WT mice, but a significantly increased level of TDP-43 was shown in 12-month-old mutant mice (Figure 3B,D). Furthermore, we investigated the TDP-43 protein level in the anterior horn of the lumbar spinal cord (Figure 3E–H). Compared with WT mice, the 3-month-old TIA1Δ mice displayed no changes in TDP-43 expression. However, compared with 3-month-old mutant mice, TDP-43 was significantly increased in 12-month-old TIA1Δ mice in an age-dependent manner (Figure 3F,H).
Previous studies have shown that TDP-43 pathology involves cytoplasmic mislocalization, aggregation, and phosphorylation [3,19,20]. In contrast, while we observed elevated levels of TDP-43 in the cortex of TIA1Δ mice, there was no evidence of nuclear clearance or cytoplasmic translocation (Figure 3A). In the anterior horn of lumbar spinal cord segments, comparative immunohistochemical analysis revealed an age-dependent cytoplasmic mislocalization of TDP-43 in motor neurons of TIA1Δ mice. While 3-month-old TIA1Δ mice exhibited negligible nuclear-to-cytoplasmic protein distribution relative to WT controls, 12-month-old mutants demonstrated marked cytoplasmic immunoreactivity (Figure 3E). Interestingly, phosphorylated TDP-43 (pTDP-43) was not detected in the cortex or spinal segments (Figure 3I,J). FUS is another pathogenic protein in ALS [21]. Ras GTPase-activating protein-binding protein 1 (G3BP1) and TIA1 are recognized as the core nucleating proteins of the stress granules [22]. Therefore, we further assessed whether FUS and G3BP1 were altered in TIA1Δ mice. The results showed that FUS and G3BP1 protein levels remained unchanged in the cortex and spinal cord (Figure 3K–P). In addition, we examined the subcellular localization of G3BP1 and FUS in the cortex and spinal cord. Our results demonstrated that FUS was observed predominantly in the nucleus, whereas G3BP1 was distributed in both cytoplasm and nucleus (Figure 3R–T).

3.4. Motor Neuron Loss and Muscle Atrophy in the TIA1Δ Mice

Based on the observed motor impairments in mice (Figure 2A–G), we subsequently investigated whether there was a loss of motor neurons in the lumbar spinal cord of these animals. Choline acetyltransferase (ChAT), recognized as a marker for motor neurons [4], was detected in the anterior horn of the lumbar spinal cord. The results showed a decrease in the number of large-diameter (≥30 μm) ChAT-positive neurons in TIA1Δ mice at both 3 and 12 months old; however, a significant reduction in the total number of ChAT-positive neurons was found only in 12-month-old TIA1Δ mice (Figure 4A–C). The results suggest that TIA1Δ mice displayed age-dependent motor neuron degeneration. It is consistent with previous findings on motor neurons in ALS model mice [4,23,24]. Furthermore, the motor function of TIA1Δ mice is affected not only by progressive motor neuron degeneration but also by muscle degeneration and atrophy. Higher levels of creatine kinase (CK) have been reported in patients with ALS [25,26,27]. The measurement of CK activity in serum represents a valuable diagnostic indicator for muscle tissue damage. To define the CK level in the serum of the TIA1Δ mice, the serum was isolated from 3- and 12-month-old mice. We found that CK in TIA1Δ mice increased significantly in 3- and 12-month-old mice (Figure 4D).
Next, we examined the morphology of muscle fibers in the cross-sections of the quadriceps femoris muscle from TIA1Δ mice using hematoxylin–eosin staining and Masson’s trichrome stain. Compared to WT mice at 3 and 12 months old, the distance between individual muscle fibers within various muscle bundles was greater in TIA1Δ mice (Figure 4E). However, no significant difference was observed in the mean area of muscle bundles (Figure 4F). In the TIA1Δ mice at 3 and 12 months old, a significantly greater amount of connective tissue was present compared to WT mice, suggesting that muscle atrophy exists and that the interstitial space between muscle fibers has increased (Figure 4E). Our data on fibrosis thus suggest that TIA1Δ mice exhibit muscle atrophy (Figure 4E). These findings could directly relate to the previously documented motor impairment in TIA1Δ mice. α-Bungarotoxin is a potent neurotoxin; it is an acetylcholine receptor that binds to acetylcholine receptors at neuromuscular junctions (NMJs) with high affinity and is commonly used to study NMJs. The NMJ is a special chemical synapse that converts nerve impulses into muscle actions. The gastrocnemius muscle was stained with neurofilament and α-bungarotoxin, and the results showed no significant differences in the mean area of motor endplates between 3-month-old TIA1Δ and WT mice (Figure S1A,B). In addition, we detected motor endplate innervation and found increased denervated muscle and a decreasing trend in the percentage of NMJs in 3-month-old TIA1Δ mice (Figure S1C,D). Notably, the loss of innervation was observed in 12-month-old TIA1Δ mice (Figure 4G), a qualitative observation only, without quantitative validation, suggesting that NMJ degeneration may be present in TIA1Δ mice, with the phenotype potentially manifesting over time.

3.5. Gliosis

Gliosis, referring to the proliferation and activation of glial cells, has been associated with the pathology of ALS in both patient and mouse models [4,28,29]. To analyze gliosis in the lumbar spinal cord, microglia and astrocytes were stained with ionized calcium-binding adaptor molecule 1 (Iba1) and glial fibrillary acidic protein (GFAP), respectively. In the anterior horn of the lumbar spinal cord, we discovered that 3- and 12-month-old TIA1Δ mice had significantly more positive microglia (Figure 5A,B) and astrocytes (Figure 5C,D) than WT mice. Furthermore, although the number of microglia and astrocytes in TIA1Δ mice was significantly higher than in WT mice, we did not see age-dependent changes in TIA1Δ mice (Figure 5B,D). At both 3 and 12 months old, TIA1Δ mice exhibited significant upregulation of TNF-α and iNOS mRNA (pro-inflammatory) alongside a marked downregulation of Arg1 (anti-inflammatory) compared to WT mice, indicating a sustained inflammatory imbalance (Figure 5E–J). This result suggested that gliosis was present in the spinal cord of TIA1Δ mice, which is consistent with previous investigations in the ALS mouse line [4].

