HPV Detection in Breast Tumors and Associated Risk Factors in Northeastern Brazil
Abstract
1. Introduction
2. Materials and Methods
2.1. Sample Population
2.2. DNA Extraction and HPV Detection
2.3. Genotyping
2.4. Physical Status and Viral Load
2.5. RNA Extraction and cDNA Synthesis
2.6. Quantitative Real-Time PCR (RT-qPCR)
2.7. Statistical Analysis
3. Results
3.1. Analysis of Clinical and Sociodemographic Characteristics
3.2. Characteristics of HPV-Positive Samples
3.3. Evaluation of HPV Viral Load and E5 Protein Expression in Breast Tumors
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Data Availability Statement
Conflicts of Interest
References
- Wilkinson, L.; Gathani, T. Understanding Breast Cancer as a Global Health Concern. Br. J. Radiol. 2022, 95, 20211033. [Google Scholar] [CrossRef] [PubMed]
- Ferlay, J.; Colombet, M.; Soerjomataram, I.; Parkin, D.M.; Piñeros, M.; Znaor, A.; Bray, F. Cancer Statistics for the Year 2020: An Overview. Int. J. Cancer 2021, 149, 778–789. [Google Scholar] [CrossRef]
- Arnold, M.; Morgan, E.; Rumgay, H.; Mafra, A.; Singh, D.; Laversanne, M.; Vignat, J.; Gralow, J.R.; Cardoso, F.; Siesling, S.; et al. Current and Future Burden of Breast Cancer: Global Statistics for 2020 and 2040. The Breast 2022, 66, 15–23. [Google Scholar] [CrossRef] [PubMed]
- Harbeck, N.; Johnston, S.; Fasching, P.; Martin, M.; Toi, M.; Rastogi, P.; Song, C.; Molthrop, D.; Vuky, J.; Yamashita, T.; et al. Abstract PD2-01: High Ki-67 as a Biomarker for Identifying Patients with High Risk Early Breast Cancer Treated in monarchE. Cancer Res. 2021, 81, PD2-01-PD2-01. [Google Scholar] [CrossRef]
- Malhotra, G.K.; Zhao, X.; Band, H.; Band, V. Histological, Molecular and Functional Subtypes of Breast Cancers. Cancer Biol. Ther. 2010, 10, 955–960. [Google Scholar] [CrossRef] [PubMed]
- Johnson, K.S.; Conant, E.F.; Soo, M.S. Molecular Subtypes of Breast Cancer: A Review for Breast Radiologists. J. Breast Imaging 2021, 3, 12–24. [Google Scholar] [CrossRef] [PubMed]
- Akram, M.; Iqbal, M.; Daniyal, M.; Khan, A.U. Awareness and Current Knowledge of Breast Cancer. Biol. Res. 2017, 50, 33. [Google Scholar] [CrossRef]
- Kashyap, D.; Pal, D.; Sharma, R.; Garg, V.K.; Goel, N.; Koundal, D.; Zaguia, A.; Koundal, S.; Belay, A. Global Increase in Breast Cancer Incidence: Risk Factors and Preventive Measures. BioMed Res. Int. 2022, 2022, 1–16. [Google Scholar] [CrossRef] [PubMed]
- Kudela, E.; Kudelova, E.; Kozubík, E.; Rokos, T.; Pribulova, T.; Holubekova, V.; Biringer, K. HPV-Associated Breast Cancer: Myth or Fact? Pathogens 2022, 11, 1510. [Google Scholar] [CrossRef]
- Bruni, L.; Albero, G.; Rowley, J.; Alemany, L.; Arbyn, M.; Giuliano, A.R.; Markowitz, L.E.; Broutet, N.; Taylor, M. Global and Regional Estimates of Genital Human Papillomavirus Prevalence among Men: A Systematic Review and Meta-Analysis. Lancet Glob. Health 2023, 11, e1345–e1362. [Google Scholar] [CrossRef]
- Khoo, A.; Boyer, M.; Jafri, Z.; Makeham, T.; Pham, T.; Khachigian, L.M.; Floros, P.; Dowling, E.; Fedder, K.; Shonka, D.; et al. Human Papilloma Virus Positive Oropharyngeal Squamous Cell Carcinoma and the Immune System: Pathogenesis, Immunotherapy and Future Perspectives. Int. J. Mol. Sci. 2024, 25, 2798. [Google Scholar] [CrossRef]
