Human Embryonic Stem Cell-Derived Immature Midbrain Dopaminergic Neurons Transplanted in Parkinsonian Monkeys
Abstract
1. Introduction
2. Results
2.1. Dopaminergic Neuron Differentiation
2.2. Differentiated Dopaminergic Neurons Have a Mature Phenotype In Vitro
2.3. hESC-Derived Dopaminergic Neurons Promote Behavioral Recovery in MPTP-Treated NHPs
2.4. Diffusion Tensor Imaging
2.5. PET Qualitative Analysis
2.6. Transplanted Neurons Release Dopamine
2.7. Dopamine Neurons Survive for Ten Months in the Putamen of MPTP-Treated NHPs
3. Discussion
4. Conclusions
5. Methods
5.1. Dopaminergic Differentiation of hESCs
5.2. RT-qPCR
5.3. Immunocytochemistry
5.4. Karyotype Analysis
5.5. Teratoma Formation Assay
5.6. RNA-Seq
5.7. Gene Expression Analysis
5.8. Electrophysiological Analysis
5.9. Lesion of Non-Human Primates with MPTP
5.10. Motor Behavioral Assessment
5.11. Magnetic Resonance Imaging
5.12. Surgical Procedure and DAN Transplantation
5.13. Diffusion Tensor Imaging
5.14. PET Acquisition and Imaging Analysis
5.15. Microdialysis Experiments and HPLC Analysis
5.16. Immunohistochemistry and Postmortem Cell Count
5.17. Statistical Analysis
5.18. Single-Case Experimental Design
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
Abbreviations
References
- Obeso, J.A.; Stamelou, M.; Goetz, C.G.; Poewe, W.; Lang, A.E.; Weintraub, D.; Burn, D.; Halliday, G.M.; Bezard, E.; Przedborski, S.; et al. Past, Present, and Future of Parkinson’s Disease: A Special Essay on the 200th Anniversary of the Shaking Palsy. Mov. Disord. 2017, 32, 1264–1310. [Google Scholar] [CrossRef]
- Poewe, W.; Seppi, K.; Tanner, C.M.; Halliday, G.M.; Brundin, P.; Volkmann, J.; Schrag, A.E.; Lang, A.E. Parkinson Disease. Nat. Rev. Dis. Primers 2017, 3, 17013. [Google Scholar] [CrossRef]
- Taylor, J.R.; Elsworth, J.D.; Roth, R.H.; Sladek, J.R.; Redmond, D.E. Severe Long-Term 1-Methyl-4-Phenyl-1,2,3,6-Tetrahydropyridine-Induced Parkinsonism in the Vervet Monkey (Cercopithecus Aethiops Sabaeus). Neuroscience 1997, 81, 745–755. [Google Scholar] [CrossRef] [PubMed]
- Campos-Romo, A.; Ojeda-Flores, R.; Moreno-Briseño, P.; Fernandez-Ruiz, J. Quantitative Evaluation of MPTP-Treated Nonhuman Parkinsonian Primates in the HALLWAY Task. J. Neurosci. Methods 2009, 177, 361–368. [Google Scholar] [CrossRef]
- Campos-Romo, A.; Ojeda-Flores, R.; Moreno-Briseño, P.; Vergara, P.; Segovia, J.; Carrillo-Ruiz, J.D.; Fernandez-Ruiz, J. Behavioral Improvement in MPTP-Treated Nonhuman Primates in the HALLWAY Task after Transfer of TH CDNA to Host Astrocytes. Acta Neurobiol. Exp. 2012, 72, 166–176. [Google Scholar]
- Perrier, A.L.; Tabar, V.; Barberi, T.; Rubio, M.E.; Bruses, J.; Topf, N.; Harrison, N.L.; Studer, L. Derivation of Midbrain Dopamine Neurons from Human Embryonic Stem Cells. Proc. Natl. Acad. Sci. USA 2004, 101, 12543–12548. [Google Scholar] [CrossRef] [PubMed]
- Chambers, S.M.; Fasano, C.A.; Papapetrou, E.P.; Tomishima, M.; Sadelain, M.; Studer, L. Highly Efficient Neural Conversion of Human ES and IPS Cells by Dual Inhibition of SMAD Signaling. Nat. Biotechnol. 2009, 27, 275–280. [Google Scholar] [CrossRef] [PubMed]
- Kirkeby, A.; Grealish, S.; Wolf, D.A.; Nelander, J.; Wood, J.; Lundblad, M.; Lindvall, O.; Parmar, M. Generation of Regionally Specified Neural Progenitors and Functional Neurons from Human Embryonic Stem Cells under Defined Conditions. Cell Rep. 2012, 1, 703–714. [Google Scholar] [CrossRef]
- Carballo-Molina, O.A.; Sánchez-Navarro, A.; López-Ornelas, A.; Lara-Rodarte, R.; Salazar, P.; Campos-Romo, A.; Ramos-Mejía, V.; Velasco, I. Semaphorin 3C Released from a Biocompatible Hydrogel Guides and Promotes Axonal Growth of Rodent and Human Dopaminergic Neurons. Tissue Eng. Part A 2016, 22, 850–861. [Google Scholar] [CrossRef]
