MicroRNA-21 Protects Hypoxic-Induced Cardiomyocytes Injury by Targeting Smad-7
Abstract
1. Introduction
2. Section of Material and Methods
2.1. Study of Human Research Participants
2.2. Animal Study Groups
2.3. H9c2 Cell Culture, Hypoxic Model, Transfection, and Hoechst Staining
2.4. Luciferase Reporter Gene Expression
2.5. Caspase-3 Activities Assessment
2.6. Detection of Intracellular ROS Concentration
2.7. Cellular Viability Assay
2.8. RNA Isolation and Detection of miRNA Expressions
2.9. Statistical Methods
3. Results
3.1. Baseline Information of the Participants
3.2. Expression of Plasma miRNAs (miR-21, miR-488, miR-126) in Acute Myocardial Infarction Patients and Mice AMI
3.3. Diagnostic Impact of Plasma miRNAs for AMI Patients
3.4. Expression and Luciferase Reporter Assay of miR-21, miR-488, and miR-126 in H9c2 Cells
3.5. Effects of Inhibitor miR-21 on Smad-7 and Hypoxia-Exposed H9c2 Cells
3.6. The miR-21 Relationship with Aging and Gender
4. Discussion
5. Limitations of the Study
6. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Martin, S.S.; Aday, A.W.; Allen, N.B.; Almarzooq, Z.I.; Anderson, C.A.; Arora, P.; Avery, C.I.; Baker-Smith, C.M.; Bansal, N.; Beaton, A.Z.; et al. 2025 Heart Disease and Stroke Statistics: A Report of US and Global Data From the American Heart Association. Circulation 2025, 8, e41–e660. [Google Scholar]
- Sayed, M.S.A.; Salma, U. Impact of microRNAs on cardiovascular diseases and aging. J. Int. Med. Res. 2024, 10, 3000605241279190. [Google Scholar]
- Lozano-Velasco, E.; Inácio, J.M.; Sousa, I.; Guimarães, A.R.; Franco, D.; Moura, G.; Belo, J.A. miRNAs in Heart Development and Disease. Int. J. Mol. Sci. 2024, 3, 1673. [Google Scholar] [CrossRef]
- Stojkovic, S.; Wadowski, P.P.; Haider, P.; Weikert, C.; Pultar, J.; Lee, S.; Eichelberger, B.; Hengstenberg, C.; Wojta, A.; Panzer, S.; et al. Circulating MicroRNAs and Monocyte-Platelet Aggregate Formation in Acute Coronary Syndrome. Thromb. Haemost. 2021, 7, 913–922. [Google Scholar] [CrossRef]
- Liang, G.; Guo, C.; Tang, H.; Zhang, M. miR-30a-5p attenuates hypoxia/reoxygenation-induced cardiomyocyte apoptosis by regulating PTEN protein expression and activating PI3K/Akt signaling pathway. BMC Cardiovasc. Disord. 2024, 1, 236. [Google Scholar] [CrossRef] [PubMed]
- Stojkovic, S.; Wojta, J. Circulatory microRNAs in acute coronary syndrome: An update. Kardiol. Pol. 2024, 12, 1192–1199. [Google Scholar]
- Wang, L.; Zhu, Q.; Cheng, B.; Jiang, N.; Dong, C. Value of Let-7a-5p in Essential Hypertension. J. Clin. Hypertens. 2025, 3, 70033. [Google Scholar] [CrossRef]
- Natsume, Y.; Oaku, K.; Takahashi, K.; Nakamura, W.; Oono, A.; Hamada, S.; Yamazoe, M.; Ihara, K.; Sasaki, T.; Goya, M.; et al. Analysis of Human and Experimental Murine Samples Identified Novel Circulating MicroRNAs as Biomarkers for Atrial Fibrillation. Circ. J. 2018, 4, 965–973. [Google Scholar] [CrossRef]
- Andiappan, R.; Govindan, R.; Ramasamy, T.; Poomarimuthu, M. Circulating miR-133a-3p and miR-451a as potential biomarkers for diagnosis of coronary artery disease. Acta Cardiol. 2024, 7, 813–823. [Google Scholar] [CrossRef] [PubMed]
- Hernández-López, J.R.; Flores-García, M.; García-Flores, E.; Cazarín-Santos, B.G.; Peña-Duque, M.A.; Sánchez-Muñoz, F.; Ballinas-Verdugo, M.A.; Delgadillo-Rodríguez, H.; Martínez-Ríos, M.A.; Angles-Cano, E.; et al. Circulating Microvesicles Enriched in miR-126-5p and miR-223-3p: Potential Biomarkers in Acute Coronary Syndrome. Biomedicines 2025, 2, 510. [Google Scholar] [CrossRef]
- Agiannitopoulos, K.; Pavlopoulou, P.; Tsamis, K.; Bampali, K.; Samara, P.; Nasioulas, G.; Mertzanos, G.; Babalis, D.; Lamnissou, K. Expression of miR-208b and miR-499 in Greek Patients with Acute Myocardial Infarction. In Vivo 2018, 2, 313–318. [Google Scholar]
- Lu, Y.; Thavarajah, T.; Gu, W.; Cai, J.; Xu, Q. Impact of miRNA in Atherosclerosis. Arter. Thromb. Vasc. Biol. 2018, 9, e159–e170. [Google Scholar] [CrossRef]
- Li, S.; Fan, Q.; He, S.; Tang, T.; Liao, Y.; Xie, J. MicroRNA-21 negatively regulates Treg cells through a TGF-β1/Smad-independent pathway in patients with coronary heart disease. Cell. Physiol. Biochem. 2015, 3, 866–878. [Google Scholar] [CrossRef] [PubMed]
- Su, Y.; Shi, D.; Xia, G.; Liu, Y.; Xu, L.; Dao, L.; Lu, X.; Shen, C.; Xu, C. Carbonic Anhydrase 3 is required for cardiac repair post myocardial infarction via Smad7-Smad2/3 signaling pathway. Int. J. Biol. Sci. 2024, 5, 1796–1814. [Google Scholar] [CrossRef]
- Shen, H.; Yao, Z.; Zhao, W.; Zhang, Y.; Yao, C.; Tong, C. miR-21 enhances the protective effect of loperamide on rat cardiomyocytes against hypoxia/reoxygenation, reactive oxygen species production and apoptosis via regulating Akap8 and Bard1 expression. Exp. Ther. Med. 2018, 2, 1312–1320. [Google Scholar] [CrossRef]
- Wang, W.; Zheng, Y.; Wang, M.; Yan, M.; Jiang, J.; Li, Z. Exosomes derived miR-126 attenuates oxidative stress and apoptosis from ischemia and reperfusion injury by targeting ERRFI1. Gene 2019, 690, 75–80. [Google Scholar] [CrossRef]
- Xu, L.; Tian, L.; Yan, Z.; Wang, J.; Xue, T.; Sun, Q. Diagnostic and prognostic value of miR-486-5p, miR-451a, miR-21-5p and monocyte to high-density lipoprotein cholesterol ratio in patients with acute myocardial infarction. Heart Vessel. 2023, 3, 318–331. [Google Scholar] [CrossRef]
- Sahebi, R.; Gandomi, F.; Shojaei, M.; Farrokhi, E. miRNA-21-5p and miRNA-21-3p as key biomarkers of myocardial infarction. Health Sci. Rep. 2024, 7, e2228. [Google Scholar] [CrossRef]
- Yang, L.; Wang, B.; Zhou, Q.; Wang, Y.; Liu, X.; Liu, Z.; Zhan, Z. MicroRNA-21 prevents excessive inflammation and cardiac dysfunction after myocardial infarction through targeting KBTBD7. Cell Death Dis. 2018, 7, 769. [Google Scholar] [CrossRef]
- Canfrán-Duque, A.; Rotllan, N.; Zhang, X.; Fernández-Fuertes, M.; Ramírez-Hidalgo, C.; Araldi, E.; Daimiel, L.; Busto, R.; Fernández-Hernando, C.; Suárez, Y. Macrophage deficiency of miR-21 promotes apoptosis, plaque necrosis, and vascular inflammation during atherogenesis. EMBO Mol. Med. 2017, 9, 1244–1262. [Google Scholar] [CrossRef]
- Yuan, J.; Chen, H.; Ge, D.; Xu, Y.; Xu, H.; Yang, Y.; Gu, M.; Zhou, Y.; Zhu, J.; Ge, T.; et al. Mir-21 Promotes Cardiac Fibrosis After Myocardial Infarction Via Targeting Smad7. Cell. Physiol. Biochem. 2017, 6, 2207–2219. [Google Scholar] [CrossRef]
- Hao, L.; Wang, J.; Liu, N. Long noncoding RNA TALNEC2 regulates myocardial ischemic injury in H9c2 cells by regulating miR-21/PDCD4-medited activation of Wnt/β-catenin pathway. J. Cell. Biochem. 2019, 8, 12912–12923. [Google Scholar] [CrossRef]
- Li, Z.; Xu, C.; Sun, D. MicroRNA-488 serves as a diagnostic marker for atherosclerosis and regulates the biological behavior of vascular smooth muscle cells. Bioengineered 2021, 1, 4092–4099. [Google Scholar] [CrossRef]
- Verjans, R.; Derks, W.J.A.; Korn, K.; Sönnichsen, B.; van Leeuwen, R.E.; Schroen, B.; van Bilsen, M.; Heymans, S. Functional Screening Identifies MicroRNAs as Multi-Cellular Regulators of Heart Failure. Sci. Rep. 2019, 1, 6055. [Google Scholar] [CrossRef]
- Luo, Q.; Guo, D.; Liu, G.; Chen, G.; Hang, M.; Jin, M. Exosomes from MiR-126-Overexpressing Adscs Are Therapeutic in Relieving Acute Myocardial Ischaemic Injury. Cell. Physiol. Biochem. 2017, 6, 2105–2116. [Google Scholar] [CrossRef]
- Mensà, E.; Guescini, M.; Giuliani, A.; Bacalini, M.G.; Ramini, D.; Corleone, G.; Ferracin, M.; Fulgenzi, G.; Graciotti, L.; Prattichizzo, F.; et al. Small extracellular vesicles deliver miR-21 and miR-217 as pro-senescence effectors to endothelial cells. J. Extracell. Vesicles 2020, 9, 1725285. [Google Scholar] [CrossRef]
- Chang, W.T.; Shih, J.Y.; Lin, Y.W.; Huang, T.L.; Chen, Z.C.; Chen, C.L.; Chu, J.S.; Liu, P.Y. miR-21 upregulation exacerbates pressure overload-induced cardiac hypertrophy in aged hearts. Aging 2022, 14, 5925–5945. [Google Scholar] [CrossRef]






| Genes | Upstream Primer Sequences (5′–3′) | Downstream Primer Sequences (5′–3′) |
|---|---|---|
| miR-21 | GCCGCTAGCTTATCAGACTGATGT | GTGCAGGGTCCGAGGT |
| miR-488 | ACACTCCAGCTGGGTTGAAAGGCTGTTTC | TGGTGTCGTGGAGTCG |
| miR-126 | GCATCGTCGTACCGT GAGTAAT | GTGCAGGGTCCGAGGTA TTC |
| miR-156 | AGGCGCCTGACAGAAGAGAGT | GTGCAGGGTCCGAGGT |
| Smad 7 | TTT GTG TAT TTA TTT CTT TCT CTC | CAC TCT CGT CTT CTC CTC |
| Clinical Variables | Healthy Participants (n = 95) | STEMI (n = 152) | NSTEMI (n = 95) | P1 | P2 | P3 |
|---|---|---|---|---|---|---|
| Age, years | 58 ± 12 | 62 ± 13 | 63 ± 11 | 0.497 | 0.483 | 0.806 |
| Sex, male/female | 48/47 | 85/67 | 56/39 | 0.295 | 0.144 | 0.107 |
| Diabetes | - | 50 (33%) | 30 (32%) | - | - | 0.994 |
| Smokers | 52.3 (55%) | 102 (67%) | 61 (64%) | 0.751 | 0.743 | 0.928 |
| Obesity | - | 20 (13%) | 10 (11%) | - | - | 0.664 |
| Lipid disorders | - | 123 (81%) | 80 (84%) | - | - | 0.503 |
| High blood pressure | - | 85 (56%) | 57 (59%) | - | - | 0.719 |
| Family history of CAD | 5.7 (6%) | 68 (45%) | 45 (47%) | 0.000 | 0.000 | 0.931 |
| Peripheral vascular diseases | - | 20 (13%) | 16 (17%) | - | - | 0.475 |
| Heart rate, bpm | 80.2 ± 8.5 | 84.6 ± 11.8 | 83.7 ± 10.9 | 0.648 | 0.597 | 0.882 |
| Glucose (mmol/L) | 4.6 ± 0.8 | 5.48 ± 0.9 | 5.37 ± 0.6 | 0.098 | 0.116 | 0.692 |
| Serum creatinine (mg/dL) | 0.91 ± 0.8 | 1.3 ± 1.2 | 1.4 ± 1.2 | 0.000 | 0.000 | 0.187 |
| C-reactive protein, mg/L | 4.2 ± 3.1 | 20.6 ± 9.2 | 22.5 ± 8.4 | 0.000 | 0.000 | 0.155 |
| Platelets (x109/L) | 213.1 ± 4.2 | 217.5 ± 6.2 | 220.7 ± 6.8 | 0.279 | 0.253 | 0.487 |
| Cardiac Troponin I (μg/L) | - | 45.6 ± 59.3 | 47.8 ± 61.5 | - | - | 0.108 |
| Left ventricular ejection fraction % | 56.7 ± 12.8 | 45.3 ± 9.6 | 47.8 ± 9.2 | 0.000 | 0.000 | 0.851 |
| Aspirin | - | 126 (83%) | 72 (76%) | - | - | 0.127 |
| Clopidogrel | - | 52 (34%) | 28 (29%) | - | - | 0.104 |
| Beta-blockers | - | 128 (84%) | 79 (83%) | - | - | 0.972 |
| Angiotensin-converting-enzyme inhibitors | - | 59 (39%) | 39 (41%) | - | - | 0.713 |
| Angiotensin receptor blockers | - | 21 (14%) | 16 (17%) | - | - | 0.681 |
| Nitrates | - | 131 (86%) | 80 (84%) | - | - | 0.895 |
| Lipid-lowering agents | - | 122 (80%) | 74 (78%) | - | - | 0.782 |
| Midazolam | - | 41 (27%) | 28 (29%) | - | - | 0.883 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Ali Sheikh, M.S.; Alduraywish, A.; Mohammed Alomair, B.; Almubarak, M.; Salma, U. MicroRNA-21 Protects Hypoxic-Induced Cardiomyocytes Injury by Targeting Smad-7. Cells 2025, 14, 1483. https://doi.org/10.3390/cells14191483
Ali Sheikh MS, Alduraywish A, Mohammed Alomair B, Almubarak M, Salma U. MicroRNA-21 Protects Hypoxic-Induced Cardiomyocytes Injury by Targeting Smad-7. Cells. 2025; 14(19):1483. https://doi.org/10.3390/cells14191483
Chicago/Turabian StyleAli Sheikh, Md Sayed, A. Alduraywish, Basil Mohammed Alomair, Muhannad Almubarak, and Umme Salma. 2025. "MicroRNA-21 Protects Hypoxic-Induced Cardiomyocytes Injury by Targeting Smad-7" Cells 14, no. 19: 1483. https://doi.org/10.3390/cells14191483
APA StyleAli Sheikh, M. S., Alduraywish, A., Mohammed Alomair, B., Almubarak, M., & Salma, U. (2025). MicroRNA-21 Protects Hypoxic-Induced Cardiomyocytes Injury by Targeting Smad-7. Cells, 14(19), 1483. https://doi.org/10.3390/cells14191483