- Islam, M.S.; Chakraborty, B.; Panda, C.K. Human Papilloma Virus (HPV) Profiles in Breast Cancer: Future Management. Ann. Transl. Med. 2020, 8, 650. [Google Scholar] [CrossRef] [PubMed]
- Lin, C.; Tsai, S.C.-S.; Huang, J.-Y.; Lin, F.C.-F. HPV Infection and Breast Cancer Risk: Insights from a Nationwide Population Study in Taiwan. Front. Oncol. 2023, 13, 1210381. [Google Scholar] [CrossRef] [PubMed]
- Arbyn, M.; Tommasino, M.; Depuydt, C.; Dillner, J. Are 20 Human Papillomavirus Types Causing Cervical Cancer? J. Pathol. 2014, 234, 431–435. [Google Scholar] [CrossRef] [PubMed]
- Bonde, J.; Bottari, F.; Iacobone, A.D.; Cocuzza, C.E.; Sandri, M.-T.; Bogliatto, F.; Khan, K.S.; Ejegod, D.M.; Gary, D.S.; Andrews, J.C. Human Papillomavirus Same Genotype Persistence and Risk: A Systematic Review. J. Low. Genit. Tract Dis. 2021, 25, 27–37. [Google Scholar] [CrossRef] [PubMed]
- Wendland, E.M.; Villa, L.L.; Unger, E.R.; Domingues, C.M.; Benzaken, A.S.; POP-Brazil Study Group; Maranhão, A.G.K.; Kops, N.L.; Bessel, M.; Caierão, J.; et al. Prevalence of HPV Infection among Sexually Active Adolescents and Young Adults in Brazil: The POP-Brazil Study. Sci. Rep. 2020, 10, 4920. [Google Scholar] [CrossRef] [PubMed]
- Basukala, O.; Banks, L. The Not-So-Good, the Bad and the Ugly: HPV E5, E6 and E7 Oncoproteins in the Orchestration of Carcinogenesis. Viruses 2021, 13, 1892. [Google Scholar] [CrossRef]
- Lawson, J.S.; Glenn, W.K.; Salyakina, D.; Delprado, W.; Clay, R.; Antonsson, A.; Heng, B.; Miyauchi, S.; Tran, D.D.; Ngan, C.C.; et al. Human Papilloma Viruses and Breast Cancer. Front. Oncol. 2015, 5. [Google Scholar] [CrossRef] [PubMed]
- Suominen, N.T.; Luukkaala, T.H.; Laprise, C.; Haataja, M.A.; Grénman, S.E.; Syrjänen, S.M.; Louvanto, K. Human Papillomavirus Concordance Between Parents and Their Newborn Offspring: Results From the Finnish Family Human Papillomavirus Study. J. Infect. Dis. 2024, 229, 448–456. [Google Scholar] [CrossRef]
- Karachalios, C.; Petousis, S.; Margioula-Siarkou, C.; Dinas, K. Human Papillomaviruses and Breast Cancer: A Systematic Review and Meta-analysis. Oncol. Lett. 2023, 27, 75. [Google Scholar] [CrossRef]
- Baldez Da Silva, M.F.P.T.; Chagas, B.S.; Guimares, V.; Katz, L.M.C.; Felix, P.M.; Miranda, P.M.; Lima, A.A.; Arraes, L.C.; Martins, D.B.G.; Lima Filho, J.L.; et al. HPV31 and HPV33 Incidence in Cervical Samples from Women in Recife, Brazil. Genet. Mol. Res. 2009, 8, 1437–1443. [Google Scholar] [CrossRef] [PubMed]
- Manos, M., M.; Ting, T.; Wright, D., K.; Lewis, A., J.; Broker, T., R.; Wolinsky, S., M. The Use of Polymerase Chain Reaction Amplification for the Detection of Genital Human Papillomavirus. Cancer Cells 1989, 7, 209–214. [Google Scholar]
- De Roda Husman, A.-M.; Walboomers, J.M.M.; Van Den Brule, A.J.C.; Meijer, C.J.L.M.; Snijders, P.J.F. The Use of General Primers GP5 and GP6 Elongated at Their 3’ Ends with Adjacent Highly Conserved Sequences Improves Human Papillomavirus Detection by PCR. J. Gen. Virol. 1995, 76, 1057–1062. [Google Scholar] [CrossRef]
- Peitsaro, P.; Johansson, B.; Syrjänen, S. Integrated Human Papillomavirus Type 16 Is Frequently Found in Cervical Cancer Precursors as Demonstrated by a Novel Quantitative Real-Time PCR Technique. J. Clin. Microbiol. 2002, 40, 886–891. [Google Scholar] [CrossRef] [PubMed]
- Santos, D.L.; São Marcos, B.D.F.; De Sousa, G.F.; Cruz, L.C.D.O.; Barros, B.R.D.S.; Nogueira, M.C.D.B.L.; Oliveira, T.H.D.A.; Silva, A.J.D.; Santos, V.E.P.; De Melo, C.M.L.; et al. Immunological Response against Breast Lineage Cells Transfected with Human Papillomavirus (HPV). Viruses 2024, 16, 717. [Google Scholar] [CrossRef] [PubMed]
- Hellemans, J.; Mortier, G.; De Paepe, A.; Speleman, F.; Vandesompele, J. qBase relative quantification framework and software for management and automated analysis of real-time quantitative PCR data. Genome Biol. 2007, 8, R19. [Google Scholar] [CrossRef] [PubMed]
- Nicolis, O.; De Los Angeles, D.; Taramasco, C. A Contemporary Review of Breast Cancer Risk Factors and the Role of Artificial Intelligence. Front. Oncol. 2024, 14, 1356014. [Google Scholar] [CrossRef]
- Roheel, A.; Khan, A.; Anwar, F.; Akbar, Z.; Akhtar, M.F.; Imran Khan, M.; Sohail, M.F.; Ahmad, R. Global Epidemiology of Breast Cancer Based on Risk Factors: A Systematic Review. Front. Oncol. 2023, 13, 1240098. [Google Scholar] [CrossRef] [PubMed]
- El-Sheikh, N.; Mousa, N.O.; Tawfeik, A.M.; Saleh, A.M.; Elshikh, I.; Deyab, M.; Ragheb, F.; Moneer, M.M.; Kawashti, A.; Osman, A.; et al. Assessment of Human Papillomavirus Infection and Risk Factors in Egyptian Women With Breast Cancer. Breast Cancer Basic Clin. Res. 2021, 15, 117822342199627. [Google Scholar] [CrossRef]
- Fakhri, N.; Chad, M.A.; Lahkim, M.; Houari, A.; Dehbi, H.; Belmouden, A.; El Kadmiri, N. Risk Factors for Breast Cancer in Women: An Update Review. Med. Oncol. 2022, 39, 197. [Google Scholar] [CrossRef]
- Almansour, N.M. Triple-Negative Breast Cancer: A Brief Review About Epidemiology, Risk Factors, Signaling Pathways, Treatment and Role of Artificial Intelligence. Front. Mol. Biosci. 2022, 9, 836417. [Google Scholar] [CrossRef]
- Donepudi, M.; Kondapalli, K.; Amos, S.; Venkanteshan, P. Breast Cancer Statistics and Markers. J. Cancer Res. Ther. 2014, 10, 506. [Google Scholar] [CrossRef] [PubMed]
- Łukasiewicz, S.; Czeczelewski, M.; Forma, A.; Baj, J.; Sitarz, R.; Stanisławek, A. Breast Cancer—Epidemiology, Risk Factors, Classification, Prognostic Markers, and Current Treatment Strategies—An Updated Review. Cancers 2021, 13, 4287. [Google Scholar] [CrossRef] [PubMed]
- Khodabandehlou, N.; Mostafaei, S.; Etemadi, A.; Ghasemi, A.; Payandeh, M.; Hadifar, S.; Norooznezhad, A.H.; Kazemnejad, A.; Moghoofei, M. Human Papilloma Virus and Breast Cancer: The Role of Inflammation and Viral Expressed Proteins. BMC Cancer 2019, 19, 61. [Google Scholar] [CrossRef] [PubMed]
- Admoun, C.; Mayrovitz, H.N. The Etiology of Breast Cancer. In Breast Cancer; Exon Publications; Mayrovitz, H.N., Ed.; Exon Publications: Brisbane, QLD, Australia, 2022; pp. 21–30. ISBN 978-0-645-33203-2. [Google Scholar]