- Kim, J.H.; Auerbach, J.M.; Rodríguez-Gómez, J.A.; Velasco, I.; Gavin, D.; Lumelsky, N.; Lee, S.H.; Nguyen, J.; Sánchez-Pernaute, R.; Bankiewicz, K.; et al. Dopamine Neurons Derived from Embryonic Stem Cells Function in an Animal Model of Parkinson’s Disease. Nature 2002, 418, 50–56. [Google Scholar] [CrossRef]
- Roy, N.S.; Cleren, C.; Singh, S.K.; Yang, L.; Beal, M.F.; Goldman, S.A. Functional Engraftment of Human ES Cell-Derived Dopaminergic Neurons Enriched by Coculture with Telomerase-Immortalized Midbrain Astrocytes. Nat. Med. 2006, 12, 1259–1268. [Google Scholar] [CrossRef]
- Kriks, S.; Shim, J.W.; Piao, J.; Ganat, Y.M.; Wakeman, D.R.; Xie, Z.; Carrillo-Reid, L.; Auyeung, G.; Antonacci, C.; Buch, A.; et al. Dopamine Neurons Derived from Human ES Cells Efficiently Engraft in Animal Models of Parkinson’s Disease. Nature 2011, 480, 547–551. [Google Scholar] [CrossRef]
- Grealish, S.; Diguet, E.; Kirkeby, A.; Mattsson, B.; Heuer, A.; Bramoulle, Y.; van Camp, N.; Perrier, A.L.; Hantraye, P.; Björklund, A.; et al. Human ESC-Derived Dopamine Neurons Show Similar Preclinical Efficacy and Potency to Fetal Neurons When Grafted in a Rat Model of Parkinson’s Disease. Cell Stem Cell 2014, 15, 653–665. [Google Scholar] [CrossRef] [PubMed]
- Doi, D.; Morizane, A.; Kikuchi, T.; Onoe, H.; Hayashi, T.; Kawasaki, T.; Motono, M.; Sasai, Y.; Saiki, H.; Gomi, M.; et al. Prolonged Maturation Culture Favors a Reduction in the Tumorigenicity and the Dopaminergic Function of Human ESC-Derived Neural Cells in a Primate Model of Parkinson’s Disease. Stem Cells 2012, 30, 935–945. [Google Scholar] [CrossRef]
- Maria, S.; Helle, B.; Tristan, L.; Gaynor, S.; Michele, M.; Teresia, O.; Oliver, C.; Roger, S.; Ole, I. Improved Cell Therapy Protocol for Parkinson’s Disease Based on Differentiation Efficiency and Safety of HESC-, HiPSC and Non- Human Primate IPSC-Derived DA Neurons. Stem Cells 2014, 31, 1548–1562. [Google Scholar]
- Kikuchi, T.; Morizane, A.; Doi, D.; Magotani, H.; Onoe, H.; Hayashi, T.; Mizuma, H.; Takara, S.; Takahashi, R.; Inoue, H.; et al. Human IPS Cell-Derived Dopaminergic Neurons Function in a Primate Parkinson’s Disease Model. Nature 2017, 548, 592–596. [Google Scholar] [CrossRef] [PubMed]
- Wang, Y.K.; Zhu, W.W.; Wu, M.H.; Wu, Y.H.; Liu, Z.X.; Liang, L.M.; Sheng, C.; Hao, J.; Wang, L.; Li, W.; et al. Human Clinical-Grade Parthenogenetic ESC-Derived Dopaminergic Neurons Recover Locomotive Defects of Nonhuman Primate Models of Parkinson’s Disease. Stem Cell Rep. 2018, 11, 171–182. [Google Scholar] [CrossRef] [PubMed]
- Schweitzer, J.S.; Song, B.; Herrington, T.M.; Park, T.Y.; Lee, N.; Ko, S.; Jeon, J.; Cha, Y.; Kim, K.; Li, Q.; et al. Personalized IPSC-Derived Dopamine Progenitor Cells for Parkinson’s Disease. N. Engl. J. Med. 2020, 382, 1926–1932. [Google Scholar] [CrossRef] [PubMed]
- Domingo-Reines, J.; López-Ornelas, A.; Montes, R.; Romero, T.; Rodriguez-Llamas, J.L.; Lara-Rodarte, R.; González-Pozas, F.; Ayllon, V.; Menendez, P.; Velasco, I.; et al. Hoxa9 and EGFP Reporter Expression in Human Embryonic Stem Cells (HESC) as Useful Tools for Studying Human Development. Stem Cell Res 2017, 25, 286–290. [Google Scholar] [CrossRef]
- Adil, M.M.; Rodrigues, G.M.C.; Kulkarni, R.U.; Rao, A.T.; Chernavsky, N.E.; Miller, E.W.; Schaffer, D.V. Efficient Generation of HPSC-Derived Midbrain Dopaminergic Neurons in a Fully Defined, Scalable, 3D Biomaterial Platform. Sci. Rep. 2017, 7, 40573. [Google Scholar] [CrossRef]
- Domanskyi, A.; Alter, H.; Vogt, M.A.; Gass, P.; Vinnikov, I.A. Transcription Factors Foxa1 and Foxa2 Are Required for Adult Dopamine Neurons Maintenance. Front. Cell Neurosci. 2014, 8, 109407. [Google Scholar] [CrossRef] [PubMed]
- Meléndez-Ramírez, C.; Cuevas-Diaz Duran, R.; Barrios-García, T.; Giacoman-Lozano, M.; López-Ornelas, A.; Herrera-Gamboa, J.; Estudillo, E.; Soto-Reyes, E.; Velasco, I.; Treviño, V. Dynamic Landscape of Chromatin Accessibility and Transcriptomic Changes during Differentiation of Human Embryonic Stem Cells into Dopaminergic Neurons. Sci. Rep. 2021, 11, 16977. [Google Scholar] [CrossRef] [PubMed]