4. Discussion

ALS is a neurodegenerative disorder that affects motor neurons, causing muscle weakness, atrophy, and functional impairment. It can be classified into sporadic and familial forms linked to gene mutations. Given its unclear etiology and pathogenesis, animal models are indispensable for elucidating ALS’s pathogenic mechanisms and developing therapeutic strategies. Mice are widely used in biomedical research due to the structural and functional similarity of their nervous system to those of humans [30]. Preclinical studies in SOD1-ALS mouse models have translated into encouraging clinical outcomes [31,32], supporting the value of mouse models in guiding clinical trials.
Numerous risk genes have been associated with ALS, including TIA1, C9ORF72, SOD1, TDP-43, and FUS [7]. However, some studies have reported no evidence of TIA1 mutations in a European cohort of ALS-FTD patients [33]. The TIA1Δ mouse model used in this study carries three homozygous mutation sites in the LCD region (TIA1-P362L, P363F, and Q364X), designed to amplify phenotypes for mechanistic investigation rather than to replicate human genetic complexity. Our results demonstrate that the TIA1Δ mice recapitulate several ALS-relevant phenotypes, including motor neuron degeneration and muscle weakness, supporting its utility as a mechanistic model for ALS. Although our TIA1Δ model carries a non-physiological homozygous mutation, it represents a loss-of-function-biased perturbation model to investigate the role of the TIA1 LCD in ALS-related pathogenesis. Our findings support that disruption of TIA1 LCD function contributes to ALS-relevant phenotypes, rather than reflecting a direct recapitulation of human disease mutations. TIA1 mutations are rare in human ALS (≈2% fALS, 0.4% sALS) and mostly occur as heterozygous variants, distinct from the homozygous mutant model used here [11]. The precise mechanisms by which TIA1 dysfunction contributes to ALS pathogenesis remain to be fully elucidated.
TIA1 is an RNA-binding protein involved in diverse cellular processes, including RNA splicing, transport, and stability regulation [34]. Interestingly, TIA1 knockdown was shown to rescue tau pathology in Alzheimer’s disease models [35], suggesting that TIA1 exerts multiple biological functions or participates in distinct pathological processes. Current research on TIA1 in ALS mainly focuses on identifying mutations and regulating SG dynamics. Mutations such as TIA1 P362L, A381T, and E384K have been shown to modulate cellular stress responses, particularly SG formation [13,36]. Loss of TIA1 may impair cellular stress resilience, increasing vulnerability to toxic insults, whereas mutations including P362L and A381T can alter TIA1′s biophysical properties, promoting phase separation, delaying SG disassembly, and recruiting TDP-43 into insoluble SGs [13,16].
FUS, another key ALS-related RNA-binding protein, is predominantly nuclear-localized, and FUS knock-in or mutant models exhibit motor impairment and spinal motor neuron loss [4,14]. Consistent with these reports, our TIA1Δ mice showed impaired motor function, muscle atrophy, and motor neuron loss (Figure 2, Figure 4 and Figure 5), reinforcing the utility of this model for studying ALS-related motor pathology. Importantly, we directly detected no significant changes in the total protein levels of core SG components such as G3BP1 and FUS; this is our direct experimental observation. However, this lack of change in core SG component abundance does not exclude the possibility of functional deficits in SG assembly, stability, or disassembly, which remains a hypothesis rather than a demonstrated finding. Mounting evidence suggests that subtle, non-quantitative perturbations in SG dynamics, even without overt changes in the core component abundance, can drive pathological phase separation and the mislocalization of cytoplasmic proteins [34,37,38]. Notably, as no direct assessment of SG dynamics was performed in vivo, conclusions regarding potential alterations in SG function remain speculative, consistent with the technical challenges associated with detecting stress granules in tissue.
TDP-43 pathology, including cytoplasmic mislocalization, aggregation, and phosphorylation (pTDP-43), is a defining feature of most ALS cases. In TIA1Δ mice, we observed age-dependent upregulation and cytoplasmic mislocalization of TDP-43 in spinal motor neurons at 12 months, but no detectable pTDP-43. This partial TDP-43 profile raises important questions about the ALS pathogenic stage modeled by TIA1Δ mice. We propose it may represent a phosphorylation-independent, early TDP-43-associated state, which could be a pre-aggregation-like disease stage with speculative relevance to early human ALS pathogenesis, rather than a well-defined pre-aggregation disease stage. Possible explanations include an early pathological phase where TDP-43 mislocalization precedes phosphorylation, or a mechanistically distinct form of TDP-43 dysfunction driven by TIA1 perturbation. Additionally, we did not assess soluble versus insoluble TDP-43 fractions, which is important in determining whether TIA1 dysfunction promotes aggregation-prone TDP-43 species, even in the absence of phosphorylation. The temporal discrepancy between motor neuron loss (present at 3 months) and TDP-43 alterations (observed at 12 months) distinguishes this model from classical ALS, where TDP-43 pathology typically precedes neuronal death. This pattern suggests that TIA1-mediated neurodegeneration may occur through TDP-43-independent pathways during early stages, with TDP-43 dysfunction contributing to late pathology.
A notable observation in this study is that pathological changes are not globally non-progressive, but instead exhibit compartment-specific and temporally uncoupled progression between 3 and 12 months of age. Specifically, motor neuron loss is detectable as early as 3 months, whereas TDP-43 mislocalization and NMJ denervation emerge much later at 12 months, while behavioral deficits do not show clear age-dependent worsening. This pattern suggests independent, region-specific pathological timelines rather than a synchronous, globally degenerative phenotype. Although early-onset pathological changes remain relatively stable in adulthood, this does not equate to a complete lack of progression. Instead, the model displays distinct temporal cascades across the central nervous system, peripheral nerve, and muscle compartments. Additionally, while peripheral organs showed no gross morphological abnormalities, functional assessments were not performed; thus, subtle functional deficits cannot be excluded. Given the widespread expression of TIA1 and its key roles in RNA metabolism and stress responses, mild physiological changes may exist despite normal histology. Future studies using targeted functional assays are needed to evaluate peripheral organ function in TIA1Δ mice. Although we observed both behavioral deficits and pathological alterations in TIA1Δ mice, the present study remains fully agnostic regarding whether these phenotypes arise primarily from loss of TIA1 function or a gain-of-toxicity mechanism related to the mutant protein, or developmental effects caused by constitutive TIA1 reduction. The mutant allele produces an altered protein rather than a clean null, so reduced TIA1 protein levels alone do not provide sufficient evidence for a definitive loss-of-function mechanism, which remains at most a speculative working model. Definitive mechanistic validation will require further investigation.
Our study established that TIA1 dysfunction in mice recapitulates ALS-like myopathy [39,40], including elevated CK levels (Figure 4D), reduced individual muscle fiber area (Figure 4E,F), and NMJ denervation (Figure 4G) in 3- and 12-month-old TIA1Δ mice. Elevated CK is a hallmark of ALS, reflecting motor neuron damage and its subsequent effects on downstream skeletal muscle [41,42,43]. In TIA1Δ mice, CK levels were significantly increased at 3 months but decreased at 12 months. This transient elevation may resemble early-stage muscle damage in sporadic ALS [44], while subsequent decreases could reflect end-stage muscle atrophy or compensatory adaptations. We acknowledge that non-neuronal factors, including muscle energy metabolism of muscle and physical activity, may influence elevated serum CK [26,42,45,46]. Cellular mechanisms suggest that CK may be upregulated as a response to metabolic stress in ALS [26], supporting its value for diagnosis and monitoring. However, despite the established association between TIA1 mutations and primary myopathies, we cannot rule out muscle-intrinsic mechanisms contributing to CK elevation and muscle pathology. Notably, our data showed pronounced NMJ denervation in 12-month-old TIA1Δ mice (Figure 4), suggesting delayed distal motor unit involvement that may partially reconcile the non-progressive core pathology with late-onset peripheral changes. Quantitative analysis of NMJ denervation at 12 months is limited to qualitative observation due to technical constraints, representing a methodological limitation. This dual mechanism (motor neuron-dependent and muscle-intrinsic) highlights the complexity of TIA1-associated disease and the need for integrated analyses of both central and peripheral components.
Furthermore, TIA1Δ mice exhibited robust activation of both microglia and astrocytes, indicating neuroinflammation, a key hallmark of ALS closely associated with motor neuron damage [47]. Microglia, the resident immune cells of the central nervous system, monitor the neural microenvironment and initiate inflammatory responses to injury or pathology [48,49]. Microglia become activated and involved in an inflammatory response upon detecting injury or pathological conditions [50]. Excessive or prolonged activation of microglia can exacerbate neuroinflammation and accelerate neuronal damage [48,51]. Astrocytes play a crucial role in maintaining neural homeostasis, regulating neuronal metabolism, and promoting the release of neurotrophic factors [52]. Astrocytes proliferate in response to neuron damage or death and may secrete pro-inflammatory or anti-inflammatory factors to repair the damage. Our study demonstrated increased numbers of Iba1-positive microglia and GFAP-positive astrocytes in TIA1Δ mice (Figure 5). However, excessive activation of glial cells can lead to chronic inflammation, shifting from a protective to a detrimental state and thereby exacerbating neuronal injury. The sustained upregulation of TNF-α/iNOS and downregulation of Arg1 in TIA1Δ mice demonstrates a chronic pro-inflammatory shift, polarizing microglia toward a neurotoxic M1-like state and suppressing reparative M2-like functions. This inflammatory profile mirrors key mechanisms driving motor neuron degeneration in human ALS. It should be noted that glial cell counts and marker expression alone do not fully define the functional state of glial cells, which represents a conceptual limitation of the present analysis.
Several limitations of this study should be acknowledged. First, the use of a homozygous triple-mutant TIA1 model represents an artificial amplification of the genetic defect seen in human patients. This non-physiological design was used to clearly define the pathogenic capacity of TIA1 mutations and to mitigate the risk of subtle phenotypes. Second, the sample size was limited, and we did not formally assess parametric assumptions (normality, homogeneity of variance) or apply multiple-comparison corrections, which may affect statistical robustness. FDR correction was applied within related families to control type I error. Third, quantitative NMJ analysis was performed only at the 3 months; although qualitative observations suggested severe denervation at 12 months, the lack of quantitative data limits temporal analysis of degenerative progression. Fourth, we pooled male and female mice without sex-stratified analysis due to limited sample size, restricting conclusions about sex differences in ALS-related phenotypes. A potential limitation is that males and females were combined; sex differences in ALS-related phenotypes warrant separate analysis in future studies with larger cohorts. In addition, it should be noted that glial cell counts and marker expression alone do not fully define the functional state of glial cells, which represents a conceptual limitation of the present analysis.
Accordingly, while our model demonstrates that TIA1 dysfunction is sufficient to drive core ALS-like pathological features, it may not fully recapitulate the slow progression or complex etiology of human ALS. The main translational value of this work lies in identifying the core cellular pathways disrupted by TIA1, which should be validated in the future using patient-derived cells or heterozygous animal models. Future studies should clarify the precise role of TIA1 in motor neuron disease and evaluate whether targeting TIA1 expression or function can modify disease progression. It will also be important to replicate pathologies associated with ALS in human-induced pluripotent stem cell-derived motor neurons or patient-derived cell models.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/cells15050420/s1. Figure S1: Tail suspension test of TIA1Δ and WT mice. Video S1: No difference in NMJs of 3-month-old WT and TIA1Δ mice’s gastrocnemius muscle.

