Next Article in Journal
Spatio-Temporal Regulation of Notch Activation in Asymmetrically Dividing Sensory Organ Precursor Cells in Drosophila melanogaster Epithelium
Previous Article in Journal
Expanding the Neurological Phenotype of Anderson–Fabry Disease: Proof of Concept for an Extrapyramidal Neurodegenerative Pattern and Comparison with Monogenic Vascular Parkinsonism
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Cells
Volume 13
Issue 13
10.3390/cells13131132
cells-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

HPV Detection in Breast Tumors and Associated Risk Factors in Northeastern Brazil

by
Kamylla Conceição Gomes Nascimento
†,
Bianca de França São Marcos
†,
Pedro Henrique Bezerra Fontes
,
Beatriz Eda de Oliveira Isídio
,
Stephanie Loureiro Leão
,
Gabriel Romulo Parente da Silva
,
David Beltrán Lussón
,
Daffany Luana dos Santos
,
Lígia Rosa Sales Leal
,
Benigno Cristofer Flores Espinoza
,
Larissa Silva de Macêdo
,
Pedro Luiz de França Neto
,
Anna Jéssica Duarte Silva
,
Jacinto Costa Silva Neto
,
Vanessa Emanuelle Pereira Santos
and
Antonio Carlos de Freitas
*
Laboratory of Molecular Studies and Experimental Therapy, Department of Genetics, Federal University of Pernambuco, Av. Prof. Moraes Rego, 1235. Cidade Universitária Recife, Pernambuco, Recife 50670901, PE, Brazil
*
Author to whom correspondence should be addressed.
†
These authors contributed equally to this work.
Cells 2024, 13(13), 1132; https://doi.org/10.3390/cells13131132
Submission received: 7 June 2024 / Revised: 26 June 2024 / Accepted: 28 June 2024 / Published: 29 June 2024
Browse Figures
Review Reports Versions Notes

Abstract

:
Breast cancer risk factors include lifestyle, genetic–hormonal influences, and viral infections. Human papillomavirus (HPV), known primarily as the etiological agent of cervical cancer, also appears active in breast carcinogenesis, as evidenced in our study of 56 patients from northeastern Brazil. We assessed the clinical and sociodemographic characteristics, correlating them with various breast cancer tumor types. HPV detection involved amplifying the L1 region, with viral load measured using the E2/E6 ratio and viral activity indicated by E5 oncogene expression. Predominantly, patients over 56 years of age with healthy lifestyles showed a high incidence of invasive ductal carcinoma and triple-negative breast cancer. HPV was detected in 35.7% of cases, mostly HPV16, which is associated with high viral loads (80 copies per cell) and significant E5 expression. These results hint at a possible link between HPV and breast carcinogenesis, necessitating further studies to explore this association and the underlying viral mechanisms.

1. Introduction

Breast cancer is one of the most commonly diagnosed cancers worldwide and the leading cause of cancer-related mortality in women globally [1]. In 2022, according to the Global Cancer Observatory, approximately 2.3 million new cases of breast cancer were estimated worldwide, with approximately 670,000 associated deaths [2]. Considering statistical projections, there is an expected increase in breast cancer cases, with an estimated 3.19 million new cases projected by 2040 [3].
Breast cancer classification considers histological and molecular aspects of the disease. Histological classification categorizes tumors into invasive ductal carcinoma (IDC), responsible for about 50% to 80% of diagnosed cases; invasive lobular carcinoma (ILC); and ductal carcinoma in situ (DCIS) [4,5]. Molecular types of breast cancer include four main subtypes: luminal A, luminal B, HER2-enriched, and triple-negative. Luminal tumors represent 60–70% of cases and express estrogen and progesterone hormone receptors, HER2+ tumors overexpress the HER2 gene, and triple-negative tumors lack hormone receptors and HER2 expression and have high recurrence rates [6].
The prolonged use of contraceptive pills and hormone replacement therapy with estrogen may increase the risk of developing the disease [7]. However, other non-hormonal factors are also associated with the development of the disease, such as sedentary lifestyle, a high-fat diet, obesity, alcohol consumption, smoking, family history (BRCA1/2 gene mutations), and exposure to pollutants [8]. In recent years, studies have reported the Human Papillomavirus (HPV) as a possible risk factor; however, although HPV DNA has been detected in breast cancer samples, its relationship with mammary carcinogenesis remains controversial and unconfirmed [9].
The association between breast cancer and Human Papillomavirus (HPV) has been the subject of investigation in recent years [9]. HPV is the most common sexually transmitted virus in the population, capable of infecting epithelial cells in both mucosal and keratinizing skin [10,11]. Studies report the presence of the HPV genome in breast tumors; however, the frequency of virus detection in samples shows a wide variation, from 1.1 to 86% among different studies [12]. Some studies suggest that HPV infection may be related to the development of breast cancer, possibly due to the virus’s ability to integrate its DNA into the host cell genome, causing genetic instability [13].
Currently, more than 200 types of HPV are known, classified according to oncogenic risk. There are 20 types of high-risk HPVs (hr-HPV): 16, 18, 26, 31, 33, 35, 39, 45, 51, 53, 52, 56, 58, 59, 66, 67, 68, 70, and 82 [11,14,15], with type 16 being the most prevalent in the population of northeastern Brazil [16]. The oncogenic potential of HPV arises from the oncoproteins E5, E6, and E7, responsible for causing cellular transformations and interacting with pathways responsible for proliferation, angiogenesis, and cellular apoptosis [17].
The transmission of HPV to breast tissue is not fully understood; however, several mechanisms have been proposed. One hypothesis is viral dissemination from a preexisting genital infection, through the bloodstream or lymphatic system, to breast tissue [18]. Another hypothesis indicates the transmission of the virus between mothers and children during breastfeeding [19]. Furthermore, studies suggest that HPV transmission to the breast can occur from any oral site due to oral sexual practices, as well as through the nipple or microlesions in breast skin resulting from genital-to-breast sexual activity [12]. However, a comprehensive understanding of the mechanisms of HPV transmission to breast tissue still requires further research for elucidation.
HPV is the primary etiological agent of cervical cancer and is also implicated in the development of other cancers, including vulvar, vaginal, anal, and head and neck cancers. However, the virus’s activity in breast carcinogenesis remains inconclusive [20]. Therefore, this study aimed to identify the presence of HPV in breast tumor tissues of women from northeastern Brazil, as well as to characterize aspects related to other risk factors for breast carcinogenesis in breast cancer patients with and without virus infection.

2. Materials and Methods

2.1. Sample Population

This study included 56 individuals with a histological diagnosis of breast cancer, conducted in accordance with the World Health Organization (WHO) classification. Fresh breast tissue samples were collected between June 2012 and December 2015. Biopsies were obtained from regions with lesions indicative of neoplastic conditions and stored in RNA later solution. Women infected with HIV (Human Immunodeficiency Virus) or who were pregnant were excluded from the study.
This work was approved by the Research Ethics Committee of the Federal University of Pernambuco, Brazil, under the numbers CAAE: 28508614.9.0000.5208 and 28508614.9.0000.5208. The patients were informed about the research objectives and the procedures to be performed. All patients agreed to participate in this study, signed the Free and Informed Consent Form and completed a medical history. The medical history included sociodemographic and behavioral data.