- Ibañez-Sandoval, O.; Hernández, A.; Florán, B.; Galarraga, E.; Tapia, D.; Valdiosera, R.; Erlij, D.; Aceves, J.; Bargas, J. Control of the Subthalamic Innervation of Substantia Nigra Pars Reticulata by D1 and D2 Dopamine Receptors. J. Neurophysiol. 2006, 95, 1800–1811. [Google Scholar] [CrossRef][Green Version]
- Kimm, T.; Khaliq, Z.M.; Bean, B.P. Differential Regulation of Action Potential Shape and Burst-Frequency Firing by BK and Kv2 Channels in Substantia Nigra Dopaminergic Neurons. J. Neurosci. 2015, 35, 16404–16417. [Google Scholar] [CrossRef] [PubMed]
- Maiti, P.; Gregg, L.C.; McDonald, M.P. MPTP-Induced Executive Dysfunction Is Associated with Altered Prefrontal Serotonergic Function. Behav. Brain Res. 2016, 298, 192–201. [Google Scholar] [CrossRef]
- Joel, D.; Weiner, I. The Connections of the Dopaminergic System with the Striatum in Rats and Primates: An Analysis with Respect to the Functional and Compartmental Organization of the Striatum. Neuroscience 2000, 96, 451–474. [Google Scholar] [CrossRef] [PubMed]
- Lynd-Balta, E.; Haber, S.N. Primate Striatonigral Projections: A Comparison of the Sensorimotor-related Striatum and the Ventral Striatum. J. Comp. Neurol. 1994, 345, 562–578. [Google Scholar] [CrossRef]
- Parent, A.; Hazrati, L.N. Functional Anatomy of the Basal Ganglia. I. The Cortico-Basal Ganglia-Thalamo-Cortical Loop. Brain Res. Rev. 1995, 20, 91–127. [Google Scholar] [CrossRef]
- Rodríguez-Gómez, J.A.; Lu, J.-Q.; Velasco, I.; Rivera, S.; Zoghbi, S.S.; Liow, J.-S.; Musachio, J.L.; Chin, F.T.; Toyama, H.; Seidel, J.; et al. Persistent Dopamine Functions of Neurons Derived from Embryonic Stem Cells in a Rodent Model of Parkinson Disease. Stem Cells 2007, 25, 918–928. [Google Scholar] [CrossRef] [PubMed]
- Waiczies, H.; Millward, J.M.; Lepore, S.; Infante-Duarte, C.; Pohlmann, A.; Niendorf, T.; Waiczies, S. Identification of Cellular Infiltrates during Early Stages of Brain Inflammation with Magnetic Resonance Microscopy. PLoS ONE 2012, 7, e32796. [Google Scholar] [CrossRef]
- Garman, R.H. Histology of the Central Nervous System. Toxicol. Pathol. 2011, 39, 22–35. [Google Scholar] [CrossRef] [PubMed]
- Kirkeby, A.; Nolbrant, S.; Tiklova, K.; Heuer, A.; Kee, N.; Cardoso, T.; Ottosson, D.R.; Lelos, M.J.; Rifes, P.; Dunnett, S.B.; et al. Predictive Markers Guide Differentiation to Improve Graft Outcome in Clinical Translation of HESC-Based Therapy for Parkinson’s Disease. Cell Stem Cell 2017, 20, 135–148. [Google Scholar] [CrossRef]
- Schulz, T.C.; Noggle, S.A.; Palmarini, G.M.; Weiler, D.A.; Lyons, I.G.; Pensa, K.A.; Meedeniya, A.C.B.; Davidson, B.P.; Lambert, N.A.; Condie, B.G. Differentiation of Human Embryonic Stem Cells to Dopaminergic Neurons in Serum-Free Suspension Culture. Stem Cells 2004, 22, 1218–1238. [Google Scholar] [CrossRef] [PubMed]
- Yan, Y.; Yang, D.; Zarnowska, E.D.; Du, Z.; Werbel, B.; Valliere, C.; Pearce, R.A.; Thomson, J.A.; Zhang, S.-C. Directed Differentiation of Dopaminergic Neuronal Subtypes from Human Embryonic Stem Cells. Stem Cells 2005, 23, 781–790. [Google Scholar] [CrossRef] [PubMed]
- Gonzalez, R.; Garitaonandia, I.; Poustovoitov, M.; Abramihina, T.; McEntire, C.; Culp, B.; Attwood, J.; Noskov, A.; Christiansen-Weber, T.; Khater, M.; et al. Neural Stem Cells Derived from Human Parthenogenetic Stem Cells Engraft and Promote Recovery in a Nonhuman Primate Model of Parkinson’s Disease. Cell Transpl. 2016, 25, 1945–1966. [Google Scholar] [CrossRef]
- Hallett, P.J.; Deleidi, M.; Astradsson, A.; Smith, G.A.; Cooper, O.; Osborn, T.M.; Sundberg, M.; Moore, M.A.; Perez-Torres, E.; Brownell, A.L.; et al. Successful Function of Autologous IPSC-Derived Dopamine Neurons Following Transplantation in a Non-Human Primate Model of Parkinson’s Disease. Cell Stem Cell 2015, 16, 269–274. [Google Scholar] [CrossRef]