Author Contributions

L.-H.M., L.Y. and J.-Y.L. designed the study. L.-H.M. and L.Y. conceived and wrote the paper. Y.-N.S. contributed to the animal model. L.-H.M., J.-Q.Z., Y.-T.S., N.Y., Z.-L.W., W.-X.Z., Y.-R.Z. and X.-Y.G. performed the acquisition of data. L.-H.M. and L.Y. interpreted the results. J.-Y.L. conceived and edited the manuscript. All authors have read and agreed to the published version of the manuscript.

Funding

This work was supported by the National Natural Science Foundation (82201594) and the Natural Science Foundation of Liaoning Province (2022-MS-228). Acknowledgments are also due for the support of the Swedish Research Council (2023-02216), the Strong Research Environment MultiPark (Multidisciplinary research on Parkinson’s disease), Parkinsonfonden (1494/2023), the Brain Foundation (FO2023-0397), the Natural Science Foundation of Jilin Province of China (20230101154JC), and the Science and Technology Funding Project to support the high-quality development of China Medical University (No.2023JH2/20200104).

Institutional Review Board Statement

All experiments involving mice were approved by the Ethics Committee of China Medical University, approval number CMU2023643, approval date 20 March 2023.

Informed Consent Statement

Not applicable.

Data Availability Statement

The original contributions presented in this study are included in the article/Supplementary Materials. Further inquiries can be directed to the corresponding authors.

Acknowledgments

The authors thank Ge Bai and Si-Han Chen from Zhejiang University for their invaluable assistance with NMJ staining experiments. In drafting this work, the authors utilized DeepSeek (web version) for language refinement. All content was subsequently reviewed and revised by the authors, who are ultimately responsible for the published material.

Conflicts of Interest

The authors declare no conflicts of interest.

Abbreviations

ALSAmyotrophic lateral sclerosis
C9ORF72Chromosome 9 Open Reading Frame 72
CPKCreatine phosphokinase
CBEsCytosine base editors
FUSFused-in-Sarcoma
LCDLow-complexity domain
LLPSLiquid–liquid phase separation
RRMsRNA recognition motifs
SOD1Superoxide dismutase 1
TDP-43TAR DNA-binding protein 43

References

  1. Al-Chalabi, A.; Hardiman, O. The epidemiology of ALS: A conspiracy of genes, environment and time. Nat. Rev. Neurol. 2013, 9, 617–628. [Google Scholar] [CrossRef]
  2. Mackenzie, I.R.; Rademakers, R.; Neumann, M. TDP-43 and FUS in amyotrophic lateral sclerosis and frontotemporal dementia. Lancet Neurol. 2010, 9, 995–1007. [Google Scholar] [CrossRef]
  3. Suk, T.R.; Rousseaux, M.W.C. The role of TDP-43 mislocalization in amyotrophic lateral sclerosis. Mol. Neurodegener. 2020, 15, 45. [Google Scholar] [CrossRef]
  4. Korobeynikov, V.A.; Lyashchenko, A.K.; Blanco-Redondo, B.; Jafar-Nejad, P.; Shneider, N.A. Antisense oligonucleotide silencing of FUS expression as a therapeutic approach in amyotrophic lateral sclerosis. Nat. Med. 2022, 28, 104–116. [Google Scholar] [CrossRef] [PubMed]
  5. Prasad, A.; Bharathi, V.; Sivalingam, V.; Girdhar, A.; Patel, B.K. Molecular Mechanisms of TDP-43 Misfolding and Pathology in Amyotrophic Lateral Sclerosis. Front. Mol. Neurosci. 2019, 12, 25. [Google Scholar] [CrossRef]
  6. Ilieva, H.; Vullaganti, M.; Kwan, J. Advances in molecular pathology, diagnosis, and treatment of amyotrophic lateral sclerosis. BMJ 2023, 383, e075037. [Google Scholar] [CrossRef] [PubMed]
  7. Zou, Z.Y.; Zhou, Z.R.; Che, C.H.; Liu, C.Y.; He, R.L.; Huang, H.P. Genetic epidemiology of amyotrophic lateral sclerosis: A systematic review and meta-analysis. J. Neurol. Neurosurg. Psychiatry 2017, 88, 540–549. [Google Scholar] [CrossRef]
  8. Abati, E.; Bresolin, N.; Comi, G.; Corti, S. Silence superoxide dismutase 1 (SOD1): A promising therapeutic target for amyotrophic lateral sclerosis (ALS). Expert Opin. Ther. Targets 2020, 24, 295–310. [Google Scholar] [CrossRef] [PubMed]
  9. McMillan, M.; Gomez, N.; Hsieh, C.; Bekier, M.; Li, X.; Miguez, R.; Tank, E.M.H.; Barmada, S.J. RNA methylation influences TDP43 binding and disease pathogenesis in models of amyotrophic lateral sclerosis and frontotemporal dementia. Mol. Cell 2023, 83, 219–236.e217. [Google Scholar] [CrossRef]
  10. Balendra, R.; Isaacs, A.M. C9orf72-mediated ALS and FTD: Multiple pathways to disease. Nat. Rev. Neurol. 2018, 14, 544–558. [Google Scholar] [CrossRef]
  11. Hirsch-Reinshagen, V.; Pottier, C.; Nicholson, A.M.; Baker, M.; Hsiung, G.R.; Krieger, C.; Sengdy, P.; Boylan, K.B.; Dickson, D.W.; Mesulam, M.; et al. Clinical and neuropathological features of ALS/FTD with TIA1 mutations. Acta Neuropathol. Commun. 2017, 5, 96. [Google Scholar] [CrossRef]
  12. Fernández-Gómez, A.; Izquierdo, J.M. The Multifunctional Faces of T-Cell Intracellular Antigen 1 in Health and Disease. Int. J. Mol. Sci. 2022, 23, 1400. [Google Scholar] [CrossRef] [PubMed]
  13. Mackenzie, I.R.; Nicholson, A.M.; Sarkar, M.; Messing, J.; Purice, M.D.; Pottier, C.; Annu, K.; Baker, M.; Perkerson, R.B.; Kurti, A.; et al. TIA1 Mutations in Amyotrophic Lateral Sclerosis and Frontotemporal Dementia Promote Phase Separation and Alter Stress Granule Dynamics. Neuron 2017, 95, 808–816.e809. [Google Scholar] [CrossRef]
  14. Zhang, X.; Wang, F.; Hu, Y.; Chen, R.; Meng, D.; Guo, L.; Lv, H.; Guan, J.; Jia, Y. In vivo stress granule misprocessing evidenced in a FUS knock-in ALS mouse model. Brain 2020, 143, 1350–1367. [Google Scholar] [CrossRef] [PubMed]
  15. Ash, P.E.A.; Lei, S.; Shattuck, J.; Boudeau, S.; Carlomagno, Y.; Medalla, M.; Mashimo, B.L.; Socorro, G.; Al-Mohanna, L.F.A.; Jiang, L.; et al. TIA1 potentiates tau phase separation and promotes generation of toxic oligomeric tau. Proc. Natl. Acad. Sci. USA 2021, 118, e2014188118. [Google Scholar] [CrossRef] [PubMed]
  16. Sekiyama, N.; Takaba, K.; Maki-Yonekura, S.; Akagi, K.I.; Ohtani, Y.; Imamura, K.; Terakawa, T.; Yamashita, K.; Inaoka, D.; Yonekura, K.; et al. ALS mutations in the TIA-1 prion-like domain trigger highly condensed pathogenic structures. Proc. Natl. Acad. Sci. USA 2022, 119, e2122523119. [Google Scholar] [CrossRef]
  17. Schweingruber, C.; Hedlund, E. The Cell Autonomous and Non-Cell Autonomous Aspects of Neuronal Vulnerability and Resilience in Amyotrophic Lateral Sclerosis. Biology 2022, 11, 1191. [Google Scholar] [CrossRef]
  18. Birsa, N.; Bentham, M.P.; Fratta, P. Cytoplasmic functions of TDP-43 and FUS and their role in ALS. Semin. Cell Dev. Biol. 2020, 99, 193–201. [Google Scholar] [CrossRef] [PubMed]
  19. Liao, Y.Z.; Ma, J.; Dou, J.Z. The Role of TDP-43 in Neurodegenerative Disease. Mol. Neurobiol. 2022, 59, 4223–4241. [Google Scholar] [CrossRef]
  20. Chou, C.C.; Zhang, Y.; Umoh, M.E.; Vaughan, S.W.; Lorenzini, I.; Liu, F.; Sayegh, M.; Donlin-Asp, P.G.; Chen, Y.H.; Duong, D.M.; et al. TDP-43 pathology disrupts nuclear pore complexes and nucleocytoplasmic transport in ALS/FTD. Nat. Neurosci. 2018, 21, 228–239. [Google Scholar] [CrossRef]
  21. Szewczyk, B.; Günther, R.; Japtok, J.; Frech, M.J.; Naumann, M.; Lee, H.O.; Hermann, A. FUS ALS neurons activate major stress pathways and reduce translation as an early protective mechanism against neurodegeneration. Cell Rep. 2023, 42, 112025. [Google Scholar] [CrossRef]
  22. Yang, C.; Wang, Z.; Kang, Y.; Yi, Q.; Wang, T.; Bai, Y.; Liu, Y. Stress granule homeostasis is modulated by TRIM21-mediated ubiquitination of G3BP1 and autophagy-dependent elimination of stress granules. Autophagy 2023, 19, 1934–1951. [Google Scholar] [CrossRef]
  23. Osaki, T.; Uzel, S.G.M.; Kamm, R.D. Microphysiological 3D model of amyotrophic lateral sclerosis (ALS) from human iPS-derived muscle cells and optogenetic motor neurons. Sci. Adv. 2018, 4, eaat5847. [Google Scholar] [CrossRef] [PubMed]
  24. Maniatis, S.; Äijö, T.; Vickovic, S.; Braine, C.; Kang, K.; Mollbrink, A.; Fagegaltier, D.; Andrusivová, Ž.; Saarenpää, S.; Saiz-Castro, G.; et al. Spatiotemporal dynamics of molecular pathology in amyotrophic lateral sclerosis. Science 2019, 364, 89–93. [Google Scholar] [CrossRef]
  25. Felice, K.J.; North, W.A. Creatine kinase values in amyotrophic lateral sclerosis. J. Neurol. Sci. 1998, 160, S30–S32. [Google Scholar] [CrossRef] [PubMed]
  26. Rafiq, M.K.; Lee, E.; Bradburn, M.; McDermott, C.J.; Shaw, P.J. Creatine kinase enzyme level correlates positively with serum creatinine and lean body mass, and is a prognostic factor for survival in amyotrophic lateral sclerosis. Eur. J. Neurol. 2016, 23, 1071–1078. [Google Scholar] [CrossRef]
  27. Tai, H.; Cui, L.; Guan, Y.; Liu, M.; Li, X.; Shen, D.; Li, D.; Cui, B.; Fang, J.; Ding, Q.; et al. Correlation of Creatine Kinase Levels with Clinical Features and Survival in Amyotrophic Lateral Sclerosis. Front. Neurol. 2017, 8, 322. [Google Scholar] [CrossRef] [PubMed]
  28. Almer, G.; Teismann, P.; Stevic, Z.; Halaschek-Wiener, J.; Deecke, L.; Kostic, V.; Przedborski, S. Increased levels of the pro-inflammatory prostaglandin PGE2 in CSF from ALS patients. Neurology 2002, 58, 1277–1279. [Google Scholar] [CrossRef]
  29. Sharma, A.; Lyashchenko, A.K.; Lu, L.; Nasrabady, S.E.; Elmaleh, M.; Mendelsohn, M.; Nemes, A.; Tapia, J.C.; Mentis, G.Z.; Shneider, N.A. ALS-associated mutant FUS induces selective motor neuron degeneration through toxic gain of function. Nat. Commun. 2016, 7, 10465. [Google Scholar] [CrossRef]
  30. Liguori, F.; Amadio, S.; Volonté, C. Where and Why Modeling Amyotrophic Lateral Sclerosis. Int. J. Mol. Sci. 2021, 22, 3977. [Google Scholar] [CrossRef]
  31. McCampbell, A.; Cole, T.; Wegener, A.J.; Tomassy, G.S.; Setnicka, A.; Farley, B.J.; Schoch, K.M.; Hoye, M.L.; Shabsovich, M.; Sun, L.; et al. Antisense oligonucleotides extend survival and reverse decrement in muscle response in ALS models. J. Clin. Investig. 2018, 128, 3558–3567. [Google Scholar] [CrossRef] [PubMed]