2.2. DNA Extraction and HPV Detection

The biopsy samples were macerated in liquid nitrogen, and the DNA was extracted and purified using the DNeasy Blood & Tissue Kit (Qiagen GmbH, Hilden, Germany). All the samples were quantified using the NanoDrop™ Lite Spectrophotometer (Thermo Scientific, Waltham, MA, USA). The quality of the extracted DNA was confirmed by amplifying a fragment of the β-globin gene via the polymerase chain reaction (PCR), using the primers described in Table 1. HPV DNA detection was performed through PCR amplification using two sets of oligonucleotides. In the first step, we used the consensus and degenerate primer set MY09 and MY11 (Table 1), which bind to a conserved region of the HPV L1 gene, resulting in the amplification of a product approximately 450 bp in size. This was followed by Nested-PCR using the GP5 and GP6 oligonucleotides, generating a fragment of approximately 150 bp.
The PCR products were visualized on a 2% agarose gel stained with ethidium bromide. We used HPV-positive DNA samples from patients with cervical cancer, as well as a cloned HPV16 genome as positive controls for all the PCR reactions. Additionally, all tests were performed in triplicate by different handlers.

2.3. Genotyping

Positive samples for HPV DNA were typed by sequencing from the GP5/6 oligonucleotides. The PCR products were sequenced using the fluorescent dideoxy-terminal method with the ABI PRISM BigDye™ Terminator Cycle Sequencing v 3.1 Ready Reaction kit (Applied Biosystems®, Foster City, CA, USA). The resulting sequences were analyzed using the programs Gap4 (version 4.0) and Pregap4 (version 1.5), which were used to construct the contigs of the obtained HPV DNA sequences. After the contigs were assembled, the BLAST program, available at http://blast.ncbi.nlm.nih.gov/Blast.cgi, was used for comparison with previously known HPV sequences.

2.4. Physical Status and Viral Load

To determine the physical state and viral load of the most prevalent HPV type, real-time PCR (qPCR) reactions were performed using the Quantitect SYBR Green PCR kit (Sigma®, St. Louis, MO, EUA). The amplifications were conducted in a volume of 20 µL, containing 2× Power SYBR Green PCR Master Mix and oligonucleotides that amplify the E6 (primer forward—GAG AAA CTG CAA TGT TTC AGG ACC; primer reverse—TGTATAGTTGTTTGCAGCTCTGTGC) and E2 regions of HPV16 (primer forward—AAC GAA GTA TCC TCT CCT GAA ATT ATT AG; primer reverse—CCA AGG CGA CGG CTT TG; [24] at a concentration of 300 nM. The reactions were carried out using the Rotor Gene 6000 (Qiagen, Germantown, MD, USA) and Cycler 8800 (Agilent Scientific Instruments).
To generate the standard curve, we used a series of dilutions (10^1 to 10^6) of the full-length HPV16 genome cloned into the pBR-322 vector. These dilutions served as standards for the calibration curve of the E2 and E6 genes. Additionally, we used DNA extracted from CaSki cell lines (400–6000 copies per cell) and SiHa cell lines (1–2 copies per cell) as positive controls for the reactions. These controls were used to verify the accuracy and reproducibility of the calibration curves estimated for the HPV load.
The samples were analyzed in duplicate after constructing the calibration curves for each gene. The viral load was determined based on the levels of the E6 gene, and the viral load values for each sample were expressed as the number of E6 copies in 50 ng of DNA [24]. Regarding the physical status of the virus, we considered HPV to be integrated into the host genome when the E2 gene was not detected. To distinguish between the episomal form and the mixed form (when both episomal and integrated forms are present), we calculated the E2/E6 ratio. The E2/E6 ratio values above 1 indicated a predominance of the episomal form [24].

2.5. RNA Extraction and cDNA Synthesis

RNA extraction was performed using liquid nitrogen and the Trizol protocol (Invitrogen®, Carlsbad, CA, USA), following the manufacturer's recommendations. For RNA purification, the samples were processed using the miRNeasy kit (Qiagen, Germantown, MD, USA). The integrity of the RNA was evaluated through RNA-specific electrophoresis, and the samples were quantified using the NanoDrop™ Lite Spectrophotometer (Thermo Scientific). Subsequently, 1 μg of RNA from each sample was subjected to reverse transcription using the miScript II RT kit (Qiagen, Germantown, MD, USA).

2.6. Quantitative Real-Time PCR (RT-qPCR)

The RT-qPCR technique was employed to quantify the expression of the HPV E5 oncogene, Forwad: ACT GGC GTG CTT TTT GCT TTG and Reverse: GAC ACA GAC AAA AGC AGC GG [25]. The endogenous genes GAPDH and ACTB were used as internal standards for data normalization, allowing for the calculation of relative quantification values for all the evaluated targets. The Quantitect SYBR Green PCR kit (Sigma®) was used in the RT-qPCR reactions. The Rotor Gene 6000 (Qiagen, Germantown, MD, USA) was utilized as the thermal cycler, and each sample was analyzed in duplicate. The quantification cycle (Cq) values were converted to a ratio relative to the control and reference genes. The relative quantification data were generated following the qBase model [26], used for expression data analysis.

2.7. Statistical Analysis

We conducted statistical analyses to assess the association between the histopathological data and the presence of viral DNA in breast tissue. The chi-square test was used to compare the case and control groups. A p-value < 0.05 was considered statistically significant. The statistical analyses were performed using GraphPad Prism software version 9.0.0 (GraphPad Software, Inc., San Diego, CA, USA).

3. Results

3.1. Analysis of Clinical and Sociodemographic Characteristics

A frequence contingency analysis was performed on 56 breast cancer tumor samples, taking into account the clinical characteristics of the tumors as well as the sociodemographic characteristics of the patients (Table 2, Table 3 and Table 4). Breast cancer patients were evaluated based on their clinical and sociodemographic characteristics. More than 50% of patients were over 56 years of age, had a normal BMI (45.8%), were non-smokers, non-diabetic, and non-hypertensive. However, these data did not achieve statistical significance (Table 2).
In terms of patients’ gynecological status, the majority experienced menarche between 11–14 years (67.8%), menopause between 45–50 years (35.7%), their first pregnancy between 18–27 years (73.5%), with 1–3 children (50.0%). Additionally, over 55% of them breastfed and did not use hormonal contraception (53.6%) (Table 3).
When evaluating the breast cancer screening activity of the surveyed patients, a significant portion reported regular self-examination (78.6%) and mammograms (55.4%), with no family history of cancer (78.6%) (Table 4).
The histological and molecular characteristics of the tumors were mostly invasive ductal carcinoma (78.6%) and triple-negative (48.2%). Regarding HPV infection, the virus was detected in 35.7% of the tumors, all of which were HPV16, with the majority found in mixed form (65.0%) (Table 5)

3.2. Characteristics of HPV-Positive Samples

The HPV-positive samples were stratified by their histological type and the physical status of the virus (Table 6).
A substantial number of HPV-positive tumors were of the invasive ductal carcinoma type (75%), and a significant proportion of these tumor types exhibited HPV in its mixed form (66.6%). The second most detected tumor type, in which HPV was found, was ductal carcinoma in situ (20%), with half of them showing the virus in its integrated form and the other half in the mixed form. Only one of the HPV-positive tumors was of the invasive lobular carcinoma type, with the viral genome present in the mixed form.
The distribution of molecular breast cancer types was assessed among the HPV-positive samples across the different types of breast carcinoma. The triple-negative type was more frequent in invasive ductal carcinomas (77.7%). Only two HPV-positive tumors were of the ductal carcinoma in situ histological type, one was HER2-enriched, and the other was triple-negative. The single HPV-positive invasive lobular carcinoma was of the triple-negative molecular type (Table 7).

3.3. Evaluation of HPV Viral Load and E5 Protein Expression in Breast Tumors

The viral load and expression of the HPV16 oncoprotein E5 were evaluated concerning both the molecular types of breast cancer and the histological types of breast cancer (Figure 1A). The viral load of HPV16 found in the evaluated tumors was higher in the triple-negative molecular type, with one sample showing nearly 80 copies/cell (Figure 1A). However, regarding the expression of E5, this oncoprotein was more expressed in one of the HER2-enriched samples; however, HPV16 E5 also showed overexpression in triple-negative samples. Only in the luminal types did E5 show low expression (Figure 1B).
The distribution of the samples concerning viral load across the different histological subtypes showed a higher number of virus copies per cell in ductal carcinoma in situ tumors (with over 80 copies/cell), followed by invasive ductal carcinoma, and invasive lobular carcinoma tumors (Figure 2A). However, when assessing E5 expression, it was observed that the oncoprotein was less expressed in invasive lobular carcinoma. Conversely, E5 was more expressed in one of the ductal carcinoma in situ samples followed by samples of the invasive ductal carcinoma type. When evaluating which molecular types were associated with histological types, we observed that triple-negative tumors (the most frequent molecular type in our samples) had a higher E5 expression when associated with invasive ductal carcinoma type (Figure 2B).

4. Discussion

Breast cancer is a global health issue associated with risk factors, including lifestyle, genetic, and demographic factors [27,28]. Studies report that age, family history, use of oral contraceptives, menopausal status, and genetic factors are significantly linked to breast cancer [29,30]. Here, we evaluated these characteristics in 56 breast cancer patients from northeastern Brazil. Approximately 80% of the population affected by breast cancer is over 50 years of age [31,32,33]. In our samples, over 50% of patients are over 56 years of age, as observed in other studies [29,34].
Prolonged exposure to estrogen, as occurs in women with early menarche and puberty, as well as late menopause, can significantly increase the risk of breast cancer due to prolonged hormone exposure [35]. Here, we observed that most breast cancer patients experienced menarche between 11–14 years and menopause between 45–50 years. A study comparing women with and without breast cancer found no influence of these characteristics on breast cancer development [29]. Conversely, the use of oral contraceptives was considered an influential factor in the development of this type of cancer. However, in our study, the majority of patients did not use hormonal contraception, suggesting that, in our patients, this characteristic did not have a significant influence.
Pregnancy and breastfeeding are factors considered protective against the development of breast cancer [36,37]. We observed that the majority of patients evaluated here have between one and three children, with breastfeeding present in more than 50% of them. This result reinforces the existence of a variety of risk factors involved in breast carcinogenesis, indicating that this characteristic did not have a protective effect in most samples evaluated here.
Family history is a commonly associated risk factor in breast carcinogenesis, accounting for an average of 5 to 10% of cases [29,38]. It is believed that family history may influence other factors, including tumor stage and grade [38]. However, in our study, 78.53% of patients did not have cases of breast cancer in their family, indicating the association of other factors in the development of cancer in these patients.
The lack of knowledge of screening methods and self-examination practices in women detected in the Al-Dhahira population is a concerning characteristic [39]. Our study demonstrated that the majority of breast cancer patients perform self-examination and mammography. This characteristic is crucial for the earlier diagnosis of this neoplasm, assisting in the appropriate therapeutic direction for each specific case [40].
The molecular classification of breast cancer elucidates important issues for the treatment of the disease, such as prognosis and therapeutic alternatives [41]. Regarding the characterization of histological and molecular types of breast cancer, we observed that the majority of patients had invasive ductal carcinoma and triple-negative breast cancer, respectively. Invasive ductal carcinoma accounts for about 50% to 80% of diagnosed breast cancer cases [29,42].
Invasive breast cancers encompass a wide spectrum of tumors that exhibit heterogeneity in clinical and morphological characteristics [33]. Triple-negative breast cancer accounts for over 15–20% of all breast cancers and, by being negative for hormone receptors, becomes therapeutically challenging due to its low response to treatment and highly invasive nature, resulting in a worse prognosis for affected patients [31,43].
Studies suggest the plausible role of oncoviruses in the pathogenesis of breast cancer [44,45]. Different studies have reported the presence of HPV in percentages ranging from 1.1% to 86% [34,46,47,48,49]. In our study, we observed a prevalence of 35.71% of the virus in breast tumors, which falls within the wide spectrum of reported prevalence.
Despite studies showing significant percentages of virus detection, other studies have failed to even identify the presence of the virus [50,51]. The variability in percentage associated with the presence of HPV in breast tissue may be related to variable sampling and the diversity of tissue processing protocols applied, in addition to the variable prevalence of HPV in different populations worldwide [20,49,52,53].
We associated molecular and histological types with the presence of HPV and observed that the triple-negative type was more frequent in invasive ductal carcinomas (77.77%). In other studies, invasive ductal carcinoma was the most prevalent subtype of breast cancer, accounting for 56.25% of samples associated with HPV in El-Sheik et al.’s study [29]. Other studies report the presence of HPV in this histological type with percentages ranging from 18 to 83.33% [54,55].
In our samples, we identified only one HPV-positive invasive lobular carcinoma, also classified as a triple-negative molecular type. In contrast, another study observed a frequency of 25% of invasive lobular carcinomas in breast cancer samples positive for HPV [55].
Our study classified 45% (9/20) of HPV-positive samples as triple-negative breast cancer, followed by 20% of the HER2 overexpression type, and 5% of the luminal type. It has been observed that there is a higher presence of HPV DNA in triple-negative and HER2+ breast cancers compared to the luminal types [47]. Although HPV cannot yet be associated with a specific molecular type, the data supports the idea that HPV may be related to a more aggressive cancer phenotype.
The integration of HPV into the human genome is one of the main mechanisms for the development of cancer from this virus; however, the episomal form is still found in many cases of HPV-associated cancers, indicating that both forms may be related to the carcinogenic activity of the virus [56,57]. HPV integration occurs after a break in the E2 gene, which is the main repressor of the expression of the E6 and E7 oncogenes [56]. When present at high levels, E2 binds to the p97 promoter in the long control region (LCR) of HPV, preventing RNA polymerase II from binding to p97 and consequently repressing the expression of E6 and E7 [58,59,60]. The E2/E6 ratio thus becomes a commonly used parameter to characterize the physical status of the virus [61]
One study observed that, for the majority of evaluated samples, the E2/E6 ratio was less than 1, indicating that the HPV was in the mixed form [34]. Our study quantified the E2 protein to determine the physical status of the viral genome, and in 65% of the samples, a predominance of the mixed form (episomal and integrated) of the HPV was found. Other studies have reported that the HPV genome in breast cancer primarily presented in the integrated form, ranging from 86% to 100%, while one study detected the mixed form of the HPV in 8.3% of breast tumors [12,62].
All the HPV-positive samples were type 16, one of the main oncogenic risk types of the virus [16]. The highest percentage of virus positivity associated with HPV16 has also been reported in other studies [29,55]. HPV16 has been found mainly in more advanced breast tumors, grades II and III, potentially associated with a more aggressive cancer behavior [63].
In our study, the viral load of HPV16 reached 80 copies/cell in triple-negative tumor types. These data are significantly higher than those reported by other research, which suggests that the viral load found in breast tissue is low [18,64,65]. The HPV viral load is linked to the severity of lesions and cancer progression, and despite this, studies have shown that even one copy of the HPV genome per cell is sufficient to induce neoplastic transformations caused by the virus’s oncoproteins [66].
HPV oncoproteins can interact with pathways related to cell proliferation, angiogenesis, inflammation, and metastasis [67]. The E5 oncoprotein induces evasion of the immune system by negatively regulating MHC-I, and can also stimulate EGFR signaling pathways involved in cell growth and proliferation [17,68,69]. Here, we detected high expression of E5 in HER2 and triple-negative samples, confirming not only the presence but also the activity of the virus in patients with breast cancer.
Overall, studies related to HPV-mediated carcinogenesis typically involve analyses related to the E6 and E7 proteins [48,70,71]. However, in breast cancer, some studies have failed to detect the activity of these oncoproteins [72], while others have only found low expression in cases positive for HPV [70]. In this regard, it is suggested that the oncogenic activity of the HPV in breast cancer may be related to the E5 oncoprotein.
The presence of the HPV has been associated with increased inflammatory cytokines (IL-1, IL-6, IL-17, TGF-β, TNF-α, and NF-kB) and tumor progression [34]. Studies have demonstrated that a high expression of E5 can be found in cancer at higher pre-neoplastic and neoplastic grades [73,74,75]. A study conducted with triple-negative breast cancer cells MDA-MB-231 showed that TNF-α was stimulated by E5, reinforcing the activity of this oncoprotein in breast tumor cells [25].
Our study demonstrated a significant presence of HPV DNA in breast tumor samples, confirmed by both the amplification of the virus’s L1 region and activity indicated using gene expression analyses, particularly the E5 oncoprotein. These findings underscore a potential link between HPV and aggressive breast cancer subtypes, such as invasive ductal and triple-negative tumors, suggesting HPV’s involvement in breast carcinogenesis. However, the exact role of HPV in breast cancer remains to be fully elucidated. We encourage further studies with larger sample sizes and in other regions to contribute to this elucidation.

5. Conclusions

This study provides a comprehensive characterization of breast cancer risk factors in patients from northeastern Brazil, who are predominantly over 56 years of age and maintain healthy lifestyles. The significant detection of HPV in these samples and the association with specific tumor types highlight the virus’s potential impact on the pathogenesis of breast cancer. The high expression of the E5 oncoprotein in HPV-positive samples further emphasizes its potential as a target for further research. To determine the mechanisms by which HPV may influence breast cancer development and to explore novel preventative, diagnostic, and therapeutic strategies, additional studies involving larger and more diverse populations are crucial.

Author Contributions

Conceptualization, A.C.d.F., V.E.P.S. and B.d.F.S.M.; methodology, J.C.S.N., V.E.P.S., K.C.G.N., B.d.F.S.M., P.H.B.F., B.E.d.O.I., S.L.L., G.R.P.d.S., D.B.L. and D.L.d.S.; formal analysis, L.R.S.L., B.C.F.E., L.S.d.M., P.L.d.F.N. and A.J.D.S.; investigation, A.C.d.F., V.E.P.S., K.C.G.N. and B.d.F.S.M.; data curation, B.d.F.S.M. and V.E.P.S.; writing—original draft preparation B.d.F.S.M. and V.E.P.S.; writing—review and editing, V.E.P.S., K.C.G.N., B.d.F.S.M., P.H.B.F., B.E.d.O.I., S.L.L., G.R.P.d.S., D.B.L. and D.L.d.S.; supervision, A.C.d.F. and V.E.P.S.; project administration, A.C.d.F. and V.E.P.S.; funding acquisition A.C.d.F. and V.E.P.S. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPQ)/ Departamento de Ciência e Tecnologia da Secretaria de Ciência, Tecnologia, Inovação e Complexo da Saúde do Ministério da Saúde (MS) process number 444606/2023-8; CNPq/MS, process number 444156/2023-2; CNPq Bolsa Produtividade, grant number 308684/2023-0.

Institutional Review Board Statement

The study was conducted in accordance with the Declaration of Helsinki, and approved by the Research Ethics Committee of the Federal University of Pernambuco, Brazil (CAAE: 28508614.9.0000.5208—13 May 2014 and 06586612.9.0000.5208 14 February 2013).

Data Availability Statement

The data are available and can be accessed by contacting the corresponding author.

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. Wilkinson, L.; Gathani, T. Understanding Breast Cancer as a Global Health Concern. Br. J. Radiol. 2022, 95, 20211033. [Google Scholar] [CrossRef] [PubMed]
  2. Ferlay, J.; Colombet, M.; Soerjomataram, I.; Parkin, D.M.; Piñeros, M.; Znaor, A.; Bray, F. Cancer Statistics for the Year 2020: An Overview. Int. J. Cancer 2021, 149, 778–789. [Google Scholar] [CrossRef]
  3. Arnold, M.; Morgan, E.; Rumgay, H.; Mafra, A.; Singh, D.; Laversanne, M.; Vignat, J.; Gralow, J.R.; Cardoso, F.; Siesling, S.; et al. Current and Future Burden of Breast Cancer: Global Statistics for 2020 and 2040. The Breast 2022, 66, 15–23. [Google Scholar] [CrossRef] [PubMed]
  4. Harbeck, N.; Johnston, S.; Fasching, P.; Martin, M.; Toi, M.; Rastogi, P.; Song, C.; Molthrop, D.; Vuky, J.; Yamashita, T.; et al. Abstract PD2-01: High Ki-67 as a Biomarker for Identifying Patients with High Risk Early Breast Cancer Treated in monarchE. Cancer Res. 2021, 81, PD2-01-PD2-01. [Google Scholar] [CrossRef]
  5. Malhotra, G.K.; Zhao, X.; Band, H.; Band, V. Histological, Molecular and Functional Subtypes of Breast Cancers. Cancer Biol. Ther. 2010, 10, 955–960. [Google Scholar] [CrossRef] [PubMed]
  6. Johnson, K.S.; Conant, E.F.; Soo, M.S. Molecular Subtypes of Breast Cancer: A Review for Breast Radiologists. J. Breast Imaging 2021, 3, 12–24. [Google Scholar] [CrossRef] [PubMed]
  7. Akram, M.; Iqbal, M.; Daniyal, M.; Khan, A.U. Awareness and Current Knowledge of Breast Cancer. Biol. Res. 2017, 50, 33. [Google Scholar] [CrossRef]
  8. Kashyap, D.; Pal, D.; Sharma, R.; Garg, V.K.; Goel, N.; Koundal, D.; Zaguia, A.; Koundal, S.; Belay, A. Global Increase in Breast Cancer Incidence: Risk Factors and Preventive Measures. BioMed Res. Int. 2022, 2022, 1–16. [Google Scholar] [CrossRef] [PubMed]
  9. Kudela, E.; Kudelova, E.; Kozubík, E.; Rokos, T.; Pribulova, T.; Holubekova, V.; Biringer, K. HPV-Associated Breast Cancer: Myth or Fact? Pathogens 2022, 11, 1510. [Google Scholar] [CrossRef]
  10. Bruni, L.; Albero, G.; Rowley, J.; Alemany, L.; Arbyn, M.; Giuliano, A.R.; Markowitz, L.E.; Broutet, N.; Taylor, M. Global and Regional Estimates of Genital Human Papillomavirus Prevalence among Men: A Systematic Review and Meta-Analysis. Lancet Glob. Health 2023, 11, e1345–e1362. [Google Scholar] [CrossRef]
  11. Khoo, A.; Boyer, M.; Jafri, Z.; Makeham, T.; Pham, T.; Khachigian, L.M.; Floros, P.; Dowling, E.; Fedder, K.; Shonka, D.; et al. Human Papilloma Virus Positive Oropharyngeal Squamous Cell Carcinoma and the Immune System: Pathogenesis, Immunotherapy and Future Perspectives. Int. J. Mol. Sci. 2024, 25, 2798. [Google Scholar] [CrossRef]
  12. Islam, M.S.; Chakraborty, B.; Panda, C.K. Human Papilloma Virus (HPV) Profiles in Breast Cancer: Future Management. Ann. Transl. Med. 2020, 8, 650. [Google Scholar] [CrossRef] [PubMed]
  13. Lin, C.; Tsai, S.C.-S.; Huang, J.-Y.; Lin, F.C.-F. HPV Infection and Breast Cancer Risk: Insights from a Nationwide Population Study in Taiwan. Front. Oncol. 2023, 13, 1210381. [Google Scholar] [CrossRef] [PubMed]
  14. Arbyn, M.; Tommasino, M.; Depuydt, C.; Dillner, J. Are 20 Human Papillomavirus Types Causing Cervical Cancer? J. Pathol. 2014, 234, 431–435. [Google Scholar] [CrossRef] [PubMed]
  15. Bonde, J.; Bottari, F.; Iacobone, A.D.; Cocuzza, C.E.; Sandri, M.-T.; Bogliatto, F.; Khan, K.S.; Ejegod, D.M.; Gary, D.S.; Andrews, J.C. Human Papillomavirus Same Genotype Persistence and Risk: A Systematic Review. J. Low. Genit. Tract Dis. 2021, 25, 27–37. [Google Scholar] [CrossRef] [PubMed]
  16. Wendland, E.M.; Villa, L.L.; Unger, E.R.; Domingues, C.M.; Benzaken, A.S.; POP-Brazil Study Group; Maranhão, A.G.K.; Kops, N.L.; Bessel, M.; Caierão, J.; et al. Prevalence of HPV Infection among Sexually Active Adolescents and Young Adults in Brazil: The POP-Brazil Study. Sci. Rep. 2020, 10, 4920. [Google Scholar] [CrossRef] [PubMed]
  17. Basukala, O.; Banks, L. The Not-So-Good, the Bad and the Ugly: HPV E5, E6 and E7 Oncoproteins in the Orchestration of Carcinogenesis. Viruses 2021, 13, 1892. [Google Scholar] [CrossRef]
  18. Lawson, J.S.; Glenn, W.K.; Salyakina, D.; Delprado, W.; Clay, R.; Antonsson, A.; Heng, B.; Miyauchi, S.; Tran, D.D.; Ngan, C.C.; et al. Human Papilloma Viruses and Breast Cancer. Front. Oncol. 2015, 5. [Google Scholar] [CrossRef] [PubMed]
  19. Suominen, N.T.; Luukkaala, T.H.; Laprise, C.; Haataja, M.A.; Grénman, S.E.; Syrjänen, S.M.; Louvanto, K. Human Papillomavirus Concordance Between Parents and Their Newborn Offspring: Results From the Finnish Family Human Papillomavirus Study. J. Infect. Dis. 2024, 229, 448–456. [Google Scholar] [CrossRef]
  20. Karachalios, C.; Petousis, S.; Margioula-Siarkou, C.; Dinas, K. Human Papillomaviruses and Breast Cancer: A Systematic Review and Meta-analysis. Oncol. Lett. 2023, 27, 75. [Google Scholar] [CrossRef]
  21. Baldez Da Silva, M.F.P.T.; Chagas, B.S.; Guimares, V.; Katz, L.M.C.; Felix, P.M.; Miranda, P.M.; Lima, A.A.; Arraes, L.C.; Martins, D.B.G.; Lima Filho, J.L.; et al. HPV31 and HPV33 Incidence in Cervical Samples from Women in Recife, Brazil. Genet. Mol. Res. 2009, 8, 1437–1443. [Google Scholar] [CrossRef] [PubMed]
  22. Manos, M., M.; Ting, T.; Wright, D., K.; Lewis, A., J.; Broker, T., R.; Wolinsky, S., M. The Use of Polymerase Chain Reaction Amplification for the Detection of Genital Human Papillomavirus. Cancer Cells 1989, 7, 209–214. [Google Scholar]
  23. De Roda Husman, A.-M.; Walboomers, J.M.M.; Van Den Brule, A.J.C.; Meijer, C.J.L.M.; Snijders, P.J.F. The Use of General Primers GP5 and GP6 Elongated at Their 3’ Ends with Adjacent Highly Conserved Sequences Improves Human Papillomavirus Detection by PCR. J. Gen. Virol. 1995, 76, 1057–1062. [Google Scholar] [CrossRef]
  24. Peitsaro, P.; Johansson, B.; Syrjänen, S. Integrated Human Papillomavirus Type 16 Is Frequently Found in Cervical Cancer Precursors as Demonstrated by a Novel Quantitative Real-Time PCR Technique. J. Clin. Microbiol. 2002, 40, 886–891. [Google Scholar] [CrossRef] [PubMed]
  25. Santos, D.L.; São Marcos, B.D.F.; De Sousa, G.F.; Cruz, L.C.D.O.; Barros, B.R.D.S.; Nogueira, M.C.D.B.L.; Oliveira, T.H.D.A.; Silva, A.J.D.; Santos, V.E.P.; De Melo, C.M.L.; et al. Immunological Response against Breast Lineage Cells Transfected with Human Papillomavirus (HPV). Viruses 2024, 16, 717. [Google Scholar] [CrossRef] [PubMed]
  26. Hellemans, J.; Mortier, G.; De Paepe, A.; Speleman, F.; Vandesompele, J. qBase relative quantification framework and software for management and automated analysis of real-time quantitative PCR data. Genome Biol. 2007, 8, R19. [Google Scholar] [CrossRef] [PubMed]
  27. Nicolis, O.; De Los Angeles, D.; Taramasco, C. A Contemporary Review of Breast Cancer Risk Factors and the Role of Artificial Intelligence. Front. Oncol. 2024, 14, 1356014. [Google Scholar] [CrossRef]
  28. Roheel, A.; Khan, A.; Anwar, F.; Akbar, Z.; Akhtar, M.F.; Imran Khan, M.; Sohail, M.F.; Ahmad, R. Global Epidemiology of Breast Cancer Based on Risk Factors: A Systematic Review. Front. Oncol. 2023, 13, 1240098. [Google Scholar] [CrossRef] [PubMed]
  29. El-Sheikh, N.; Mousa, N.O.; Tawfeik, A.M.; Saleh, A.M.; Elshikh, I.; Deyab, M.; Ragheb, F.; Moneer, M.M.; Kawashti, A.; Osman, A.; et al. Assessment of Human Papillomavirus Infection and Risk Factors in Egyptian Women With Breast Cancer. Breast Cancer Basic Clin. Res. 2021, 15, 117822342199627. [Google Scholar] [CrossRef]
  30. Fakhri, N.; Chad, M.A.; Lahkim, M.; Houari, A.; Dehbi, H.; Belmouden, A.; El Kadmiri, N. Risk Factors for Breast Cancer in Women: An Update Review. Med. Oncol. 2022, 39, 197. [Google Scholar] [CrossRef]
  31. Almansour, N.M. Triple-Negative Breast Cancer: A Brief Review About Epidemiology, Risk Factors, Signaling Pathways, Treatment and Role of Artificial Intelligence. Front. Mol. Biosci. 2022, 9, 836417. [Google Scholar] [CrossRef]
  32. Donepudi, M.; Kondapalli, K.; Amos, S.; Venkanteshan, P. Breast Cancer Statistics and Markers. J. Cancer Res. Ther. 2014, 10, 506. [Google Scholar] [CrossRef] [PubMed]
  33. Łukasiewicz, S.; Czeczelewski, M.; Forma, A.; Baj, J.; Sitarz, R.; Stanisławek, A. Breast Cancer—Epidemiology, Risk Factors, Classification, Prognostic Markers, and Current Treatment Strategies—An Updated Review. Cancers 2021, 13, 4287. [Google Scholar] [CrossRef] [PubMed]
  34. Khodabandehlou, N.; Mostafaei, S.; Etemadi, A.; Ghasemi, A.; Payandeh, M.; Hadifar, S.; Norooznezhad, A.H.; Kazemnejad, A.; Moghoofei, M. Human Papilloma Virus and Breast Cancer: The Role of Inflammation and Viral Expressed Proteins. BMC Cancer 2019, 19, 61. [Google Scholar] [CrossRef] [PubMed]
  35. Admoun, C.; Mayrovitz, H.N. The Etiology of Breast Cancer. In Breast Cancer; Exon Publications; Mayrovitz, H.N., Ed.; Exon Publications: Brisbane, QLD, Australia, 2022; pp. 21–30. ISBN 978-0-645-33203-2. [Google Scholar]
  36. Migliavacca Zucchetti, B.; Peccatori, F.A.; Codacci-Pisanelli, G. Pregnancy and Lactation: Risk or Protective Factors for Breast Cancer? In Diseases of the Breast during Pregnancy and Lactation; Alipour, S., Omranipour, R., Eds.; Advances in Experimental Medicine and Biology; Springer International Publishing: Cham, Germany, 2020; Volume 1252, pp. 195–197. ISBN 978-3-030-41595-2. [Google Scholar]
  37. Stordal, B. Breastfeeding Reduces the Risk of Breast Cancer: A Call for Action in High-income Countries with Low Rates of Breastfeeding. Cancer Med. 2023, 12, 4616–4625. [Google Scholar] [CrossRef] [PubMed]
  38. Liu, L.; Hao, X.; Song, Z.; Zhi, X.; Zhang, S.; Zhang, J. Correlation between Family History and Characteristics of Breast Cancer. Sci. Rep. 2021, 11, 6360. [Google Scholar] [CrossRef] [PubMed]
  39. Al-Ismaili, Z.; Al-Nasri, K.; Al-Yaqoobi, A.; Al-Shukaili, A. Awareness of Breast Cancer Risk Factors, Symptoms and Breast Self-Examination Among Omani Female Teachers: A Cross-Sectional Study. Sultan Qaboos Univ. Med. J. 2020, 20, e194–e201. [Google Scholar] [CrossRef] [PubMed]
  40. Albeshan, S.M.; Hossain, S.Z.; Mackey, M.G.; Brennan, P.C. Can Breast Self-Examination and Clinical Breast Examination Along With Increasing Breast Awareness Facilitate Earlier Detection of Breast Cancer in Populations With Advanced Stages at Diagnosis? Clin. Breast Cancer 2020, 20, 194–200. [Google Scholar] [CrossRef] [PubMed]
  41. Rakha, E.A.; Tse, G.M.; Quinn, C.M. An Update on the Pathological Classification of Breast Cancer. Histopathology 2023, 82, 5–16. [Google Scholar] [CrossRef]
  42. Zhao, H. The Prognosis of Invasive Ductal Carcinoma, Lobular Carcinoma and Mixed Ductal and Lobular Carcinoma According to Molecular Subtypes of the Breast. Breast Cancer 2021, 28, 187–195. [Google Scholar] [CrossRef]
  43. Zagami, P.; Carey, L.A. Triple Negative Breast Cancer: Pitfalls and Progress. Npj Breast Cancer 2022, 8, 95. [Google Scholar] [CrossRef] [PubMed]
  44. Richardson, A.K.; Walker, L.C.; Cox, B.; Rollag, H.; Robinson, B.A.; Morrin, H.; Pearson, J.F.; Potter, J.D.; Paterson, M.; Surcel, H.-M.; et al. Breast Cancer and Cytomegalovirus. Clin. Transl. Oncol. 2020, 22, 585–602. [Google Scholar] [CrossRef] [PubMed]
  45. Saif, I.; Ennaji, Y.; El Mzibri, M.; Ennaji, M.M. Infection of HPV and MMTV Oncovirus in Breast Cancer Tissues in Women. In Oncogenic Viruses; Elsevier: Amsterdam, The Netherlands, 2023; pp. 49–70. ISBN ISBN 978-0-12-824152-3. [Google Scholar]
  46. Awan, U.A.; Khattak, A.A.; Ahmed, N.; Guo, X.; Akhtar, S.; Kamran, S.; Yongjing, Z.; Liu, J.; Khan, S. An Updated Systemic Review and Meta-Analysis on Human Papillomavirus in Breast Carcinogenesis. Front. Oncol. 2023, 13, 1219161. [Google Scholar] [CrossRef] [PubMed]
  47. De Carolis, S.; Storci, G.; Ceccarelli, C.; Savini, C.; Gallucci, L.; Sansone, P.; Santini, D.; Seracchioli, R.; Taffurelli, M.; Fabbri, F.; et al. HPV DNA Associates With Breast Cancer Malignancy and It Is Transferred to Breast Cancer Stromal Cells by Extracellular Vesicles. Front. Oncol. 2019, 9, 860. [Google Scholar] [CrossRef] [PubMed]
  48. Salman, N.A.; Davies, G.; Majidy, F.; Shakir, F.; Akinrinade, H.; Perumal, D.; Ashrafi, G.H. Association of High Risk Human Papillomavirus and Breast Cancer: A UK Based Study. Sci. Rep. 2017, 7, 43591. [Google Scholar] [CrossRef] [PubMed]
  49. Wang, T.; Chang, P.; Wang, L.; Yao, Q.; Guo, W.; Chen, J.; Yan, T.; Cao, C. The Role of Human Papillomavirus Infection in Breast Cancer. Med. Oncol. 2012, 29, 48–55. [Google Scholar] [CrossRef] [PubMed]
  50. Ateek, G.N.; Leon, M.; Hernandez Gonzalo, D.; Stewart, B.; Petty, D. Exploring HPV as an Etiologic Factor for Breast Cancer. Am. J. Clin. Pathol. 2023, 160, S10–S11. [Google Scholar] [CrossRef]
  51. Kouloura, A.; Nicolaidou, E.; Misitzis, I.; Panotopoulou, E.; Kassiani, T.; Smyrniotis, V.; Corso, G.; Veronesi, P.; Arkadopoulos, N. HPV Infection and Breast Cancer. Results of a Microarray Approach. The Breast 2018, 40, 165–169. [Google Scholar] [CrossRef]
  52. Cavalcante, J.R.; Pinheiro, L.G.P.; De Almeida, P.R.C.; Ferreira, M.V.P.; Cruz, G.A.; Campelo, T.A.; Silva, C.S.; Lima, L.N.G.C.; De Oliveira, B.M.K.; Lima, L.M.; et al. Association of Breast Cancer with Human Papillomavirus (HPV) Infection in Northeast Brazil: Molecular Evidence. Clinics 2018, 73, e465. [Google Scholar] [CrossRef]
  53. Nechifor-Boilă, A.; Banescu, C.; Zahan, A.E.; Moldovan, V.; Szasz, E.; Borda, A. DNA Isolation from Achieved Formalin-Fixed Paraffin-Embedded Tissues in a Series of 212 Thyroid Carcinoma Cases: The Influence of Preanalytical Factors on DNA Quantity and Purity. J. Investig. Med. 2020, 68, 792–798. [Google Scholar] [CrossRef]
  54. Fernandes, A.; Bianchi, G.; Feltri, A.P.; Pérez, M.; Correnti, M. Presence of Human Papillomavirus in Breast Cancer and Its Association with Prognostic Factors. Ecancermedicalscience 2015, 9, 548. [Google Scholar] [CrossRef] [PubMed]
  55. Maldonado-Rodríguez, E.; Hernández-Barrales, M.; Reyes-López, A.; Godina-González, S.; Gallegos-Flores, P.I.; Esparza-Ibarra, E.L.; González-Curiel, I.E.; Aguayo-Rojas, J.; López-Saucedo, A.; Mendoza-Almanza, G.; et al. Presence of Human Papillomavirus DNA in Malignant Neoplasia and Non-Malignant Breast Disease. Curr. Issues Mol. Biol. 2022, 44, 3648–3665. [Google Scholar] [CrossRef]
  56. Oyervides-Muñoz, M.A.; Pérez-Maya, A.A.; Rodríguez-Gutiérrez, H.F.; Gómez-Macias, G.S.; Fajardo-Ramírez, O.R.; Treviño, V.; Barrera-Saldaña, H.A.; Garza-Rodríguez, M.L. Understanding the HPV Integration and Its Progression to Cervical Cancer. Infect. Genet. Evol. 2018, 61, 134–144. [Google Scholar] [CrossRef] [PubMed]
  57. Rossi, N.M.; Dai, J.; Xie, Y.; Wangsa, D.; Heselmeyer-Haddad, K.; Lou, H.; Boland, J.F.; Yeager, M.; Orozco, R.; Freites, E.A.; et al. Extrachromosomal Amplification of Human Papillomavirus Episomes Is a Mechanism of Cervical Carcinogenesis. Cancer Res. 2023, 83, 1768–1781. [Google Scholar] [CrossRef] [PubMed]
  58. Araldi, R.P.; Assaf, S.M.R.; Carvalho, R.F.D.; Carvalho, M.A.C.R.D.; Souza, J.M.D.; Magnelli, R.F.; Módolo, D.G.; Roperto, F.P.; Stocco, R.D.C.; Beçak, W. Papillomaviruses: A Systematic Review. Genet. Mol. Biol. 2017, 40, 1–21. [Google Scholar] [CrossRef] [PubMed]
  59. Gheit, T. Mucosal and Cutaneous Human Papillomavirus Infections and Cancer Biology. Front. Oncol. 2019, 9, 355. [Google Scholar] [CrossRef] [PubMed]
  60. Graham, S.V. The Human Papillomavirus Replication Cycle, and Its Links to Cancer Progression: A Comprehensive Review. Clin. Sci. 2017, 131, 2201–2221. [Google Scholar] [CrossRef] [PubMed]
  61. Cricca, M.; Morselli-Labate, A.M.; Venturoli, S.; Ambretti, S.; Gentilomi, G.A.; Gallinella, G.; Costa, S.; Musiani, M.; Zerbini, M. Viral DNA Load, Physical Status and E2/E6 Ratio as Markers to Grade HPV16 Positive Women for High-Grade Cervical Lesions. Gynecol. Oncol. 2007, 106, 549–557. [Google Scholar] [CrossRef] [PubMed]
  62. Khan, N.A.; Castillo, A.; Koriyama, C.; Kijima, Y.; Umekita, Y.; Ohi, Y.; Higashi, M.; Sagara, Y.; Yoshinaka, H.; Tsuji, T.; et al. Human Papillomavirus Detected in Female Breast Carcinomas in Japan. Br. J. Cancer 2008, 99, 408–414. [Google Scholar] [CrossRef]
  63. Elagali, A.M.; Suliman, A.A.; Altayeb, M.; Dannoun, A.I.; Parine, N.R.; Sakr, H.I.; Suliman, H.S.; Motawee, M.E. Human Papillomavirus, Gene Mutation and Estrogen and Progesterone Receptors in Breast Cancer: A Cross-Sectional Study. Pan Afr. Med. J. 2021, 38. [Google Scholar] [CrossRef]
  64. Fu, L.; Wang, D.; Shah, W.; Wang, Y.; Zhang, G.; He, J. Association of Human Papillomavirus Type 58 with Breast Cancer in Shaanxi Province of China. J. Med. Virol. 2015, 87, 1034–1040. [Google Scholar] [CrossRef] [PubMed]
  65. Herrera-Romano, L.; Fernández-Tamayo, N.; Gómez-Conde, E.; Reyes-Cardoso, J.M.; Ortiz-Gutierrez, F.; Ceballos, G.; Valdivia, A.; Piña, P.; Salcedo, M. Absence of Human Papillomavirus Sequences in Epithelial Breast Cancer in a Mexican Female Population. Med. Oncol. 2012, 29, 1515–1517. [Google Scholar] [CrossRef] [PubMed]
  66. Duan, L.; Du, H.; Wang, C.; Huang, X.; Qu, X.; Shi, B.; Liu, Y.; Zhang, W.; Duan, X.; Wei, L.; et al. The Effectiveness of HPV Viral Load, Reflected by Cobas 4800 HPV-Ct Values for the Triage of HPV-Positive Women in Primary Cervical Cancer Screening: Direct Endocervical Samples. PLOS ONE 2020, 15, e0232107. [Google Scholar] [CrossRef] [PubMed]
  67. Medda, A.; Duca, D.; Chiocca, S. Human Papillomavirus and Cellular Pathways: Hits and Targets. Pathogens 2021, 10, 262. [Google Scholar] [CrossRef]
  68. Basto, D.L.; Chaves, C.B.P.; Felix, S.P.; Amaro-Filho, S.M.; Vieira, V.C.; Martins, L.F.L.; De Carvalho, N.A.; Almeida, L.M.; Moreira, M.Â.M. The Papillomavirus E5 Gene Does Not Affect EGFR Transcription and Overall Survival in Cervical Cancer. J. Med. Virol. 2020, 92, 1283–1289. [Google Scholar] [CrossRef]
  69. Campo, M.S.; Graham, S.V.; Cortese, M.S.; Ashrafi, G.H.; Araibi, E.H.; Dornan, E.S.; Miners, K.; Nunes, C.; Man, S. HPV-16 E5 down-Regulates Expression of Surface HLA Class I and Reduces Recognition by CD8 T Cells. Virology 2010, 407, 137–142. [Google Scholar] [CrossRef]
  70. Islam, S.; Dasgupta, H.; Roychowdhury, A.; Bhattacharya, R.; Mukherjee, N.; Roy, A.; Mandal, G.K.; Alam, N.; Biswas, J.; Mandal, S.; et al. Study of Association and Molecular Analysis of Human Papillomavirus in Breast Cancer of Indian Patients: Clinical and Prognostic Implication. PLOS ONE 2017, 12, e0172760. [Google Scholar] [CrossRef]
  71. Yasmeen, A.; Bismar, T.A.; Kandouz, M.; Foulkes, W.D.; Desprez, P.-Y.; Al Moustafa, A.-E. E6/E7 of HPV Type 16 Promotes Cell Invasion and Metastasis of Human Breast Cancer Cells. Cell Cycle 2007, 6, 2038–2042. [Google Scholar] [CrossRef]
  72. Frega, A.; Lorenzon, L.; Bononi, M.; De Cesare, A.; Ciardi, A.; Lombardi, D.; Assorgi, C.; Gentile, M.; Moscarini, M.; Torrisi, M.R.; et al. Evaluation of E6 and E7 mRNA Expression in HPV DNA Positive Breast Cancer. Eur. J. Gynaecol. Oncol. 2012, 33, 164–167. [Google Scholar]
  73. Chen, J.; Xue, Y.; Poidinger, M.; Lim, T.; Chew, S.H.; Pang, C.L.; Abastado, J.-P.; Thierry, F. Mapping of HPV Transcripts in Four Human Cervical Lesions Using RNAseq Suggests Quantitative Rearrangements during Carcinogenic Progression. Virology 2014, 462–463, 14–24. [Google Scholar] [CrossRef]
  74. Häfner, N.; Driesch, C.; Gajda, M.; Jansen, L.; Kirchmayr, R.; Runnebaum, I.B.; Dürst, M. Integration of the HPV16 Genome Does Not Invariably Result in High Levels of Viral Oncogene Transcripts. Oncogene 2008, 27, 1610–1617. [Google Scholar] [CrossRef] [PubMed]
  75. Sahab, Z.; Sudarshan, S.R.; Liu, X.; Zhang, Y.; Kirilyuk, A.; Kamonjoh, C.M.; Simic, V.; Dai, Y.; Byers, S.W.; Doorbar, J.; et al. Quantitative Measurement of Human Papillomavirus Type 16 E5 Oncoprotein Levels in Epithelial Cell Lines by Mass Spectrometry. J. Virol. 2012, 86, 9465–9473. [Google Scholar] [CrossRef] [PubMed]
Cells 13 01132 g001
Figure 1. Distribution of viral load and E5 expression across tumor molecular subtypes. (A) Comparation of total viral load across different molecular subtypes of tumors: luminal, HER2-enriched, and triple-negative. (B). E5 mRNA expression across different molecular subtypes of tumors: luminal, HER2-enriched, and triple-negative.
Figure 1. Distribution of viral load and E5 expression across tumor molecular subtypes. (A) Comparation of total viral load across different molecular subtypes of tumors: luminal, HER2-enriched, and triple-negative. (B). E5 mRNA expression across different molecular subtypes of tumors: luminal, HER2-enriched, and triple-negative.
Cells 13 01132 g001
Cells 13 01132 g002
Figure 2. Distribution of viral load and E5 expression across tumor histological subtypes and molecular Subtypes. (A) Comparation of total viral load among different types of carcinomas: invasive ductal carcinoma, ductal carcinoma in situ, and invasive lobular carcinoma. (B) E5 mRNA expression among different types of carcinomas: invasive ductal carcinoma, ductal carcinoma in situ, and invasive lobular carcinoma. The samples highlighted in yellow represent triple-negative tumors.
Figure 2. Distribution of viral load and E5 expression across tumor histological subtypes and molecular Subtypes. (A) Comparation of total viral load among different types of carcinomas: invasive ductal carcinoma, ductal carcinoma in situ, and invasive lobular carcinoma. (B) E5 mRNA expression among different types of carcinomas: invasive ductal carcinoma, ductal carcinoma in situ, and invasive lobular carcinoma. The samples highlighted in yellow represent triple-negative tumors.
Cells 13 01132 g002
Table 1. Primers used for the detection of HPV in breast tumors.
Table 1. Primers used for the detection of HPV in breast tumors.
GeneSequenceSize (pb)Reference
β-globinPC04ACACAACTGTGTTCACTAGC110 bpBaldez et al. [21]
GH20CAACTTCATCCACGTTCACC0
L1-HPVMY09CGTCCMARRGGAWACTGATC450 bpManos et al. [22]
MY11GCMCAGGGWCATAAYAATGG
GP5TTTGTTACTGTGGTAGATAC150 bpde Roda Husman et al. [23]
GP6GAAAAATAAACTGTAAATCA
Table 2. Patient characteristics.
Table 2. Patient characteristics.
CharacteristicsN(%)
Age
<5527 (48.2)
>5629 (51.8)
IBM
Underweight2 (4.2)
Normal Weight22 (45.8)
Overweight14 (29.2)
Obesity10 (20.8)
Smoking
Yes13 (23.2)
No37 (66.1)
Previous smoker6 (10.6)
Co-morbidity
Hypertension
Yes22 (39.3)
No34 (60.7)
Diabetes mellitus
Yes5 (8.9)
No51 (91.1)
Table 3. Characteristics of patients regarding gynecological status.
Table 3. Characteristics of patients regarding gynecological status.
CharacteristicsN(%)
Age of first menstruation
08–10 years old3 (5.3)
11–14 years old38 (67.8)
15–17 years old14 (25.0)
Older than 18 years old1 (1.8)
Menopause Age
<40 years old3 (5.3)
40–45 years old6 (10.7)
45–50 years old20 (35.7)
>50 years old11 (19.6)
Not in menopause16 (28.6)
Number of pregnancy
1–3 children28 (50.0)
4–7 children14 (25.0)
>8 children7 (12.5)
No children7 (12.5)
Age of first pregnancy
12–17 years old6 (12.2)
18–27 years old36 (73.5)
>28 years old7 (14.3)
Breastfeeding
Yes31 (55.4)
No25 (44.7)
Use of contraceptive
Yes26 (46.4)
No30 (53.6)
Table 4. Characteristics of patients regarding breast cancer screening.
Table 4. Characteristics of patients regarding breast cancer screening.
CharacteristicsN(%)
Self-examination
Yes44 (78.6)
No12 (21.4)
Mammography
Yes31 (55.4)
No25 (44.7)
Family history
Yes12 (21.4)
No44 (78.6)
Table 5. Characteristics of tumors in patients with breast cancer.
Table 5. Characteristics of tumors in patients with breast cancer.
CharacteristicsN(%)
Histological Type
Ductal carcinoma in situ8 (14.3)
Invasive Ductal carcinoma44 (78.6)
Invasive Lobular Carcinoma1 (1.8)
Medullary carcinoma1 (1.8)
Mucinous carcinoma1 (1.8)
Fibroadenoma1 (1.8)
Molecular type
Luminal10 (17.9)
HER2-enriched6 (10.7)
triple-negative27 (48.2)
not-identified13 (23.2)
HPV infection
Yes20 (35.7)
No36 (64.3)
Physical Status
Episomal3 (15.0)
Integrated4 (20.0)
Mixed13 (65.0)
Table 6. Histological stratification of HPV-positive samples and their physical status.
Table 6. Histological stratification of HPV-positive samples and their physical status.
Positive HPV x Histological Type
Ductal Carcinoma In SituInvasive Ductal CarcinomaInvasive Lobular Carcinoma
N(%)4 (20.00)15 (75.00)1 (5.00)
Physical StatusEpisomeIntegratedMixedEpisomeIntegratedMixedEpisomeIntegratedMixed
N
(%)		02
(50.0)		2 (50.0)3
(20.0)		2
(13.3)		10
9 (66.6)		001
(100.0)
Table 7. Distribution among the different molecular types and histological types of HPV-positive breast cancer.
Table 7. Distribution among the different molecular types and histological types of HPV-positive breast cancer.
Ductal Carcinoma In Situ N (%) Invasive Ductal Carcinoma
N (%) 		Invasive Lobular Carcinoma N (%)
Luminal0 (0.0)1 (11.1)0 (0.0)
HER2-enriched1 (50.0)1 (11.1)0 (0.0)
Triple-negative1 (50.0)7 (77.7)1 (100.0)
Total2 (100.0)9 (100.0)1 (100.0)
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Nascimento, K.C.G.; São Marcos, B.d.F.; Fontes, P.H.B.; Isídio, B.E.d.O.; Leão, S.L.; da Silva, G.R.P.; Lussón, D.B.; dos Santos, D.L.; Leal, L.R.S.; Espinoza, B.C.F.; et al. HPV Detection in Breast Tumors and Associated Risk Factors in Northeastern Brazil. Cells 2024, 13, 1132. https://doi.org/10.3390/cells13131132

AMA Style

Nascimento KCG, São Marcos BdF, Fontes PHB, Isídio BEdO, Leão SL, da Silva GRP, Lussón DB, dos Santos DL, Leal LRS, Espinoza BCF, et al. HPV Detection in Breast Tumors and Associated Risk Factors in Northeastern Brazil. Cells. 2024; 13(13):1132. https://doi.org/10.3390/cells13131132

Chicago/Turabian Style

Nascimento, Kamylla Conceição Gomes, Bianca de França São Marcos, Pedro Henrique Bezerra Fontes, Beatriz Eda de Oliveira Isídio, Stephanie Loureiro Leão, Gabriel Romulo Parente da Silva, David Beltrán Lussón, Daffany Luana dos Santos, Lígia Rosa Sales Leal, Benigno Cristofer Flores Espinoza, and et al. 2024. "HPV Detection in Breast Tumors and Associated Risk Factors in Northeastern Brazil" Cells 13, no. 13: 1132. https://doi.org/10.3390/cells13131132

APA Style

Nascimento, K. C. G., São Marcos, B. d. F., Fontes, P. H. B., Isídio, B. E. d. O., Leão, S. L., da Silva, G. R. P., Lussón, D. B., dos Santos, D. L., Leal, L. R. S., Espinoza, B. C. F., de Macêdo, L. S., de França Neto, P. L., Silva, A. J. D., Silva Neto, J. C., Santos, V. E. P., & de Freitas, A. C. (2024). HPV Detection in Breast Tumors and Associated Risk Factors in Northeastern Brazil. Cells, 13(13), 1132. https://doi.org/10.3390/cells13131132

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop