Adaptive Thermogenesis and Lipid Metabolism Modulation in Inguinal and Perirenal Adipose Tissues of Hezuo Pigs in Response to Low-Temperature Exposure
Abstract
1. Introduction
2. Materials and Methods
2.1. Animals and Experimental Design
2.2. Sample Collection
2.3. Morphological Observation of IF and PF
2.4. Real-Time Quantitative PCR (RT-qPCR)
2.5. mRNA Library Construction and Sequencing
2.6. Bioinformatics Analysis for RNA-Seq Data
2.7. Functional Enrichment Analysis
2.8. Screening Differential Genes Involved in Key Lipid Metabolism Pathways
2.9. Statistical Analysis
3. Results
3.1. Effect of Low Temperature on the Body Weight of Hezuo Pigs
3.2. Effect of Low Temperature on the Morphology in the IF and PF of Hezuo Pigs
3.3. Effect of Low Temperature on the UCP3 and PGC-1α mRNA Expression in the IF and PF of Hezuo Pigs
3.4. Quality Control and Characterization of cDNA Library in Hezuo Pigs Adipose Tissue
3.5. Analysis of Differentially Expressed Genes (DEGs)
3.6. GO and KEGG Enrichment Analyses
3.7. Differential Transcriptomic Profiles Between IF and PF
3.8. Screening for Lipid Metabolism-Related DEGs
3.9. Validation of RNA-Seq Results by RT-qPCR
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Liu, Z.; Zhang, D.; Wang, W.; He, X.; Peng, F.; Wang, L.; Guo, Z.; Fu, B.; Wu, S.; Li, Z.; et al. A comparative study of the effects of long-term cold exposure, and cold resistance in Min Pigs and Large White Pigs. Acta Agric. Scand. A Anim. Sci. 2017, 67, 34–39. [Google Scholar] [CrossRef] [Scilit]
- Ikeda, K.; Maretich, P.; Kajimura, S. The Common and Distinct Features of Brown and Beige Adipocytes. Trends Endocrinol. Metab. 2018, 29, 191–200. [Google Scholar] [CrossRef] [Scilit]
- Chen, C.C.; Kuo, C.H.; Leu, Y.L.; Wang, S.H. Corylin reduces obesity and insulin resistance and promotes adipose tissue browning through SIRT-1 and β3-AR activation. Pharmacol. Res. 2021, 164, 105291. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Qing, H.; Desrouleaux, R.; Israni-Winger, K.; Mineur, Y.S.; Fogelman, N.; Zhang, C.L.; Rashed, S.; Palm, N.W.; Sinha, R.; Picciotto, M.R.; et al. Origin and Function of Stress-Induced IL-6 in Murine Models. Cell 2020, 182, 1660. [Google Scholar] [CrossRef] [Scilit]
- Chouchani, E.T.; Kazak, L.; Spiegelman, B.M. New Advances in Adaptive Thermogenesis: UCP1 and Beyond. Cell Metab. 2019, 29, 27–37. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Yang, S.; Ma, H.; Wang, L.; Wang, F.; Xia, J.Q.; Liu, D.Y.; Mu, L.L.; Yang, X.Q.; Liu, D. The Role of β3-Adrenergic Receptors in Cold-Induced Beige Adipocyte Production in Pigs. Cells 2024, 13, 709. [Google Scholar] [CrossRef] [Scilit]
- Ye, X.; Song, Y.; Zhao, Y.; Zhu, D. Cold stimulation promotes interleukin-4 secretion by mucosal-associated invariant T cells in the adipose tissue to promote adipose browning in mice. SMJ 2023, 43, 1881–1885. [Google Scholar]
- Scott, M.C.; Fuller, S. The Effects of Intermittent Cold Exposure on Adipose Tissue. Int. J. Mol. Sci. 2024, 25, 46. [Google Scholar] [CrossRef] [Scilit]
- Chen, Y.J.; Liao, P.X.; Kuo, W.H.; Chen, C.Y.; Ding, S.T.; Wang, M.H. Assessment of Brown and Beige Adipose Tissue Activation in Mice Using PET/CT Imaging. Methods Mol. Biol. 2023, 2662, 135–145. [Google Scholar]
- Zhou, Y.B.; Xu, Z.Y.; Wang, L.Y.; Ling, D.F.; Nong, Q.Y.; Xie, J.T.; Zhu, X.D.; Shan, T.Z. Cold Exposure Induces Depot-Specific Alterations in Fatty Acid Composition and Transcriptional Profile in Adipose Tissues of Pigs. Front. Endocrinol. 2022, 13, 827523. [Google Scholar]
- Vamvini, M.; Nigro, P.; Caputo, T.; Stanford, K.I.; Hirshman, M.F.; Middelbeek, R.J.W.; Goodyear, L.J. Exercise Training and Cold Exposure Trigger Distinct Molecular Adaptations to Inguinal White Adipose Tissue. Cell Rep. 2024, 43, 114481. [Google Scholar] [CrossRef] [Scilit]
- Zhang, Y.M.; Erdene, K.; Zhao, Y.B.; Li, C.Q.; Wang, L.; Tian, F.; Ao, C.J.; Jin, H. Role of white adipose tissue browning in cold seasonal acclimation in grazing Mongolian sheep (Ovis aries). J. Therm. Biol. 2022, 109, 103333. [Google Scholar] [CrossRef] [Scilit]
- Xiao, Y.; Wang, G.; Gerrard, M.E.; Wieland, S.; Davis, M.; Cline, M.A.; Siegel, P.B.; Gilbert, E.R. Changes in adipose tissue physiology during the first two weeks posthatch in chicks from lines selected for low or high body weight. Am. J. Physiol. Regul. Integr. Comp. Physiol. 2019, 316, R802–R818. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Camhi, S.M.; Bray, G.A.; Bouchard, C.; Greenway, F.L.; Johnson, W.D.; Newton, R.L.; Ravussin, E.; Ryan, D.H.; Smith, S.R.; Katzmarzyk, P.T. The Relationship of Waist Circumference and BMI to Visceral, Subcutaneous, and Total Body Fat: Sex and Race Differences. Obesity 2011, 19, 402–408. [Google Scholar] [CrossRef] [Scilit]
- Ibrahim, M.M. Subcutaneous and visceral adipose tissue: Structural and functional differences. Obes. Rev. 2010, 11, 11–18. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhang, D.; Wang, L.; Ma, S.; Ma, H.; Liu, D. Characterization of pig skeletal muscle transcriptomes in response to low temperature. Vet. Med. Sci. 2023, 9, 181–190. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [Scilit]
- Bal, N.C.; Singh, S.; Reis, F.C.G.; Maurya, S.K.; Pani, S.; Rowland, L.A.; Periasamy, M. Both brown adipose tissue and skeletal muscle thermogenesis processes are activated during mild to severe cold adaptation in mice. J. Biol. Chem. 2017, 292, 16616–16625. [Google Scholar] [CrossRef] [Scilit]
- Valdivia, L.F.; Castro, E.; Eichler, R.A.; Moreno, M.F.; de Sousa, E.; Jardim, G.F.; Peixoto, A.S.; Moraes, M.N.; Castrucci, A.M.D.; Nedergaard, J. Cold acclimation and pioglitazone combined increase thermogenic capacity of brown and white adipose tissues but this does not translate into higher energy expenditure in mice. Am. J. Physiol. Endocrinol. Metab. 2023, 324, E358–E373. [Google Scholar] [CrossRef] [Scilit]
- Chen, W.T.; Xu, Z.Y.; You, W.J.; Zhou, Y.B.; Wang, L.Y.; Huang, Y.Q.; Shan, T.Z. Cold exposure alters lipid metabolism of skeletal muscle through HIF-1α-induced mitophagy. BMC Biol. 2023, 21, 27. [Google Scholar] [CrossRef] [Scilit]
- Rosenwald, M.; Perdikari, A.; Rülicke, T.; Wolfrum, C. Bi-directional interconversion of brite and white adipocytes. Nat. Cell Biol. 2013, 15, 659–667. [Google Scholar] [CrossRef] [Scilit]
- Mulya, A.; Kirwan, J.P. Brown and Beige Adipose Tissue Therapy for Obesity and Its Comorbidities. Endocrinol. Metab. Clin. N. Am. 2016, 45, 605–621. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kajimura, S.; Spiegelman, B.M.; Seale, P. Brown and Beige Fat: Physiological Roles beyond Heat Generation. Cell Metab. 2015, 22, 546–559. [Google Scholar] [CrossRef] [Scilit]
- Berg, F.; Gustafson, U.; Andersson, L. The uncoupling protein 1 gene (UCP1) is disrupted in the pig lineage: A genetic explanation for poor thermoregulation in piglets. PLoS Genet. 2006, 2, e129. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lin, J.; Cao, C.W.; Tao, C.; Ye, R.C.; Dong, M.; Zheng, Q.T.; Wang, C.; Jiang, X.X.; Qin, G.S.; Yan, C.G.; et al. Cold adaptation in pigs depends on UCP3 in beige adipocytes. J. Mol. Cell Biol. 2017, 9, 364–375. [Google Scholar] [CrossRef] [Scilit]
- Jia, R.; Luo, X.Q.; Wang, G.; Lin, C.X.; Qiao, H.; Wang, N.; Yao, T.; Barclay, J.L.; Whitehead, J.P.; Luo, X.; et al. Characterization of cold-induced remodelling reveals depot-specific differences across and within brown and white adipose tissues in mice. Acta Physiol. 2016, 217, 311–324. [Google Scholar] [CrossRef] [Scilit]
- Luo, X.; Jia, R.; Zhang, Q.L.; Sun, B.; Yan, J.Q. Cold-Induced Browning Dynamically Alters the Expression Profiles of Inflammatory Adipokines with Tissue Specificity in Mice. Int. J. Mol. Sci. 2016, 17, 795. [Google Scholar] [CrossRef] [Scilit]
- Desjardins, E.M.; Steinberg, G.R. Emerging Role of AMPK in Brown and Beige Adipose Tissue (BAT): Implications for Obesity, Insulin Resistance, and Type 2 Diabetes. Curr. Diab. Rep. 2018, 18, 1–9. [Google Scholar] [CrossRef] [Scilit]
- Hardie, D.G.; Ross, F.A.; Hawley, S.A. AMPK: A nutrient and energy sensor that maintains energy homeostasis. Nat. Rev. Mol. Cell Biol. 2012, 13, 251–262. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Park, C.Y.; Jun, H.J.; Wakita, T.; Cheong, J.H.; Hwang, S.B. Hepatitis C virus nonstructural 4B protein modulates sterol regulatory element-binding protein signaling via the AKT pathway. J. Biol. Chem. 2009, 284, 9237–9246. [Google Scholar] [CrossRef] [Scilit]
- Wang, H.Q.; Altomare, D.A.; Skele, K.L.; Poulikakos, P.I.; Kuhajda, F.P.; Di Cristofano, A.; Testa, J.R. Positive feedback regulation between AKT activation and fatty acid synthase expression in ovarian carcinoma cells. Oncogene 2005, 24, 3574–3582. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Stiles, B.; Wang, Y.; Stahl, A.; Bassilian, S.; Lee, W.P.; Kim, Y.J.; Sherwin, R.; Devaskar, S.; Lesche, R.; Magnuson, M.A.; et al. Liver-specific deletion of negative regulator Pten results in fatty liver and insulin hypersensitivity. Proc. Natl. Acad. Sci. USA 2004, 101, 2082–2087. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hao, J.; Liu, S.X.; Zhao, S.; Liu, Q.J.; Lv, X.; Chen, H.; Niu, Y.Y.; Duan, H.J. PI3K/Akt pathway mediates high glucose-induced lipogenesis and extracellular matrix accumulation in HKC cells through regulation of SREBP-1 and TGF-β1. Histochem. Cell Biol. 2011, 135, 173–181. [Google Scholar] [CrossRef] [Scilit]
- Lee, H.J.; Jang, M.; Kim, H.; Kwak, W.; Park, W.; Hwang, J.Y.; Lee, C.K.; Jang, G.W.; Park, M.N.; Kim, H.C.; et al. Comparative Transcriptome Analysis of Adipose Tissues Reveals that ECM-Receptor Interaction Is Involved in the Depot-Specific Adipogenesis in Cattle. PLoS ONE 2013, 8, e66267. [Google Scholar] [CrossRef] [Scilit]
- San, J.S.; Du, Y.T.; Wu, G.F.; Xu, R.F.; Yang, J.C.; Hu, J.M. Transcriptome analysis identifies signaling pathways related to meat quality in broiler chickens—The extracellular matrix (ECM) receptor interaction signaling pathway. Poult. Sci. 2021, 100, 101135. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Liu, X.M.; Zhao, H.B.; Jin, Q.; You, W.; Cheng, H.J.; Liu, Y.F.; Song, E.L.; Liu, G.F.; Tan, X.W.; Zhang, X.L.; et al. Resveratrol induces apoptosis and inhibits adipogenesis by stimulating the SIRT1-AMPKα-FOXO1 signalling pathway in bovine intramuscular adipocytes. Mol. Cell. Biochem. 2018, 439, 213–223. [Google Scholar] [CrossRef] [Scilit]
- Deng, X.; Zhang, W.W.; O-Sullivan, I.; Williams, J.B.; Dong, Q.M.; Park, E.A.; Raghow, R.; Unterman, T.G.; Elam, M.B. FoxO1 Inhibits Sterol Regulatory Element-binding Protein-1c (SREBP-1c) Gene Expression via Transcription Factors Sp1 and SREBP-1c. J. Biol. Chem. 2012, 287, 20132–20143. [Google Scholar] [CrossRef] [Scilit]
- Yang, M.M.; Hu, B.W.; Sun, D.L.; Zhao, C.B.; Wei, H.H.; Li, D.J.; Liang, Z.Y.; Zhao, Y.X.; Liang, J.P.; Shi, M.Q.; et al. Growth hormone receptor gene influences mitochondrial function and chicken lipid metabolism by AMPK-PGC1α-PPAR signaling pathway. BMC Genom. 2022, 23, 219. [Google Scholar] [CrossRef] [Scilit]
- Ning, Z.F.; Deng, X.; Li, L.; Feng, J.; Du, X.X.; Amevo, F.K.; Tian, Y.F.; Li, L.X.; Rao, Y.; Yi, Z.X.; et al. miR-128-3p regulates chicken granulosa cell function via 14-3-3β/FoxO and PPAR-γ/LPL signaling pathways. Int. J. Biol. Macromol. 2023, 241, 124654. [Google Scholar] [CrossRef] [Scilit]
- Jenkins-Kruchten, A.E.; Bennaars-Eiden, A.; Ross, J.R.; Shen, W.J.; Kraemer, F.B.; Bernlohr, D.A. Fatty acid-binding protein-hormone-sensitive lipase interaction. Fatty acid dependence on binding. J. Biol. Chem. 2003, 278, 47636–47643. [Google Scholar] [CrossRef] [Scilit]
- Jia, Y.X.; Liu, Y.; Liu, S.; Chang, Y.X.; Xu, L.F.; Li, H.F. Wnt10b knockdown promotes UCP1 expression in brown adipose tissue in mice. Genes Cells 2023, 28, 764–775. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Xu, D.Q.; Wang, Z.; Xia, Y.; Shao, F.; Xia, W.Y.; Wei, Y.K.; Li, X.J.; Qian, X.; Lee, J.H.; Du, L.Y.; et al. The gluconeogenic enzyme PCK1 phosphorylates INSIG1/2 for lipogenesis. Nature 2020, 580, 530–535. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Gong, R.X.; Xing, L.; Yin, J.W.; Ding, Y.Q.; Liu, X.T.; Bao, J.; Li, J.H. Appropriate cold stimulation changes energy distribution to improve stress resistance in broilers. J. Anim. Sci. 2023, 101, skad185. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Letra, L.; Santana, I. The Influence of Adipose Tissue on Brain Development, Cognition, and Risk of Neurodegenerative Disorders. Adv. Neurobiol. 2017, 19, 151–161. [Google Scholar]
- Xu, Z.Y.; You, W.J.; Zhou, Y.B.; Chen, W.T.; Wang, Y.Z.; Shan, T.Z. Cold-induced lipid dynamics and transcriptional programs in white adipose tissue. BMC Biol. 2019, 17, 1–21. [Google Scholar] [CrossRef] [Scilit]











| Gene Name | Primer Sequences (5′-3′) | Length (bp) | Transcript No. |
|---|---|---|---|
| UCP3 | F: TCACCTTCAGGACACGTTCG R: AGGCATCCATCCTAGTGGGT | 84 | NM_214049.1 |
| PGC-1α | F: CATGTGCAACCAGGACTCTGT R: GCGTCTCTGTGAGAACTGCTA | 269 | NM_213963.2 |
| TNS4 | F: GCAGCCCACCATGAAGTTTG R: TGTCCCTCACGATGAAAGCC | 122 | XM_003131470.4 |
| CHD5 | F: CTCCAGATGTCCGAGCGAAG R: GGGCACCTACCGGTCACATA | 194 | XM_021095234.1 |
| CLPSL2 | F: ATCAACTTGGACCTCGGTGG R: CCTTGGCAGGGACAGACAAT | 107 | XM_005665918.3 |
| CDH9 | F: ACGATTACCTCAGCGACTGG R: GAAAGCAGGCCACTCCATCT | 150 | XM_021076628.1 |
| DSG3 | F: AAGCAGACACACGGGAGAAG R: CACCACTCACAACCAGACGA | 86 | XM_003356391.4 |
| LIPG | F: GAAACCTAGTGGGATGGGGAT R: GCCAAGAGTGCCTTTCATCAC | 82 | NM_001243029.1 |
| NRIP3 | F: GATCCCTTTTGTGGAGACGGT R: TCTGTCAACCTGGTGTGTGT | 105 | XM_005667042.3 |
| SAL1 | F: CCTCTTCCCACAAGGAAGCA R: CCAAGACACGGATATGCTCCA | 162 | NM_213814.2 |
| SCD | F: AAATCTTCTGGGAAAGCCCCTG R: TCCCCTGACAAGTTACCTGC | 111 | NM_213781.1 |
| KCNK3 | F: TCTACTTCGCCATCACCGTC R: ATGCACGAGAAGAAGCCGAT | 253 | NM_001315680.1 |
| GAPDH | F: AGTATGATTCCACCCACGGC R: TACGTAGCACCAGCATCACC | 139 | NM_001206359.1 |
| Term | Control Group (kg) | Low-Temperature Group (kg) | p-Value |
|---|---|---|---|
| 0 h | 5.17 ± 0.03 | 5.18 ± 0.04 | 0.718 |
| 12 h | 5.18 ± 0.04 | 5.18 ± 0.04 | 0.922 |
| 24 h | 5.24 ± 0.06 | 5.21 ± 0.05 | 0.495 |
| 48 h | 5.44 ± 0.09 | 5.27 ± 0.07 | 0.057 |
| 5 d | 5.98 ± 0.14 | 5.54 ± 0.08 | 0.008 |
| 10 d | 6.58 ± 0.18 | 5.78 ± 0.27 | 0.013 |
| 15 d | 7.70 ± 0.20 | 6.24 ± 0.28 | 0.002 |
| Average daily weight gain (g/d) | 169.00 ± 11.36 | 70.33 ± 16.74 | 0.001 |
| Groups | Genes | Betweenness | Groups | Genes | Betweenness |
|---|---|---|---|---|---|
| B_IF | FABP4 | 1872.3813 | B_PF | ATP5F1C | 153.1263 |
| PRKCG | 1696.4803 | ATP5F1A | 132.4847 | ||
| WNT10B | 1520.4729 | SDHB | 128.6541 | ||
| GNB5 | 1493.9647 | DLAT | 115.2456 | ||
| COL1A1 | 1285.897 | MDH2 | 107.9385 | ||
| GNAI1 | 1145.1943 | NDUFAB1 | 94.6571 | ||
| ITGB4 | 1084.635 | SDHA | 86.3341 | ||
| IRS2 | 1029.1504 | NDUFS8 | 81.3528 | ||
| PCK1 | 827.73615 | DLD | 77.0280 | ||
| MAPK10 | 700.68866 | ATP5F1B | 73.2094 | ||
| PPP2R1B | 608.68066 | UQCRC2 | 70.0166 | ||
| PLIN1 | 585.4062 | ATP5F1D | 69.3359 | ||
| FGFR2 | 564.2501 | CYC1 | 57.2409 | ||
| ADIPOQ | 546.2029 | UQCRC1 | 53.8775 | ||
| ADCY4 | 540.1115 | NDUFA9 | 52.7184 | ||
| WNT11 | 530.37274 | ATP5PO | 52.2509 | ||
| FZD2 | 510.57275 | ATP5PB | 44.4790 | ||
| PDE3B | 501.63425 | PDHA1 | 41.9882 | ||
| LEPR | 422.55783 | NDUFS1 | 41.1655 | ||
| FN1 | 412.8051 | COX5A | 39.9688 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Li, Y.; Shi, H.-X.; Li, J.; Du, H.; Jia, R.; Liang, Y.-H.; Huang, X.-Y.; Gao, X.-L.; Gun, S.-B.; Yang, Q.-L. Adaptive Thermogenesis and Lipid Metabolism Modulation in Inguinal and Perirenal Adipose Tissues of Hezuo Pigs in Response to Low-Temperature Exposure. Cells 2025, 14, 392. https://doi.org/10.3390/cells14060392
Li Y, Shi H-X, Li J, Du H, Jia R, Liang Y-H, Huang X-Y, Gao X-L, Gun S-B, Yang Q-L. Adaptive Thermogenesis and Lipid Metabolism Modulation in Inguinal and Perirenal Adipose Tissues of Hezuo Pigs in Response to Low-Temperature Exposure. Cells. 2025; 14(6):392. https://doi.org/10.3390/cells14060392
Chicago/Turabian StyleLi, Yao, Hai-Xia Shi, Jie Li, Hong Du, Rui Jia, Yu-Hao Liang, Xiao-Yu Huang, Xiao-Li Gao, Shuang-Bao Gun, and Qiao-Li Yang. 2025. "Adaptive Thermogenesis and Lipid Metabolism Modulation in Inguinal and Perirenal Adipose Tissues of Hezuo Pigs in Response to Low-Temperature Exposure" Cells 14, no. 6: 392. https://doi.org/10.3390/cells14060392
APA StyleLi, Y., Shi, H.-X., Li, J., Du, H., Jia, R., Liang, Y.-H., Huang, X.-Y., Gao, X.-L., Gun, S.-B., & Yang, Q.-L. (2025). Adaptive Thermogenesis and Lipid Metabolism Modulation in Inguinal and Perirenal Adipose Tissues of Hezuo Pigs in Response to Low-Temperature Exposure. Cells, 14(6), 392. https://doi.org/10.3390/cells14060392