- Taylor, J.R.; Elsworth, J.D.; Sladek, J.R.; Collier, T.J.; Roth, R.H.; Redmond, D.E. Sham Surgery Does Not Ameliorate MPTP-Induced Behavioral Deficits in Monkeys. Cell Transpl. 1995, 4, 13–26. [Google Scholar] [CrossRef]
- Park, T.Y.; Jeon, J.; Lee, N.; Kim, J.; Song, B.; Kim, J.H.; Lee, S.K.; Liu, D.; Cha, Y.; Kim, M.; et al. Co-Transplantation of Autologous Treg Cells in a Cell Therapy for Parkinson’s Disease. Nature 2023, 619, 606–615. [Google Scholar] [CrossRef]
- Politis, M.; Oertel, W.H.; Wu, K.; Quinn, N.P.; Pogarell, O.; Brooks, D.J.; Bjorklund, A.; Lindvall, O.; Piccini, P. Graft-Induced Dyskinesias in Parkinson’s Disease: High Striatal Serotonin/Dopamine Transporter Ratio. Mov. Disord. 2011, 26, 1997–2003. [Google Scholar] [CrossRef]
- Lane, E.L.; Harrison, D.J.; Ramos-Varas, E.; Hills, R.; Turner, S.; Lelos, M.J. Spontaneous Graft-Induced Dyskinesias Are Independent of 5-HT Neurons and Levodopa Priming in a Model of Parkinson’s Disease. Mov. Disord. 2022, 37, 613–619. [Google Scholar] [CrossRef]
- Surova, Y.; Nilsson, M.; Lampinen, B.; Lätt, J.; Hall, S.; Widner, H.; van Westen, D.; Hansson, O. Alteration of Putaminal Fractional Anisotropy in Parkinson’s Disease: A Longitudinal Diffusion Kurtosis Imaging Study. Neuroradiology 2018, 60, 247–254. [Google Scholar] [CrossRef]
- Pfefferbaum, A.; Adalsteinsson, E.; Rohlfing, T.; Sullivan, E.V. Diffusion Tensor Imaging of Deep Gray Matter Brain Structures: Effects of Age and Iron Concentration. Neurobiol. Aging 2010, 31, 482–493. [Google Scholar] [CrossRef]
- Zhan, W.; Kang, G.A.; Glass, G.A.; Zhang, Y.; Shirley, C.; Millin, R.; Possin, K.L.; Nezamzadeh, M.; Weiner, M.W.; Marks, W.J.; et al. Regional Alterations of Brain Microstructure in Parkinson’s Disease Using Diffusion Tensor Imaging. Mov. Disord. 2012, 27, 90–97. [Google Scholar] [CrossRef]
- Cochrane, C.J.; Ebmeier, K.P. Diffusion Tensor Imaging in Parkinsonian Syndromes: A Systematic Review and Meta-Analysis. Neurology 2013, 80, 857–864. [Google Scholar] [CrossRef] [PubMed]
- McNeill, T.H.; Brown, S.A.; Rafols, J.A.; Shoulson, I. Atrophy of Medium Spiny I Striatal Dendrites in Advanced Parkinson’s Disease. Brain Res. 1988, 455, 148–152. [Google Scholar] [CrossRef] [PubMed]
- Stephenson, D.T.; Childs, M.A.; Li, Q.; Carvajal-Gonzalez, S.; Opsahl, A.; Tengowski, M.; Meglasson, M.D.; Merchant, K.; Emborg, M.E. Differential Loss of Presynaptic Dopaminergic Markers in Parkinsonian Monkeys. Cell Transplant. 2007, 16, 229–244. [Google Scholar] [CrossRef] [PubMed]
- Stephens, B.; Mueller, A.J.; Shering, A.F.; Hood, S.H.; Taggart, P.; Arbuthnott, G.W.; Bell, J.E.; Kilford, L.; Kingsbury, A.E.; Daniel, S.E.; et al. Evidence of a Breakdown of Corticostriatal Connections in Parkinson’s Disease. Neuroscience 2005, 132, 741–754. [Google Scholar] [CrossRef] [PubMed]
- Zhang, Y.; Burock, M.A. Diffusion Tensor Imaging in Parkinson’s Disease and Parkinsonian Syndrome: A Systematic Review. Front. Neurol. 2020, 11, 531993. [Google Scholar] [CrossRef]
- Wang, F.; Huang, S.L.; He, X.J.; Li, X.H. Determination of the Ideal Rat Model for Spinal Cord Injury by Diffusion Tensor Imaging. Neuroreport 2014, 25, 1386–1392. [Google Scholar] [CrossRef]
- Zhang, D.; Li, X.H.; Zhai, X.; He, X.J. Feasibility of 3.0 T Diffusion-Weighted Nuclear Magnetic Resonance Imaging in the Evaluation of Functional Recovery of Rats with Complete Spinal Cord Injury. Neural Regen. Res. 2015, 10, 412–418. [Google Scholar] [CrossRef]
- Lin, M.; He, H.; Schifitto, G.; Zhong, J. Simulation of Changes in Diffusion Related to Different Pathologies at Cellular Level After Traumatic Brain Injury. Magn. Reson. Med. 2016, 76, 290. [Google Scholar] [CrossRef]
- Gupta, N.; Henry, R.G.; Strober, J.; Kang, S.M.; Lim, D.A.; Bucci, M.; Caverzasi, E.; Gaetano, L.; Mandelli, M.L.; Ryan, T.; et al. Neural Stem Cell Engraftment and Myelination in the Human Brain. Sci. Transl. Med. 2012, 4, 155ra137. [Google Scholar] [CrossRef] [PubMed]
- de Oliveira, R.V.; Pereira, J.S. Utility of Manual Fractional Anisotropy Measurements in the Management of Patients with Parkinson Disease: A Feasibility Study with a 1.5-T Magnetic Resonance Imaging System. Acta Radiol. Open 2021, 10, 205846012199347. [Google Scholar] [CrossRef] [PubMed]
- Bazzu, G.; Calia, G.; Puggioni, G.; Spissu, Y.; Rocchitta, G.; Debetto, P.; Grigoletto, J.; Zusso, M.; Migheli, R.; Andrea Serra, P.; et al. α-Synuclein- and MPTP-Generated Rodent Models of Parkinsons Disease and the Study of Extracellular Striatal Dopamine Dynamics: A Microdialysis Approach. CNS Neurol. Disord. Drug Targets 2012, 9, 482–490. [Google Scholar] [CrossRef] [PubMed]
- Steinbeck, J.A.; Choi, S.J.; Mrejeru, A.; Ganat, Y.; Deisseroth, K.; Sulzer, D.; Mosharov, E.V.; Studer, L. Optogenetics Enables Functional Analysis of Human Embryonic Stem Cell-Derived Grafts in a Parkinson’s Disease Model. Nat. Biotechnol. 2015, 33, 204–209. [Google Scholar] [CrossRef] [PubMed]
- Chen, Y.; Xiong, M.; Dong, Y.; Haberman, A.; Cao, J.; Liu, H.; Zhou, W.; Zhang, S.C. Chemical Control of Grafted Human PSC-Derived Neurons in a Mouse Model of Parkinson’s Disease. Cell Stem Cell 2016, 18, 817–826. [Google Scholar] [CrossRef] [PubMed]
- Karimi, M.; Tian, L.; Brown, C.A.; Flores, H.P.; Loftin, S.K.; Videen, T.O.; Moerlein, S.M.; Perlmutter, J.S. Validation of Nigrostriatal Positron Emission Tomography Measures: Critical Limits. Ann. Neurol. 2013, 73, 390–396. [Google Scholar] [CrossRef] [PubMed]
- Ando, K.; Obayashi, S.; Nagai, Y.; Oh-Nishi, A.; Minamimoto, T.; Higuchi, M.; Inoue, T.; Itoh, T.; Suhara, T. PET Analysis of Dopaminergic Neurodegeneration in Relation to Immobility in the MPTP-Treated Common Marmoset, a Model for Parkinson’s Disease. PLoS ONE 2012, 7, e46371. [Google Scholar] [CrossRef]
- Seo, J.; Lee, Y.; Kim, B.S.; Park, J.; Yang, S.; Yoon, H.J.; Yoo, J.; Park, H.S.; Hong, J.J.; Koo, B.S.; et al. A Non-Human Primate Model for Stable Chronic Parkinson’s Disease Induced by MPTP Administration Based on Individual Behavioral Quantification. J. Neurosci. Methods 2019, 311, 277–287. [Google Scholar] [CrossRef]
- Pérez-Lohman, C.; Kerik, N.E.; Díaz-Meneses, I.E.; Cervantes-Arriaga, A.; Rodríguez-Violante, M. Diagnostic Utility of [11C] DTBZ Positron Emission Tomography In Clinically Uncertain Parkinsonism: Experience of a Single Tertiary Center. Rev. Investig. Clin. 2018, 70, 285–290. [Google Scholar] [CrossRef]
- Björklund, L.M.; Sánchez-Pernaute, R.; Chung, S.; Andersson, T.; Chen, I.Y.C.; McNaught, K.S.P.; Brownell, A.L.; Jenkins, B.G.; Wahlestedt, C.; Kim, K.S.; et al. Embryonic Stem Cells Develop into Functional Dopaminergic Neurons after Transplantation in a Parkinson Rat Model. Proc. Natl. Acad. Sci. USA 2002, 99, 2344–2349. [Google Scholar] [CrossRef] [PubMed]
- Wang, J.; Xie, Y.; Bai, X.; Wang, N.; Yu, H.; Deng, Z.; Lian, M.; Yu, S.; Liu, H.; Xie, W.; et al. Targeting Dual Specificity Protein Kinase TTK Attenuates Tumorigenesis of Glioblastoma. Oncotarget 2018, 9, 3081–3088. [Google Scholar] [CrossRef] [PubMed]
- Martin, M. Cutadapt Removes Adapter Sequences from High-Throughput Sequencing Reads. EMBnet. J. 2011, 17, 10–12. [Google Scholar] [CrossRef]
- Bolger, A.M.; Lohse, M.; Usadel, B. Trimmomatic: A Flexible Trimmer for Illumina Sequence Data. Bioinformatics 2014, 30, 2114–2120. [Google Scholar] [CrossRef] [PubMed]
- Babraham Bioinformatics—FastQC A Quality Control Tool for High Throughput Sequence Data. Available online: https://www.bioinformatics.babraham.ac.uk/projects/fastqc/ (accessed on 29 August 2023).