  32. Erdi-Krausz, G.; Shaw, P.J. Antisense oligonucleotide therapy in amyotrophic lateral sclerosis. Curr. Opin. Neurol. 2025, 38, 574–580. [Google Scholar] [CrossRef] [PubMed]
  33. Baradaran-Heravi, Y.; Dillen, L.; Nguyen, H.P.; Van Mossevelde, S.; Baets, J.; De Jonghe, P.; Engelborghs, S.; De Deyn, P.P.; Vandenbulcke, M.; Vandenberghe, R.; et al. No supportive evidence for TIA1 gene mutations in a European cohort of ALS-FTD spectrum patients. Neurobiol. Aging 2018, 69, 293.e299–293.e211. [Google Scholar] [CrossRef]
  34. Masi, M.; Attanzio, A.; Racchi, M.; Wolozin, B.; Borella, S.; Biundo, F.; Buoso, E. Proteostasis Deregulation in Neurodegeneration and Its Link with Stress Granules: Focus on the Scaffold and Ribosomal Protein RACK1. Cells 2022, 11, 2590. [Google Scholar] [CrossRef]
  35. Jiang, L.; Ash, P.E.A.; Maziuk, B.F.; Ballance, H.I.; Boudeau, S.; Abdullatif, A.A.; Orlando, M.; Petrucelli, L.; Ikezu, T.; Wolozin, B. TIA1 regulates the generation and response to toxic tau oligomers. Acta Neuropathol. 2019, 137, 259–277. [Google Scholar] [CrossRef] [PubMed]
  36. Baradaran-Heravi, Y.; Van Broeckhoven, C.; van der Zee, J. Stress granule mediated protein aggregation and underlying gene defects in the FTD-ALS spectrum. Neurobiol. Dis. 2020, 134, 104639. [Google Scholar] [CrossRef]
  37. Wolozin, B.; Ivanov, P. Stress granules and neurodegeneration. Nat. Rev. Neurosci. 2019, 20, 649–666. [Google Scholar] [CrossRef]
  38. Thomas, M.G.; Loschi, M.; Desbats, M.A.; Boccaccio, G.L. RNA granules: The good, the bad and the ugly. Cell. Signal. 2011, 23, 324–334. [Google Scholar] [CrossRef]
  39. Niu, Z.; Pontifex, C.S.; Berini, S.; Hamilton, L.E.; Naddaf, E.; Wieben, E.; Aleff, R.A.; Martens, K.; Gruber, A.; Engel, A.G.; et al. Myopathy With SQSTM1 and TIA1 Variants: Clinical and Pathological Features. Front. Neurol. 2018, 9, 147. [Google Scholar] [CrossRef]
  40. Panos-Basterra, P.; Theuriet, J.; Nadaj-Pakleza, A.; Magot, A.; Lannes, B.; Marcorelles, P.; Behin, A.; Masingue, M.; Caillon, F.; Malek, Y.; et al. Defining the landscape of TIA1 and SQSTM1 digenic myopathy. Neuromuscul. Disord. 2024, 42, 43–52. [Google Scholar] [CrossRef]
  41. Bekkelund, S.I. Leisure physical exercise and creatine kinase activity. The Tromsø study. Scand. J. Med. Sci. Sports 2020, 30, 2437–2444. [Google Scholar] [CrossRef]
  42. Clarke, W.T.; Peterzan, M.A.; Rayner, J.J.; Sayeed, R.A.; Petrou, M.; Krasopoulos, G.; Lake, H.A.; Raman, B.; Watson, W.D.; Cox, P.; et al. Localized rest and stress human cardiac creatine kinase reaction kinetics at 3 T. NMR Biomed. 2019, 32, e4085. [Google Scholar] [CrossRef] [PubMed]
  43. Lima, A.F.; Evangelista, T.; de Carvalho, M. Increased creatine kinase and spontaneous activity on electromyography, in amyotrophic lateral sclerosis. Electromyogr. Clin. Neurophysiol. 2003, 43, 189–192. [Google Scholar]
  44. Ito, D.; Hashizume, A.; Hijikata, Y.; Yamada, S.; Iguchi, Y.; Iida, M.; Kishimoto, Y.; Moriyoshi, H.; Hirakawa, A.; Katsuno, M. Elevated serum creatine kinase in the early stage of sporadic amyotrophic lateral sclerosis. J. Neurol. 2019, 266, 2952–2961. [Google Scholar] [CrossRef]
  45. Wyss, M.; Kaddurah-Daouk, R. Creatine and creatinine metabolism. Physiol. Rev. 2000, 80, 1107–1213. [Google Scholar] [CrossRef]
  46. Kim, J.; Kwan, M.P. Beyond Commuting: Ignoring Individuals’ Activity-Travel Patterns May Lead to Inaccurate Assessments of Their Exposure to Traffic Congestion. Int. J. Environ. Res. Public Health 2018, 16, 89. [Google Scholar] [CrossRef]
  47. Seredenina, T.; Nayernia, Z.; Sorce, S.; Maghzal, G.J.; Filippova, A.; Ling, S.C.; Basset, O.; Plastre, O.; Daali, Y.; Rushing, E.J.; et al. Evaluation of NADPH oxidases as drug targets in a mouse model of familial amyotrophic lateral sclerosis. Free Radic. Biol. Med. 2016, 97, 95–108. [Google Scholar] [CrossRef] [PubMed]
  48. Kwon, H.S.; Koh, S.H. Neuroinflammation in neurodegenerative disorders: The roles of microglia and astrocytes. Transl. Neurodegener. 2020, 9, 42. [Google Scholar] [CrossRef]
  49. Liddelow, S.A.; Marsh, S.E.; Stevens, B. Microglia and Astrocytes in Disease: Dynamic Duo or Partners in Crime? Trends Immunol. 2020, 41, 820–835. [Google Scholar] [CrossRef] [PubMed]
  50. Geloso, M.C.; Zupo, L.; Corvino, V. Crosstalk between peripheral inflammation and brain: Focus on the responses of microglia and astrocytes to peripheral challenge. Neurochem. Int. 2024, 180, 105872. [Google Scholar] [CrossRef]
  51. Lopez-Ortiz, A.O.; Eyo, U.B. Astrocytes and microglia in the coordination of CNS development and homeostasis. J. Neurochem. 2024, 168, 3599–3614. [Google Scholar] [CrossRef] [PubMed]
  52. Ortega, A.; Martínez-Nuncio, L.A.; Taddei, E.; Castañeda, E.; Rubio, C.; Rubio-Osornio, M. ASTROGLIA: Molecular Mechanisms, Functional Roles, and Neurophysiological Implications in the Central Nervous System. Life 2025, 15, 1505. [Google Scholar] [CrossRef] [PubMed]
Cells 15 00420 g001
Figure 1. TIA1 expression was reduced in specific brain regions and the spinal cord of TIA1Δ mice. (A). The genome structure of mouse Tia1. The underlined sequences corresponded to gRNA sequences. (B). PCR products of WT and TIA1Δ mice were sequenced. (C). Representative images of TIA1 immunohistochemical staining of the olfactory bulb (a–d), cortex (e–h), striatum (i–l), hippocampus (m–p), and substantia nigra (q–t) in 3-month-old WT and TIA1Δ mice. Scale bar: 100 µm (a, c, e, g, i, k, m, o, q, s). Scale bars: 50 µm (b, d, f, h, j, l, n, p, r, t). D-H. Quantification of TIA1 expression in the olfactory bulb (D), cortex (E), striatum (F), hippocampus (G), and substantia nigra (H) in 3-month-old WT and TIA1Δ mice. n = 3, ns: no significance; olfactory bulb (p = 0.0007), cortex (p = 0.0437), striatum (p = 0.0118), hippocampus (p = 0.0006), and substantia nigra (p = 0.6946). (I). Representative WB image of TIA1 in the cortex and striatum in 3-month-old WT and TIA1Δ mice. (J,K). Quantification of TIA1 protein levels in the cortex and striatum in 3-month-old WT and TIA1Δ mice. n = 3, cortex (p = 0.0478) and striatum (p = 0.006). (L). Representative images of TIA1 immunohistochemical staining of the lumbar spinal cord in 3-month-old WT and TIA1Δ mice. Scale bars: 100 µm. (M). Quantification of TIA1 expression of the lumbar spinal cord in 3-month-old WT and TIA1Δ mice. n = 3, p = 0.0058. (N–S). Quantification of TIA1 mRNA levels in the olfactory bulb (N), cortex (O), striatum (P), hippocampus (Q), substantia nigra (R), and lumbar spinal cord in 3-month-old WT and TIA1Δ mice. n = 3, olfactory bulb (p < 0.0001), cortex (p = 0.0017), striatum (p < 0.0001), hippocampus (p < 0.0001), substantia nigra (p = 0.9436) ns: no significance. *p < 0.05, ** p < 0.01, *** p < 0.001, **** p < 0.0001.