- Migliavacca Zucchetti, B.; Peccatori, F.A.; Codacci-Pisanelli, G. Pregnancy and Lactation: Risk or Protective Factors for Breast Cancer? In Diseases of the Breast during Pregnancy and Lactation; Alipour, S., Omranipour, R., Eds.; Advances in Experimental Medicine and Biology; Springer International Publishing: Cham, Germany, 2020; Volume 1252, pp. 195–197. ISBN 978-3-030-41595-2. [Google Scholar]
- Stordal, B. Breastfeeding Reduces the Risk of Breast Cancer: A Call for Action in High-income Countries with Low Rates of Breastfeeding. Cancer Med. 2023, 12, 4616–4625. [Google Scholar] [CrossRef] [PubMed]
- Liu, L.; Hao, X.; Song, Z.; Zhi, X.; Zhang, S.; Zhang, J. Correlation between Family History and Characteristics of Breast Cancer. Sci. Rep. 2021, 11, 6360. [Google Scholar] [CrossRef] [PubMed]
- Al-Ismaili, Z.; Al-Nasri, K.; Al-Yaqoobi, A.; Al-Shukaili, A. Awareness of Breast Cancer Risk Factors, Symptoms and Breast Self-Examination Among Omani Female Teachers: A Cross-Sectional Study. Sultan Qaboos Univ. Med. J. 2020, 20, e194–e201. [Google Scholar] [CrossRef] [PubMed]
- Albeshan, S.M.; Hossain, S.Z.; Mackey, M.G.; Brennan, P.C. Can Breast Self-Examination and Clinical Breast Examination Along With Increasing Breast Awareness Facilitate Earlier Detection of Breast Cancer in Populations With Advanced Stages at Diagnosis? Clin. Breast Cancer 2020, 20, 194–200. [Google Scholar] [CrossRef] [PubMed]
- Rakha, E.A.; Tse, G.M.; Quinn, C.M. An Update on the Pathological Classification of Breast Cancer. Histopathology 2023, 82, 5–16. [Google Scholar] [CrossRef]
- Zhao, H. The Prognosis of Invasive Ductal Carcinoma, Lobular Carcinoma and Mixed Ductal and Lobular Carcinoma According to Molecular Subtypes of the Breast. Breast Cancer 2021, 28, 187–195. [Google Scholar] [CrossRef]
- Zagami, P.; Carey, L.A. Triple Negative Breast Cancer: Pitfalls and Progress. Npj Breast Cancer 2022, 8, 95. [Google Scholar] [CrossRef] [PubMed]
- Richardson, A.K.; Walker, L.C.; Cox, B.; Rollag, H.; Robinson, B.A.; Morrin, H.; Pearson, J.F.; Potter, J.D.; Paterson, M.; Surcel, H.-M.; et al. Breast Cancer and Cytomegalovirus. Clin. Transl. Oncol. 2020, 22, 585–602. [Google Scholar] [CrossRef] [PubMed]
- Saif, I.; Ennaji, Y.; El Mzibri, M.; Ennaji, M.M. Infection of HPV and MMTV Oncovirus in Breast Cancer Tissues in Women. In Oncogenic Viruses; Elsevier: Amsterdam, The Netherlands, 2023; pp. 49–70. ISBN ISBN 978-0-12-824152-3. [Google Scholar]
- Awan, U.A.; Khattak, A.A.; Ahmed, N.; Guo, X.; Akhtar, S.; Kamran, S.; Yongjing, Z.; Liu, J.; Khan, S. An Updated Systemic Review and Meta-Analysis on Human Papillomavirus in Breast Carcinogenesis. Front. Oncol. 2023, 13, 1219161. [Google Scholar] [CrossRef] [PubMed]
- De Carolis, S.; Storci, G.; Ceccarelli, C.; Savini, C.; Gallucci, L.; Sansone, P.; Santini, D.; Seracchioli, R.; Taffurelli, M.; Fabbri, F.; et al. HPV DNA Associates With Breast Cancer Malignancy and It Is Transferred to Breast Cancer Stromal Cells by Extracellular Vesicles. Front. Oncol. 2019, 9, 860. [Google Scholar] [CrossRef] [PubMed]
- Salman, N.A.; Davies, G.; Majidy, F.; Shakir, F.; Akinrinade, H.; Perumal, D.; Ashrafi, G.H. Association of High Risk Human Papillomavirus and Breast Cancer: A UK Based Study. Sci. Rep. 2017, 7, 43591. [Google Scholar] [CrossRef] [PubMed]
- Wang, T.; Chang, P.; Wang, L.; Yao, Q.; Guo, W.; Chen, J.; Yan, T.; Cao, C. The Role of Human Papillomavirus Infection in Breast Cancer. Med. Oncol. 2012, 29, 48–55. [Google Scholar] [CrossRef] [PubMed]
- Ateek, G.N.; Leon, M.; Hernandez Gonzalo, D.; Stewart, B.; Petty, D. Exploring HPV as an Etiologic Factor for Breast Cancer. Am. J. Clin. Pathol. 2023, 160, S10–S11. [Google Scholar] [CrossRef]
- Kouloura, A.; Nicolaidou, E.; Misitzis, I.; Panotopoulou, E.; Kassiani, T.; Smyrniotis, V.; Corso, G.; Veronesi, P.; Arkadopoulos, N. HPV Infection and Breast Cancer. Results of a Microarray Approach. The Breast 2018, 40, 165–169. [Google Scholar] [CrossRef]
- Cavalcante, J.R.; Pinheiro, L.G.P.; De Almeida, P.R.C.; Ferreira, M.V.P.; Cruz, G.A.; Campelo, T.A.; Silva, C.S.; Lima, L.N.G.C.; De Oliveira, B.M.K.; Lima, L.M.; et al. Association of Breast Cancer with Human Papillomavirus (HPV) Infection in Northeast Brazil: Molecular Evidence. Clinics 2018, 73, e465. [Google Scholar] [CrossRef]
- Nechifor-Boilă, A.; Banescu, C.; Zahan, A.E.; Moldovan, V.; Szasz, E.; Borda, A. DNA Isolation from Achieved Formalin-Fixed Paraffin-Embedded Tissues in a Series of 212 Thyroid Carcinoma Cases: The Influence of Preanalytical Factors on DNA Quantity and Purity. J. Investig. Med. 2020, 68, 792–798. [Google Scholar] [CrossRef]
- Fernandes, A.; Bianchi, G.; Feltri, A.P.; Pérez, M.; Correnti, M. Presence of Human Papillomavirus in Breast Cancer and Its Association with Prognostic Factors. Ecancermedicalscience 2015, 9, 548. [Google Scholar] [CrossRef] [PubMed]
- Maldonado-Rodríguez, E.; Hernández-Barrales, M.; Reyes-López, A.; Godina-González, S.; Gallegos-Flores, P.I.; Esparza-Ibarra, E.L.; González-Curiel, I.E.; Aguayo-Rojas, J.; López-Saucedo, A.; Mendoza-Almanza, G.; et al. Presence of Human Papillomavirus DNA in Malignant Neoplasia and Non-Malignant Breast Disease. Curr. Issues Mol. Biol. 2022, 44, 3648–3665. [Google Scholar] [CrossRef]
- Oyervides-Muñoz, M.A.; Pérez-Maya, A.A.; Rodríguez-Gutiérrez, H.F.; Gómez-Macias, G.S.; Fajardo-Ramírez, O.R.; Treviño, V.; Barrera-Saldaña, H.A.; Garza-Rodríguez, M.L. Understanding the HPV Integration and Its Progression to Cervical Cancer. Infect. Genet. Evol. 2018, 61, 134–144. [Google Scholar] [CrossRef] [PubMed]
- Rossi, N.M.; Dai, J.; Xie, Y.; Wangsa, D.; Heselmeyer-Haddad, K.; Lou, H.; Boland, J.F.; Yeager, M.; Orozco, R.; Freites, E.A.; et al. Extrachromosomal Amplification of Human Papillomavirus Episomes Is a Mechanism of Cervical Carcinogenesis. Cancer Res. 2023, 83, 1768–1781. [Google Scholar] [CrossRef] [PubMed]
- Araldi, R.P.; Assaf, S.M.R.; Carvalho, R.F.D.; Carvalho, M.A.C.R.D.; Souza, J.M.D.; Magnelli, R.F.; Módolo, D.G.; Roperto, F.P.; Stocco, R.D.C.; Beçak, W. Papillomaviruses: A Systematic Review. Genet. Mol. Biol. 2017, 40, 1–21. [Google Scholar] [CrossRef] [PubMed]
- Gheit, T. Mucosal and Cutaneous Human Papillomavirus Infections and Cancer Biology. Front. Oncol. 2019, 9, 355. [Google Scholar] [CrossRef] [PubMed]
- Graham, S.V. The Human Papillomavirus Replication Cycle, and Its Links to Cancer Progression: A Comprehensive Review. Clin. Sci. 2017, 131, 2201–2221. [Google Scholar] [CrossRef] [PubMed]
- Cricca, M.; Morselli-Labate, A.M.; Venturoli, S.; Ambretti, S.; Gentilomi, G.A.; Gallinella, G.; Costa, S.; Musiani, M.; Zerbini, M. Viral DNA Load, Physical Status and E2/E6 Ratio as Markers to Grade HPV16 Positive Women for High-Grade Cervical Lesions. Gynecol. Oncol. 2007, 106, 549–557. [Google Scholar] [CrossRef] [PubMed]
- Khan, N.A.; Castillo, A.; Koriyama, C.; Kijima, Y.; Umekita, Y.; Ohi, Y.; Higashi, M.; Sagara, Y.; Yoshinaka, H.; Tsuji, T.; et al. Human Papillomavirus Detected in Female Breast Carcinomas in Japan. Br. J. Cancer 2008, 99, 408–414. [Google Scholar] [CrossRef]
- Elagali, A.M.; Suliman, A.A.; Altayeb, M.; Dannoun, A.I.; Parine, N.R.; Sakr, H.I.; Suliman, H.S.; Motawee, M.E. Human Papillomavirus, Gene Mutation and Estrogen and Progesterone Receptors in Breast Cancer: A Cross-Sectional Study. Pan Afr. Med. J. 2021, 38. [Google Scholar] [CrossRef]
- Fu, L.; Wang, D.; Shah, W.; Wang, Y.; Zhang, G.; He, J. Association of Human Papillomavirus Type 58 with Breast Cancer in Shaanxi Province of China. J. Med. Virol. 2015, 87, 1034–1040. [Google Scholar] [CrossRef] [PubMed]
- Herrera-Romano, L.; Fernández-Tamayo, N.; Gómez-Conde, E.; Reyes-Cardoso, J.M.; Ortiz-Gutierrez, F.; Ceballos, G.; Valdivia, A.; Piña, P.; Salcedo, M. Absence of Human Papillomavirus Sequences in Epithelial Breast Cancer in a Mexican Female Population. Med. Oncol. 2012, 29, 1515–1517. [Google Scholar] [CrossRef] [PubMed]
- Duan, L.; Du, H.; Wang, C.; Huang, X.; Qu, X.; Shi, B.; Liu, Y.; Zhang, W.; Duan, X.; Wei, L.; et al. The Effectiveness of HPV Viral Load, Reflected by Cobas 4800 HPV-Ct Values for the Triage of HPV-Positive Women in Primary Cervical Cancer Screening: Direct Endocervical Samples. PLOS ONE 2020, 15, e0232107. [Google Scholar] [CrossRef] [PubMed]
- Medda, A.; Duca, D.; Chiocca, S. Human Papillomavirus and Cellular Pathways: Hits and Targets. Pathogens 2021, 10, 262. [Google Scholar] [CrossRef]
- Basto, D.L.; Chaves, C.B.P.; Felix, S.P.; Amaro-Filho, S.M.; Vieira, V.C.; Martins, L.F.L.; De Carvalho, N.A.; Almeida, L.M.; Moreira, M.Â.M. The Papillomavirus E5 Gene Does Not Affect EGFR Transcription and Overall Survival in Cervical Cancer. J. Med. Virol. 2020, 92, 1283–1289. [Google Scholar] [CrossRef]
- Campo, M.S.; Graham, S.V.; Cortese, M.S.; Ashrafi, G.H.; Araibi, E.H.; Dornan, E.S.; Miners, K.; Nunes, C.; Man, S. HPV-16 E5 down-Regulates Expression of Surface HLA Class I and Reduces Recognition by CD8 T Cells. Virology 2010, 407, 137–142. [Google Scholar] [CrossRef]
- Islam, S.; Dasgupta, H.; Roychowdhury, A.; Bhattacharya, R.; Mukherjee, N.; Roy, A.; Mandal, G.K.; Alam, N.; Biswas, J.; Mandal, S.; et al. Study of Association and Molecular Analysis of Human Papillomavirus in Breast Cancer of Indian Patients: Clinical and Prognostic Implication. PLOS ONE 2017, 12, e0172760. [Google Scholar] [CrossRef]
- Yasmeen, A.; Bismar, T.A.; Kandouz, M.; Foulkes, W.D.; Desprez, P.-Y.; Al Moustafa, A.-E. E6/E7 of HPV Type 16 Promotes Cell Invasion and Metastasis of Human Breast Cancer Cells. Cell Cycle 2007, 6, 2038–2042. [Google Scholar] [CrossRef]
- Frega, A.; Lorenzon, L.; Bononi, M.; De Cesare, A.; Ciardi, A.; Lombardi, D.; Assorgi, C.; Gentile, M.; Moscarini, M.; Torrisi, M.R.; et al. Evaluation of E6 and E7 mRNA Expression in HPV DNA Positive Breast Cancer. Eur. J. Gynaecol. Oncol. 2012, 33, 164–167. [Google Scholar]
- Chen, J.; Xue, Y.; Poidinger, M.; Lim, T.; Chew, S.H.; Pang, C.L.; Abastado, J.-P.; Thierry, F. Mapping of HPV Transcripts in Four Human Cervical Lesions Using RNAseq Suggests Quantitative Rearrangements during Carcinogenic Progression. Virology 2014, 462–463, 14–24. [Google Scholar] [CrossRef]
- Häfner, N.; Driesch, C.; Gajda, M.; Jansen, L.; Kirchmayr, R.; Runnebaum, I.B.; Dürst, M. Integration of the HPV16 Genome Does Not Invariably Result in High Levels of Viral Oncogene Transcripts. Oncogene 2008, 27, 1610–1617. [Google Scholar] [CrossRef] [PubMed]
- Sahab, Z.; Sudarshan, S.R.; Liu, X.; Zhang, Y.; Kirilyuk, A.; Kamonjoh, C.M.; Simic, V.; Dai, Y.; Byers, S.W.; Doorbar, J.; et al. Quantitative Measurement of Human Papillomavirus Type 16 E5 Oncoprotein Levels in Epithelial Cell Lines by Mass Spectrometry. J. Virol. 2012, 86, 9465–9473. [Google Scholar] [CrossRef] [PubMed]


| Gene | Sequence | Size (pb) | Reference | |
|---|---|---|---|---|
| β-globin | PC04 | ACACAACTGTGTTCACTAGC | 110 bp | Baldez et al. [21] |
| GH20 | CAACTTCATCCACGTTCACC0 | |||
| L1-HPV | MY09 | CGTCCMARRGGAWACTGATC | 450 bp | Manos et al. [22] |
| MY11 | GCMCAGGGWCATAAYAATGG | |||
| GP5 | TTTGTTACTGTGGTAGATAC | 150 bp | de Roda Husman et al. [23] | |
| GP6 | GAAAAATAAACTGTAAATCA | |||
| Characteristics | N(%) |
|---|---|
| Age | |
| <55 | 27 (48.2) |
| >56 | 29 (51.8) |
| IBM | |
| Underweight | 2 (4.2) |
| Normal Weight | 22 (45.8) |
| Overweight | 14 (29.2) |
| Obesity | 10 (20.8) |
| Smoking | |
| Yes | 13 (23.2) |
| No | 37 (66.1) |
| Previous smoker | 6 (10.6) |
| Co-morbidity | |
| Hypertension | |
| Yes | 22 (39.3) |
| No | 34 (60.7) |
| Diabetes mellitus | |
| Yes | 5 (8.9) |
| No | 51 (91.1) |
| Characteristics | N(%) |
|---|---|
| Age of first menstruation | |
| 08–10 years old | 3 (5.3) |
| 11–14 years old | 38 (67.8) |
| 15–17 years old | 14 (25.0) |
| Older than 18 years old | 1 (1.8) |
| Menopause Age | |
| <40 years old | 3 (5.3) |
| 40–45 years old | 6 (10.7) |
| 45–50 years old | 20 (35.7) |
| >50 years old | 11 (19.6) |
| Not in menopause | 16 (28.6) |
| Number of pregnancy | |
| 1–3 children | 28 (50.0) |
| 4–7 children | 14 (25.0) |
| >8 children | 7 (12.5) |
| No children | 7 (12.5) |
| Age of first pregnancy | |
| 12–17 years old | 6 (12.2) |
| 18–27 years old | 36 (73.5) |
| >28 years old | 7 (14.3) |
| Breastfeeding | |
| Yes | 31 (55.4) |
| No | 25 (44.7) |
| Use of contraceptive | |
| Yes | 26 (46.4) |
| No | 30 (53.6) |
| Characteristics | N(%) |
|---|---|
| Self-examination | |
| Yes | 44 (78.6) |
| No | 12 (21.4) |
| Mammography | |
| Yes | 31 (55.4) |
| No | 25 (44.7) |
| Family history | |
| Yes | 12 (21.4) |
| No | 44 (78.6) |
| Characteristics | N(%) |
|---|---|
| Histological Type | |
| Ductal carcinoma in situ | 8 (14.3) |
| Invasive Ductal carcinoma | 44 (78.6) |
| Invasive Lobular Carcinoma | 1 (1.8) |
| Medullary carcinoma | 1 (1.8) |
| Mucinous carcinoma | 1 (1.8) |
| Fibroadenoma | 1 (1.8) |
| Molecular type | |
| Luminal | 10 (17.9) |
| HER2-enriched | 6 (10.7) |
| triple-negative | 27 (48.2) |
| not-identified | 13 (23.2) |
| HPV infection | |
| Yes | 20 (35.7) |
| No | 36 (64.3) |
| Physical Status | |
| Episomal | 3 (15.0) |
| Integrated | 4 (20.0) |
| Mixed | 13 (65.0) |
| Positive HPV x Histological Type | |||||||||
|---|---|---|---|---|---|---|---|---|---|
| Ductal Carcinoma In Situ | Invasive Ductal Carcinoma | Invasive Lobular Carcinoma | |||||||
| N(%) | 4 (20.00) | 15 (75.00) | 1 (5.00) | ||||||
| Physical Status | Episome | Integrated | Mixed | Episome | Integrated | Mixed | Episome | Integrated | Mixed |
| N (%) | 0 | 2 (50.0) | 2 (50.0) | 3 (20.0) | 2 (13.3) | 10 9 (66.6) | 0 | 0 | 1 (100.0) |
| Ductal Carcinoma In Situ N (%) |
Invasive Ductal Carcinoma
N (%) | Invasive Lobular Carcinoma N (%) | |
|---|---|---|---|
| Luminal | 0 (0.0) | 1 (11.1) | 0 (0.0) |
| HER2-enriched | 1 (50.0) | 1 (11.1) | 0 (0.0) |
| Triple-negative | 1 (50.0) | 7 (77.7) | 1 (100.0) |
| Total | 2 (100.0) | 9 (100.0) | 1 (100.0) |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Nascimento, K.C.G.; São Marcos, B.d.F.; Fontes, P.H.B.; Isídio, B.E.d.O.; Leão, S.L.; da Silva, G.R.P.; Lussón, D.B.; dos Santos, D.L.; Leal, L.R.S.; Espinoza, B.C.F.; et al. HPV Detection in Breast Tumors and Associated Risk Factors in Northeastern Brazil. Cells 2024, 13, 1132. https://doi.org/10.3390/cells13131132
Nascimento KCG, São Marcos BdF, Fontes PHB, Isídio BEdO, Leão SL, da Silva GRP, Lussón DB, dos Santos DL, Leal LRS, Espinoza BCF, et al. HPV Detection in Breast Tumors and Associated Risk Factors in Northeastern Brazil. Cells. 2024; 13(13):1132. https://doi.org/10.3390/cells13131132
Chicago/Turabian StyleNascimento, Kamylla Conceição Gomes, Bianca de França São Marcos, Pedro Henrique Bezerra Fontes, Beatriz Eda de Oliveira Isídio, Stephanie Loureiro Leão, Gabriel Romulo Parente da Silva, David Beltrán Lussón, Daffany Luana dos Santos, Lígia Rosa Sales Leal, Benigno Cristofer Flores Espinoza, and et al. 2024. "HPV Detection in Breast Tumors and Associated Risk Factors in Northeastern Brazil" Cells 13, no. 13: 1132. https://doi.org/10.3390/cells13131132
APA StyleNascimento, K. C. G., São Marcos, B. d. F., Fontes, P. H. B., Isídio, B. E. d. O., Leão, S. L., da Silva, G. R. P., Lussón, D. B., dos Santos, D. L., Leal, L. R. S., Espinoza, B. C. F., de Macêdo, L. S., de França Neto, P. L., Silva, A. J. D., Silva Neto, J. C., Santos, V. E. P., & de Freitas, A. C. (2024). HPV Detection in Breast Tumors and Associated Risk Factors in Northeastern Brazil. Cells, 13(13), 1132. https://doi.org/10.3390/cells13131132