- Duran, R.C.D.; Yan, H.; Zheng, Y.; Huang, X.; Grill, R.; Kim, D.H.; Cao, Q.; Wu, J.Q. The Systematic Analysis of Coding and Long Non-Coding RNAs in the Sub-Chronic and Chronic Stages of Spinal Cord Injury. Sci. Rep. 2017, 7, 41008. [Google Scholar] [CrossRef] [PubMed]
- Kim, D.; Pertea, G.; Trapnell, C.; Pimentel, H.; Kelley, R.; Salzberg, S.L. TopHat2: Accurate Alignment of Transcriptomes in the Presence of Insertions, Deletions and Gene Fusions. Genome Biol. 2013, 14, R36. [Google Scholar] [CrossRef] [PubMed]
- Trapnell, C.; Williams, B.A.; Pertea, G.; Mortazavi, A.; Kwan, G.; Van Baren, M.J.; Salzberg, S.L.; Wold, B.J.; Pachter, L. Transcript Assembly and Quantification by RNA-Seq Reveals Unannotated Transcripts and Isoform Switching during Cell Differentiation. Nat. Biotechnol. 2010, 28, 511–515. [Google Scholar] [CrossRef]
- Anders, S.; Pyl, P.T.; Huber, W. HTSeq—A Python Framework to Work with High-Throughput Sequencing Data. Bioinformatics 2015, 31, 166–169. [Google Scholar] [CrossRef]
- Love, M.I.; Huber, W.; Anders, S. Moderated Estimation of Fold Change and Dispersion for RNA-Seq Data with DESeq2. Genome Biol. 2014, 15, 550. [Google Scholar] [CrossRef]
- Przedborski, S.; Jackson-Lewis, V.; Naini, A.B.; Jakowec, M.; Petzinger, G.; Miller, R.; Akram, M. The Parkinsonian Toxin 1-Methyl-4-Phenyl-1,2,3,6-Tetrahydropyridine (MPTP): A Technical Review of Its Utility and Safety. J. Neurochem. 2001, 76, 1265–1274. [Google Scholar] [CrossRef]
- Smith, S.M.; Jenkinson, M.; Johansen-Berg, H.; Rueckert, D.; Nichols, T.E.; Mackay, C.E.; Watkins, K.E.; Ciccarelli, O.; Cader, M.Z.; Matthews, P.M.; et al. Tract-Based Spatial Statistics: Voxelwise Analysis of Multi-Subject Diffusion Data. Neuroimage 2006, 31, 1487–1505. [Google Scholar] [CrossRef] [PubMed]
- Rohlfing, T.; Kroenke, C.D.; Sullivan, E.V.; Dubach, M.F.; Bowden, D.M.; Grant, K.A.; Pfefferbaum, A. The INIA19 Template and NeuroMaps Atlas for Primate Brain Image Parcellation and Spatial Normalization. Front. Neuroinform. 2012, 6, 27. [Google Scholar] [CrossRef] [PubMed]
- Avendaño-Estrada, A.; Ávila-Rodríguez, M.A. Reference Tissue Models in the Assessment of 11C-DTBZ Binding to the VMAT2 in Rat Striatum: A Test-Retest Reproducibility Study. Synapse 2018, 72, e22029. [Google Scholar] [CrossRef] [PubMed]
- Fedorov, A.; Beichel, R.; Kalpathy-Cramer, J.; Finet, J.; Fillion-Robin, J.C.; Pujol, S.; Bauer, C.; Jennings, D.; Fennessy, F.; Sonka, M.; et al. 3D Slicer as an Image Computing Platform for the Quantitative Imaging Network. Magn. Reson. Imaging 2012, 30, 1323–1341. [Google Scholar] [CrossRef] [PubMed]
- Jenkinson, M.; Smith, S. A Global Optimisation Method for Robust Affine Registration of Brain Images. Med. Image Anal. 2001, 5, 143–156. [Google Scholar] [CrossRef]
- Jenkinson, M.; Bannister, P.; Brady, M.; Smith, S. Improved Optimization for the Robust and Accurate Linear Registration and Motion Correction of Brain Images. Neuroimage 2002, 17, 825–841. [Google Scholar] [CrossRef]
- Collantes, M.; Prieto, E.; Peñuelas, I.; Blesa, J.; Juri, C.; Martí-Climent, J.M.; Quincoces, G.; Arbizu, J.; Riverol, M.; Zubieta, J.L.; et al. New MRI, 18F-DOPA and 11C-(+)-α-Dihydrotetrabenazine Templates for Macaca Fascicularis Neuroimaging: Advantages to Improve PET Quantification. Neuroimage 2009, 47, 533–539. [Google Scholar] [CrossRef]
- Ballanger, B.; Tremblay, L.; Sgambato-Faure, V.; Beaudoin-Gobert, M.; Lavenne, F.; le Bars, D.; Costes, N. A Multi-Atlas Based Method for Automated Anatomical Macaca Fascicularis Brain MRI Segmentation and PET Kinetic Extraction. Neuroimage 2013, 77, 26–43. [Google Scholar] [CrossRef]
- Frey, S.; Pandya, D.N.; Chakravarty, M.M.; Bailey, L.; Petrides, M.; Collins, D.L. An MRI Based Average Macaque Monkey Stereotaxic Atlas and Space (MNI Monkey Space). Neuroimage 2011, 55, 1435–1442. [Google Scholar] [CrossRef]
- Dhawan, V.; Ma, Y.; Pillai, V.; Spetsieris, P.; Chaly, T.; Belakhlef, A.; Margouleff, C.; Eidelberg, D. Comparative Analysis of Striatal FDOPA Uptake in Parkinson’s Disease: Ratio Method Versus Graphical Approach. J. Nucl. Med. 2002, 43, 1324–1330. [Google Scholar]
- Jokinen, P.; Helenius, H.; Rauhala, E.; Brück, A.; Eskola, O.; Rinne, J.O. Simple Ratio Analysis Of18F-Fluorodopa Uptake in Striatal Subregions Separates Patients with Early Parkinson Disease from Healthy Controls. J. Nucl. Med. 2009, 50, 893–899. [Google Scholar] [CrossRef] [PubMed]
- Maidment, N.T.; Brumbaugh, D.R.; Rudolph, V.D.; Erdelyi, E.; Evans, C.J. Microdialysis of Extracellular Endogenous Opioid Peptides from Rat Brain in vivo. Neuroscience 1989, 33, 549–557. [Google Scholar] [CrossRef] [PubMed]
- Lopez, W.O.C.; Fonoff, E.T.; Hamani, C.; Tierney, T.S.; Alho, E.; dos Santos Ghilardi, M.G.; Teixeira, M.J.; Martinez, R.C.R. Optimizing Microdialysis for Deep Brain Stimulation. Front. Biosci. 2016, 8, 299–310. [Google Scholar]
- Harkavyi, A.; Abuirmeileh, A.; Lever, R.; Kingsbury, A.E.; Biggs, C.S.; Whitton, P.S. Glucagon-like Peptide 1 Receptor Stimulation Reverses Key Deficits in Distinct Rodent Models of Parkinson’s Disease. J Neuroinflamm. 2008, 5, 19. [Google Scholar] [CrossRef] [PubMed]
- Hou, J.; Liu, Q.; Li, Y.; Sun, H.; Zhang, J. An in Vivo Microdialysis Study of FLZ Penetration through the Blood-Brain Barrier in Normal and 6-Hydroxydopamine Induced Parkinson’s Disease Model Rats. Biomed. Res. Int. 2014, 2014, 850493. [Google Scholar] [CrossRef]
- Vargas-Romero, F.; González-Barrios, R.; Guerra-Calderas, L.; Escobedo-Avila, I.; Cortés-Pérez, D.; López-Ornelas, A.; Rocha, L.; Soto-Reyes, E.; Velasco, I. Histamine Modulates Midbrain Dopamine Neuron Differentiation through the Regulation of Epigenetic Marks. Front. Cell Neurosci. 2019, 13, 215. [Google Scholar] [CrossRef]
- Fisch, G.S. Evaluating Data from Behavioral Analysis: Visual Inspection or Statistical Models? Behav. Process. 2001, 54, 137–154. [Google Scholar] [CrossRef]
- Tarlow, K.R.; Penland, A. Outcome Assessment and Inference with the Percentage of Nonoverlapping Data (PND) Single-Case Statistic. Pract. Innov. 2016, 1, 221–233. [Google Scholar] [CrossRef]






| Target | Forward (5′–3′) | Reverse (5′–3′) |
|---|---|---|
| LMX1A | GAGACCACCTGCTTCTACCG | GCCCGCATAACAAACTCATT |
| FOXA2 | ATTGCTGGTCGTTTGTTGTG | TGTACGTGTTCATGCCGTTC |
| TH | GAGTACACCGCCGAGGAGATTG | GCGGATATACTGGGTGCACTGG |
| SOX2 | TCAGGAGTTGTCAAGGCAGAGAAG | CTCAGTCCTAGTCTTAAAGAGGCAGC |
| OCT4 | AGTGAGAGGCAACCTGGAGA | ACACTCGGACCACATCCTTC |
| KLF4 | GAACTGACCAGGCACTACCG | TTCTGGCAGTGTGGGTCATA |
| GAPDH | ATGACATCAAGAAGGTGGTG | CATACCAGGAAATGAGCTTG |
| Antibody | Host | Dilution | Brand | Catalog Number |
|---|---|---|---|---|
| OCT4 | Mouse | 1:250 | BD Biosciences (Franklin Lakes, NJ, USA) | 611202 |
| SOX2 | Rabbit | 1:500 | Abcam (Cambridge, UK) | AB97959 |
| NANOG | Rabbit | 1:1000 | Peprotech (Rocky Hill, NJ, USA) | 500-P236 |
| SSEA4 | Mouse | 1:400 | Abcam | AB16287 |
| NESTIN | Rabbit | 1:500 | Covance (Daytona Beach, FL, USA) | 839801 |
| TH | Rabbit | 1:1000 IC 1:500 IH | Pel-Freez Biologicals (Rogers, AR, USA) | P40101 |
| βIII-TUBULIN | Mouse | 1:3000 | Covance | MMS435P |
| FOXA2 | Rabbit | 1:500 | Millipore (Burlington, MA, USA) | 07633 |
| MAP2 | Mouse | 1:500 | Sigma-Aldrich (Saint-Louis, MO, USA) | M4403 |
| GIRK2 | Rabbit | 1:1000 | Millipore | AB5200 |
| GFAP | Mouse | 1:500 | Sigma-Aldrich | G3893 |
| GAD 65/67R | Rabbit | 1:200 | Millipore | AB1511 |
| Serotonin | Rabbit | 1:5000 | Sigma-Aldrich | S5545 |
| Alexa Fluor 350 Anti-Mouse IgG | Goat | 1:1000 | Thermo Fisher Scientific | A21049 |
| Alexa Fluor 488 Anti-Mouse IgG | Goat | 1:1000 | Thermo Fisher Scientific | A11029 |
| Alexa Fluor 568 Anti-Rabbit IgG | Goat | 1:1000 | Thermo Fisher Scientific | A11036 |
| Sample | Reads PF | Paired Reads (Trimmomatic) | % Trim | RNA STAR | % STAR | RmDup | RmDup Aprox | RNA STAR Count Unmapped | RNA STAR Count Mapped | RNA STAR Count % | RNA STAR Count ALL % |
|---|---|---|---|---|---|---|---|---|---|---|---|
| Day0-r1 | 2,975,881 | 2,828,933 | 95.0% | 2,510,778 | 88.7% | 92.5% | 2,322,470 | 557,997 | 1,952,781 | 77.78% | 65.6% |
| Day0-r2 | 3,349,069 | 3,199,515 | 95.5% | 2,847,575 | 89.0% | 92.3% | 2,628,312 | 637,844 | 2,209,731 | 77.60% | 65.9% |
| Day0-r3 | 2,927,902 | 2,799,662 | 95.6% | 2,471,487 | 88.2% | 92.6% | 2,288,597 | 552,669 | 1,918,818 | 77.64% | 65.5% |
| Day14-r1 | 2,639,118 | 2,506,396 | 94.9% | 2,212,330 | 88.2% | 92.5% | 2,046,405 | 474,216 | 1,738,114 | 78.56% | 65.8% |
| Day14-r2 | 2,831,743 | 2,700,318 | 95.3% | 2,401,428 | 88.9% | 92.4% | 2,218,919 | 498,600 | 1,902,828 | 79.24% | 67.2% |
| Day14-r3 | 2,768,272 | 2,639,168 | 95.3% | 2,348,184 | 88.9% | 92.5% | 2,172,070 | 497,287 | 1,850,897 | 78.82% | 66.8% |
| Day14-r4 | 3,185,871 | 3,035,967 | 95.2% | 2,709,484 | 89.2% | 91.7% | 2,484,597 | 569,966 | 2,139,518 | 78.96% | 67.1% |
| Day28-r1 | 1,624,658 | 1,549,005 | 95.3% | 1,393,858 | 89.9% | 96.1% | 1,339,498 | 255,928 | 1,137,930 | 81.64% | 70.0% |
| Day28-r2 | 2,593,374 | 2,461,511 | 94.9% | 2,214,291 | 89.9% | 94.7% | 2,096,934 | 412,712 | 1,801,579 | 81.36% | 69.4% |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
López-Ornelas, A.; Escobedo-Avila, I.; Ramírez-García, G.; Lara-Rodarte, R.; Meléndez-Ramírez, C.; Urrieta-Chávez, B.; Barrios-García, T.; Cáceres-Chávez, V.A.; Flores-Ponce, X.; Carmona, F.; et al. Human Embryonic Stem Cell-Derived Immature Midbrain Dopaminergic Neurons Transplanted in Parkinsonian Monkeys. Cells 2023, 12, 2738. https://doi.org/10.3390/cells12232738
López-Ornelas A, Escobedo-Avila I, Ramírez-García G, Lara-Rodarte R, Meléndez-Ramírez C, Urrieta-Chávez B, Barrios-García T, Cáceres-Chávez VA, Flores-Ponce X, Carmona F, et al. Human Embryonic Stem Cell-Derived Immature Midbrain Dopaminergic Neurons Transplanted in Parkinsonian Monkeys. Cells. 2023; 12(23):2738. https://doi.org/10.3390/cells12232738
Chicago/Turabian StyleLópez-Ornelas, Adolfo, Itzel Escobedo-Avila, Gabriel Ramírez-García, Rolando Lara-Rodarte, César Meléndez-Ramírez, Beetsi Urrieta-Chávez, Tonatiuh Barrios-García, Verónica A. Cáceres-Chávez, Xóchitl Flores-Ponce, Francia Carmona, and et al. 2023. "Human Embryonic Stem Cell-Derived Immature Midbrain Dopaminergic Neurons Transplanted in Parkinsonian Monkeys" Cells 12, no. 23: 2738. https://doi.org/10.3390/cells12232738
APA StyleLópez-Ornelas, A., Escobedo-Avila, I., Ramírez-García, G., Lara-Rodarte, R., Meléndez-Ramírez, C., Urrieta-Chávez, B., Barrios-García, T., Cáceres-Chávez, V. A., Flores-Ponce, X., Carmona, F., Reynoso, C. A., Aguilar, C., Kerik, N. E., Rocha, L., Verdugo-Díaz, L., Treviño, V., Bargas, J., Ramos-Mejía, V., Fernández-Ruiz, J., ... Velasco, I. (2023). Human Embryonic Stem Cell-Derived Immature Midbrain Dopaminergic Neurons Transplanted in Parkinsonian Monkeys. Cells, 12(23), 2738. https://doi.org/10.3390/cells12232738