Figure 1. TIA1 expression was reduced in specific brain regions and the spinal cord of TIA1Δ mice. (A). The genome structure of mouse Tia1. The underlined sequences corresponded to gRNA sequences. (B). PCR products of WT and TIA1Δ mice were sequenced. (C). Representative images of TIA1 immunohistochemical staining of the olfactory bulb (a–d), cortex (e–h), striatum (i–l), hippocampus (m–p), and substantia nigra (q–t) in 3-month-old WT and TIA1Δ mice. Scale bar: 100 µm (a, c, e, g, i, k, m, o, q, s). Scale bars: 50 µm (b, d, f, h, j, l, n, p, r, t). D-H. Quantification of TIA1 expression in the olfactory bulb (D), cortex (E), striatum (F), hippocampus (G), and substantia nigra (H) in 3-month-old WT and TIA1Δ mice. n = 3, ns: no significance; olfactory bulb (p = 0.0007), cortex (p = 0.0437), striatum (p = 0.0118), hippocampus (p = 0.0006), and substantia nigra (p = 0.6946). (I). Representative WB image of TIA1 in the cortex and striatum in 3-month-old WT and TIA1Δ mice. (J,K). Quantification of TIA1 protein levels in the cortex and striatum in 3-month-old WT and TIA1Δ mice. n = 3, cortex (p = 0.0478) and striatum (p = 0.006). (L). Representative images of TIA1 immunohistochemical staining of the lumbar spinal cord in 3-month-old WT and TIA1Δ mice. Scale bars: 100 µm. (M). Quantification of TIA1 expression of the lumbar spinal cord in 3-month-old WT and TIA1Δ mice. n = 3, p = 0.0058. (N–S). Quantification of TIA1 mRNA levels in the olfactory bulb (N), cortex (O), striatum (P), hippocampus (Q), substantia nigra (R), and lumbar spinal cord in 3-month-old WT and TIA1Δ mice. n = 3, olfactory bulb (p < 0.0001), cortex (p = 0.0017), striatum (p < 0.0001), hippocampus (p < 0.0001), substantia nigra (p = 0.9436) ns: no significance. *p < 0.05, ** p < 0.01, *** p < 0.001, **** p < 0.0001.
Cells 15 00420 g001
Cells 15 00420 g002
Figure 2. Impaired motor ability in the TIA1Δ mice. (A). Open-field test in 3- and 12-month-old WT and TIA1Δ mice. Red boxes show the total area, and blue boxes denote the center area. 3M: 3 months old; 12M: 12 months old. (B–E). Total movement distance (B), mean speed (C), and time spent in the outer zone (surrounding area) (D) and in the inner zone (central area) (E) in the open-field test. n = 6–8, B-3M: WT vs. 3M TIA1Δ: p = 0.0003; 12M: WT vs. 12M TIA1Δ: p = 0.0289; C-3M: WT vs. 3M TIA1Δ: p = 0.0003; 12M: WT vs. 12M TIA1Δ: p = 0.0228, D-3M: WT vs. 3M TIA1Δ: p = 0.0008; E-3M: WT vs. 3M TIA1Δ: p = 0.0008. (F,G). Rotarod tests in 3- and 12-month-old WT and TIA1Δ mice for latency (F) and speed (G) were recorded. n = 6–8, F-3M: WT vs. 3M TIA1Δ: p = 0.0087; 12M: WT vs. 12M TIA1Δ: p < 0.0001; G-3M: WT vs. 3M TIA1Δ: p = 0.0109; 12M: WT vs. 12M TIA1Δ: p < 0.0001. (H). Body weight of 3- and 12-month-old WT and TIA1Δ mice. n = 6–8, p > 0.05. (I). Characterization of mouse body surface in 3-month-old WT and TIA1Δ mice. (J). Representative images show the spleen of 3-month-old WT and TIA1Δ mice. (K). Quantification of the spleen length of 3-month-old WT and TIA1Δ mice. n = 4–5, p = 0.0037. (L–Q). The representative images show the other tissues of 3-month-old WT and TIA1Δ mice, including the lung, kidney, quadriceps muscle, liver, gastrocnemius muscle, and heart. 12M: 12 months old. * p < 0.05, ** p < 0.01, *** p < 0.001, **** p < 0.0001.
Figure 2. Impaired motor ability in the TIA1Δ mice. (A). Open-field test in 3- and 12-month-old WT and TIA1Δ mice. Red boxes show the total area, and blue boxes denote the center area. 3M: 3 months old; 12M: 12 months old. (B–E). Total movement distance (B), mean speed (C), and time spent in the outer zone (surrounding area) (D) and in the inner zone (central area) (E) in the open-field test. n = 6–8, B-3M: WT vs. 3M TIA1Δ: p = 0.0003; 12M: WT vs. 12M TIA1Δ: p = 0.0289; C-3M: WT vs. 3M TIA1Δ: p = 0.0003; 12M: WT vs. 12M TIA1Δ: p = 0.0228, D-3M: WT vs. 3M TIA1Δ: p = 0.0008; E-3M: WT vs. 3M TIA1Δ: p = 0.0008. (F,G). Rotarod tests in 3- and 12-month-old WT and TIA1Δ mice for latency (F) and speed (G) were recorded. n = 6–8, F-3M: WT vs. 3M TIA1Δ: p = 0.0087; 12M: WT vs. 12M TIA1Δ: p < 0.0001; G-3M: WT vs. 3M TIA1Δ: p = 0.0109; 12M: WT vs. 12M TIA1Δ: p < 0.0001. (H). Body weight of 3- and 12-month-old WT and TIA1Δ mice. n = 6–8, p > 0.05. (I). Characterization of mouse body surface in 3-month-old WT and TIA1Δ mice. (J). Representative images show the spleen of 3-month-old WT and TIA1Δ mice. (K). Quantification of the spleen length of 3-month-old WT and TIA1Δ mice. n = 4–5, p = 0.0037. (L–Q). The representative images show the other tissues of 3-month-old WT and TIA1Δ mice, including the lung, kidney, quadriceps muscle, liver, gastrocnemius muscle, and heart. 12M: 12 months old. * p < 0.05, ** p < 0.01, *** p < 0.001, **** p < 0.0001.
Cells 15 00420 g002
Cells 15 00420 g003
Figure 3. Increased TDP-43 levels in the cortex and spinal cord of TIA1Δ mice. (A). Representative images of TDP-43 immunohistochemical staining of cortex in 3- and 12-month-old WT and TIA1Δ mice. Scale bars: 100 μm (upper panel), 50 μm (lower panel). (B). Quantification for TDP-43 of cortex in 3- and 12-month-old WT and TIA1Δ mice. n = 3–5, 12M: WT vs. 12M TIA1Δ: p = 0.0321. (C). Representative WB image of TDP-43 in the cortex. (D). Quantification of TDP-43 protein levels in the cortex. n = 3, 3M TIA1Δ vs. 12M TIA1Δ: p = 0.0134; 12M: WT vs. 12M TIA1Δ: p = 0.0161. (E). Representative images of TDP-43 immunohistochemical staining of the anterior horn of the lumbar spinal cord in 3- and 12-month-old WT and TIA1Δ mice. Scale bar: 100 μm. (F). Quantification of TDP-43 in the anterior horn of lumbar spinal cord in 3- and 12-month-old WT and TIA1Δ mice. n = 3–5, 3M TIA1Δ vs. 12M TIA1Δ: p = 0.0187; 12M: WT vs. 12M TIA1Δ: p = 0.0027. (G). Representative WB image of TDP-43 in the lumbar segments. (H). Quantification of TDP-43 protein levels in the lumbar segments. n = 3, 3M TIA1Δ vs. 12M TIA1Δ: p = 0.0100; 12M: WT vs. 12M TIA1Δ: p = 0.0023. (I,J). Representative WB image of p-TDP-43 protein levels in the 3- and 12-month-old WT and TIA1Δ mice cortex and lumbar spinal cords. (K). Representative WB image of FUS and G3BP1 in the 3- and 12-month-old WT and TIA1Δ mice cortex. (L,M). Quantification of G3BP1 and FUS protein levels in the cortex of 3- and 12-month-old WT and TIA1Δ mice. n = 3, NS: no difference. (N). Representative WB image of FUS and G3BP1 in the 3- and 12-month-old WT and TIA1Δ mice lumbar spinal cords. (O,P). Quantification of G3BP1 and FUS protein levels in the cortex of 3- and 12-month-old WT and TIA1Δ mice. n = 3, NS: no difference, p > 0.05. (Q–T). Representative images of G3BP1 and FUS immunohistochemical staining of the anterior horn of the lumbar spinal cord and cortex in 3- and 12-month-old WT and TIA1Δ mice. Scale bar: 100 μm (lumbar spinal cord), Scale bar: 50 μm (lumbar spinal cord). * p < 0.05, ** p < 0.01.
Figure 3. Increased TDP-43 levels in the cortex and spinal cord of TIA1Δ mice. (A). Representative images of TDP-43 immunohistochemical staining of cortex in 3- and 12-month-old WT and TIA1Δ mice. Scale bars: 100 μm (upper panel), 50 μm (lower panel). (B). Quantification for TDP-43 of cortex in 3- and 12-month-old WT and TIA1Δ mice. n = 3–5, 12M: WT vs. 12M TIA1Δ: p = 0.0321. (C). Representative WB image of TDP-43 in the cortex. (D). Quantification of TDP-43 protein levels in the cortex. n = 3, 3M TIA1Δ vs. 12M TIA1Δ: p = 0.0134; 12M: WT vs. 12M TIA1Δ: p = 0.0161. (E). Representative images of TDP-43 immunohistochemical staining of the anterior horn of the lumbar spinal cord in 3- and 12-month-old WT and TIA1Δ mice. Scale bar: 100 μm. (F). Quantification of TDP-43 in the anterior horn of lumbar spinal cord in 3- and 12-month-old WT and TIA1Δ mice. n = 3–5, 3M TIA1Δ vs. 12M TIA1Δ: p = 0.0187; 12M: WT vs. 12M TIA1Δ: p = 0.0027. (G). Representative WB image of TDP-43 in the lumbar segments. (H). Quantification of TDP-43 protein levels in the lumbar segments. n = 3, 3M TIA1Δ vs. 12M TIA1Δ: p = 0.0100; 12M: WT vs. 12M TIA1Δ: p = 0.0023. (I,J). Representative WB image of p-TDP-43 protein levels in the 3- and 12-month-old WT and TIA1Δ mice cortex and lumbar spinal cords. (K). Representative WB image of FUS and G3BP1 in the 3- and 12-month-old WT and TIA1Δ mice cortex. (L,M). Quantification of G3BP1 and FUS protein levels in the cortex of 3- and 12-month-old WT and TIA1Δ mice. n = 3, NS: no difference. (N). Representative WB image of FUS and G3BP1 in the 3- and 12-month-old WT and TIA1Δ mice lumbar spinal cords. (O,P). Quantification of G3BP1 and FUS protein levels in the cortex of 3- and 12-month-old WT and TIA1Δ mice. n = 3, NS: no difference, p > 0.05. (Q–T). Representative images of G3BP1 and FUS immunohistochemical staining of the anterior horn of the lumbar spinal cord and cortex in 3- and 12-month-old WT and TIA1Δ mice. Scale bar: 100 μm (lumbar spinal cord), Scale bar: 50 μm (lumbar spinal cord). * p < 0.05, ** p < 0.01.
Cells 15 00420 g003
Cells 15 00420 g004
Figure 4. Motor neuron loss and muscle atrophy in TIA1Δ mice. (A). Representative images of ChAT immunofluorescence staining of motor neurons in the anterior horn of the lumbar spinal cord in 3- and 12-month-old WT and TIA1Δ mice. Scale bar: 100 μm. (B). Numbers of large ChAT-positive motor neurons (transverse cell diameter ≥ 30 μm) within the anterior horn of the lumbar spinal cord. n = 3–5, * p < 0.05, 3M: WT vs. 3M TIA1Δ: p = 0.0101; 12M: WT vs. 12M TIA1Δ: p = 0.0021. (C). Numbers of total ChAT-positive microglial cells in the anterior horn of the lumbar spinal cord. n = 3–5, 12M: WT vs. 12M TIA1Δ: p = 0.0155. (D). Quantification of creatine kinase (CK) in serum of 3- and 12-month-old WT and TIA1Δ mice. n = 5–7, 3M WT vs. 3M TIA1Δ: p = 0.0047; 12M WT vs. 12M TIA1Δ: p = 0.0171. (E). Hematoxylin and eosin staining and Masson staining of skeletal muscle in 3- and 12-month-old WT and TIA1Δ mice. Scale bar: 100 μm. Arrows indicate areas of increased connective tissue (fibrosis) and expanded interstitial space between muscle fibers. (F). Quantification of mean fiber area of muscle, n = 3, ns: no difference. (G). Representative images of NMJs in gastrocnemius muscle in 3- and 12-month-old WT and TIA1Δ mice. Scale bar: 100 μm. * p < 0.05, ** p < 0.01.
Figure 4. Motor neuron loss and muscle atrophy in TIA1Δ mice. (A). Representative images of ChAT immunofluorescence staining of motor neurons in the anterior horn of the lumbar spinal cord in 3- and 12-month-old WT and TIA1Δ mice. Scale bar: 100 μm. (B). Numbers of large ChAT-positive motor neurons (transverse cell diameter ≥ 30 μm) within the anterior horn of the lumbar spinal cord. n = 3–5, * p < 0.05, 3M: WT vs. 3M TIA1Δ: p = 0.0101; 12M: WT vs. 12M TIA1Δ: p = 0.0021. (C). Numbers of total ChAT-positive microglial cells in the anterior horn of the lumbar spinal cord. n = 3–5, 12M: WT vs. 12M TIA1Δ: p = 0.0155. (D). Quantification of creatine kinase (CK) in serum of 3- and 12-month-old WT and TIA1Δ mice. n = 5–7, 3M WT vs. 3M TIA1Δ: p = 0.0047; 12M WT vs. 12M TIA1Δ: p = 0.0171. (E). Hematoxylin and eosin staining and Masson staining of skeletal muscle in 3- and 12-month-old WT and TIA1Δ mice. Scale bar: 100 μm. Arrows indicate areas of increased connective tissue (fibrosis) and expanded interstitial space between muscle fibers. (F). Quantification of mean fiber area of muscle, n = 3, ns: no difference. (G). Representative images of NMJs in gastrocnemius muscle in 3- and 12-month-old WT and TIA1Δ mice. Scale bar: 100 μm. * p < 0.05, ** p < 0.01.
Cells 15 00420 g004
Cells 15 00420 g005
Figure 5. Gliosis in TIA1Δ mice. (A). Representative images of Iba1 immunohistochemical staining, showing microglial cells in the anterior horn of the lumbar spinal cord in 3- and 12-month-old WT and TIA1Δ mice. Scale bars: 100 μm. (B). Numbers of Iba1-positive microglial cells in the anterior horn of the lumbar spinal cord. n = 3–5, 3M WT vs. 3M TIA1Δ: p < 0.0001; 12M WT vs. 12M TIA1Δ: p < 0.0001. (C). Representative images of GFAP immunohistochemical staining, showing astrocytes in the anterior horn of the lumbar spinal cord in 3- and 12-month-old WT and TIA1Δ mice. Scale bar: 100 μm. (D). Numbers of GFAP-positive astrocyte cells within the anterior horn of the lumbar spinal cord. n = 3–5, 12M WT vs. 12M TIA1Δ: p = 0.0018. NC: negative control. (E–J). qPCR quantification of relative mRNA expression of pro-inflammatory (iNOS, TNF-α) and anti-inflammatory/microglial markers (Arg1) in the lumbar spinal cord of 3- and 12-month-old WT and TIA1Δ mice. n = 3, TNF-α (3M WT vs. 3M TIA1Δ: p = 0.0013, 12M WT vs. 12M TIA1Δ: p = 0.011); iNOS (3M WT vs. 3M TIA1Δ: p = 0.0157, 12M WT vs. 12M TIA1Δ: p = 0.03); Arg1 (3M WT vs. 3M TIA1Δ: p < 0001, 12M WT vs. 12M TIA1Δ: p < 0.0001). * p < 0.05, ** p < 0.01, **** p < 0.0001.
Figure 5. Gliosis in TIA1Δ mice. (A). Representative images of Iba1 immunohistochemical staining, showing microglial cells in the anterior horn of the lumbar spinal cord in 3- and 12-month-old WT and TIA1Δ mice. Scale bars: 100 μm. (B). Numbers of Iba1-positive microglial cells in the anterior horn of the lumbar spinal cord. n = 3–5, 3M WT vs. 3M TIA1Δ: p < 0.0001; 12M WT vs. 12M TIA1Δ: p < 0.0001. (C). Representative images of GFAP immunohistochemical staining, showing astrocytes in the anterior horn of the lumbar spinal cord in 3- and 12-month-old WT and TIA1Δ mice. Scale bar: 100 μm. (D). Numbers of GFAP-positive astrocyte cells within the anterior horn of the lumbar spinal cord. n = 3–5, 12M WT vs. 12M TIA1Δ: p = 0.0018. NC: negative control. (E–J). qPCR quantification of relative mRNA expression of pro-inflammatory (iNOS, TNF-α) and anti-inflammatory/microglial markers (Arg1) in the lumbar spinal cord of 3- and 12-month-old WT and TIA1Δ mice. n = 3, TNF-α (3M WT vs. 3M TIA1Δ: p = 0.0013, 12M WT vs. 12M TIA1Δ: p = 0.011); iNOS (3M WT vs. 3M TIA1Δ: p = 0.0157, 12M WT vs. 12M TIA1Δ: p = 0.03); Arg1 (3M WT vs. 3M TIA1Δ: p < 0001, 12M WT vs. 12M TIA1Δ: p < 0.0001). * p < 0.05, ** p < 0.01, **** p < 0.0001.
Cells 15 00420 g005
Table 1. Instructions for antibody.
Table 1. Instructions for antibody.
AntibodiesTypeSpeciesCat. No.SupplierDilution
Anti-CHATPrimary antibodyRabbit20747-1Proteintech1:500 (IF)
Anti-FUSPrimary antibodyRabbitCY6589Abways1:500 (WB)
1:500 (IHC)
Anti-G3BP1Primary antibodyMouse66486-1-IgProteintech1:10,000 (WB)
1:500 (IHC)
Anti-GFAPPrimary antibodyMouseMAB360Millipore1:2000 (IHC)
Anti-GAPDHPrimary antibodyMouse60004-1-IgProteintech1:20,000 (WB)
Anti-Iba1Primary antibodyRabbit019-19741Woko1:2000 (IHC)
Anti-pTDP-43Primary antibodyRabbit22309-1-APProteintech1:2000 (WB)
Anti-TDP-43Primary antibodyRabbitab109535Abcam1:500 (IHC)
1:5000 (WB)
Anti-TIA1Primary antibodyRabbitab140595Abcam1:500 (IHC)
1:5000 (WB)
Goat anti-rabbit IgG H&L (Alexa Fluor® 488)Secondary antibody-ab150077Abcam1:1000 (IF)
Goat anti-mouse IgG-HRPSecondary antibody-ab205719Abcam1:20,000 (WB)
Goat anti-rabbit IgG-HRPSecondary antibody-115-001-003Jackson ImmunoResearch1:20,000 (WB)
Biotinylated-horse anti-mouse IgGSecondary antibody-BA 2001Vetor Laboratories1:500 (IHC)
Biotinylated-goat anti-rabbit IgGSecondary antibody-BA 1000Vetor Laboratories1:500 (IHC)
Table 2. Primer sequences of quantitative PCR.
Table 2. Primer sequences of quantitative PCR.
GenePrimer Sequence
18SF: GGATGTAAAGGATGGAAAATACA
R: TCCAGGTCTTCACGGAGCTTGTT
TIA1F: CACCGTGGATGGGACCCAATTA
R: TCATACCCGGCCACTCGATAC
TNF-αF: CGCTGAGGTCAATCTGC
R: GGCTGGGTAGAGAATGGA
Arg1F: GGCAAGGTGATGGAAGAG
R: AAAGCTCAGGTGAATCGG
iNOSF: TCTTTGACGCTCGGAACT
R: ATGGCCGACCTGATGTT
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Mao, L.-H.; Song, Y.-N.; Zhang, J.-Q.; Shao, Y.-T.; Wang, Z.-L.; Yang, N.; Zhang, W.-X.; Zhang, Y.-R.; Gao, X.-Y.; Li, J.-Y.; et al. TIA1 Mutant Mouse Model Exhibits Motor Deficits and Neurodegenerative Characteristics of Amyotrophic Lateral Sclerosis. Cells 2026, 15, 420. https://doi.org/10.3390/cells15050420

AMA Style

Mao L-H, Song Y-N, Zhang J-Q, Shao Y-T, Wang Z-L, Yang N, Zhang W-X, Zhang Y-R, Gao X-Y, Li J-Y, et al. TIA1 Mutant Mouse Model Exhibits Motor Deficits and Neurodegenerative Characteristics of Amyotrophic Lateral Sclerosis. Cells. 2026; 15(5):420. https://doi.org/10.3390/cells15050420

Chicago/Turabian Style

Mao, Li-Hong, Yu-Ning Song, Jing-Qi Zhang, Yun-Ting Shao, Zhang-Li Wang, Na Yang, Wen-Xuan Zhang, Ying-Rui Zhang, Xiao-Yan Gao, Jia-Yi Li, and et al. 2026. "TIA1 Mutant Mouse Model Exhibits Motor Deficits and Neurodegenerative Characteristics of Amyotrophic Lateral Sclerosis" Cells 15, no. 5: 420. https://doi.org/10.3390/cells15050420

APA Style

Mao, L.-H., Song, Y.-N., Zhang, J.-Q., Shao, Y.-T., Wang, Z.-L., Yang, N., Zhang, W.-X., Zhang, Y.-R., Gao, X.-Y., Li, J.-Y., & Yuan, L. (2026). TIA1 Mutant Mouse Model Exhibits Motor Deficits and Neurodegenerative Characteristics of Amyotrophic Lateral Sclerosis. Cells, 15(5), 420. https://doi.org/10.3390/cells15050420

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop