Multiple Copies of microRNA Binding Sites in Long 3′UTR Variants Regulate Axonal Translation
Abstract
1. Introduction
2. Materials and Methods
2.1. Animals
2.2. Cell Culture
2.3. Preparation of the Microfluidic Chamber (MFC)
2.4. Primary Motor Neuron Cultures
2.5. RNA Extraction from MN Axons and Cell Bodies
2.6. Plasmid Construction
2.7. Mature miRNA Mimics
2.8. Plasmid Transfection
2.9. qRT-PCR Analysis
2.10. Live Cell Confocal Imaging and Photobleaching
2.11. Live Cell Imaging FRAP Analysis of GFP Signal Build-up
2.12. RNA Extraction
2.13. miRNA Constructs
2.14. Dual Luciferase Assay
2.15. RNA-seq and Analysis
2.16. DaPars Analysis
2.17. Somatic Variant Calling
2.18. Timespan Differential Gene Expression
2.19. Western Blot
2.20. Statistics
3. Results
3.1. miRNA-Target Complementation Determines the Rate of Translation
3.2. Synthetic miRNA Containing Seed Modifications Differentially Regulate Protein Synthesis
3.3. Axonal Compared to Cell-Body Transcripts Have Longer 3′UTR Variants Containing Multiple Copies of miRNA Target Sequences
3.4. miR-129-5p Differentially Regulates Axonal Versus Cell-Body mRNA Expression of Kif5b mRNAs
3.5. The Multiplicity of miR-129-5p Sites in the Long 3′UTR Variant of Kif5b Slows Its Translation Rate
4. Discussion
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Chevalier-Larsen, E.; Holzbaur, E.L.F. Axonal transport and neurodegenerative disease. Biochim. Biophys. Acta Mol. Basis Dis. 2006, 1762, 1094–1108. [Google Scholar] [CrossRef]
- Bilsland, L.G.; Sahai, E.; Kelly, G.; Golding, M.; Greensmith, L.; Schiavo, G. Deficits in axonal transport precede ALS symptoms in vivo. Proc. Natl. Acad. Sci. USA 2010, 107, 20523–20528. [Google Scholar] [CrossRef] [PubMed]
- Jung, H.; Yoon, B.C.; Holt, C.E. Axonal mRNA localization and local protein synthesis in nervous system assembly, maintenance and repair. Nat. Rev. Neurosci. 2012, 13, 308. [Google Scholar] [CrossRef]
- López-Erauskin, J.; Tadokoro, T.; Baughn, M.W.; Myers, B.; McAlonis-Downes, M.; Chillon-Marinas, C.; Asiaban, J.N.; Artates, J.; Bui, A.T.; Vetto, A.P.; et al. ALS/FTD-Linked Mutation in FUS Suppresses Intra-axonal Protein Synthesis and Drives Disease without Nuclear Loss-of-Function of FUS. Neuron 2018, 100, 816–830.e7. [Google Scholar] [CrossRef] [PubMed]
- Hafner, A.S.; Donlin-Asp, P.G.; Leitch, B.; Herzog, E.; Schuman, E.M. Local protein synthesis is a ubiquitous feature of neuronal pre- And postsynaptic compartments. Science 2019, 364, eaau3644. [Google Scholar] [CrossRef] [PubMed]
- Zahavi, E.E.; Maimon, R.; Perlson, E. Spatial-specific functions in retrograde neuronal signalling. Traffic 2017, 18, 415–424. [Google Scholar] [CrossRef] [PubMed]
- Rotem, N.; Magen, I.; Ionescu, A.; Gershoni-Emek, N.; Altman, T.; Costa, C.J.; Gradus, T.; Pasmanik-Chor, M.; Willis, D.E.; Ben-Dov, I.Z.; et al. ALS Along the Axons—Expression of Coding and Noncoding RNA Differs in Axons of ALS models. Sci. Rep. 2017, 7, 44500. [Google Scholar] [CrossRef]
- Hörnberg, H.; Holt, C. RNA-binding proteins and translational regulation in axons and growth cones. Front. Neurosci. 2013, 7, 81. [Google Scholar] [CrossRef]
- Perry, R.B.-T.; Rishal, I.; Doron-Mandel, E.; Kalinski, A.L.; Medzihradszky, K.F.; Terenzio, M.; Alber, S.; Koley, S.; Lin, A.; Rozenbaum, M.; et al. Nucleolin-Mediated RNA Localization Regulates Neuron Growth and Cycling Cell Size. Cell Rep. 2016, 16, 1664–1676. [Google Scholar] [CrossRef]
- Tushev, G.; Glock, C.; Heumüller, M.; Biever, A.; Jovanovic, M.; Schuman, E.M. Alternative 3′ UTRs Modify the Localization, Regulatory Potential, Stability, and Plasticity of mRNAs in Neuronal Compartments. Neuron 2018, 98, 495–511.e6. [Google Scholar] [CrossRef]
- Andreassi, C.; Riccio, A. To localize or not to localize: mRNA fate is in 3′UTR ends. Trends Cell Biol. 2009, 19, 465–474. [Google Scholar] [CrossRef] [PubMed]
- Andreassi, C.; Luisier, R.; Crerar, H.; Darsinou, M.; Blokzijl-Franke, S.; Lenn, T.; Luscombe, N.M.; Cuda, G.; Gaspari, M.; Saiardi, A.; et al. Cytoplasmic cleavage of IMPA1 3′ UTR is necessary for maintaining axon integrity. Cell Rep. 2021, 34, 108778. [Google Scholar] [CrossRef] [PubMed]
- Wang, B.; Bao, L. Axonal microRNAs: Localization, function and regulatory mechanism during axon development. J. Mol. Cell Biol. 2017, 9, 82–90. [Google Scholar] [CrossRef] [PubMed]
- Gershoni-Emek, N.; Altman, T.; Ionescu, A.; Costa, C.J.; Gradus-Pery, T.; Willis, D.E.; Perlson, E. Localization of RNAi Machinery to Axonal Branch Points and Growth Cones Is Facilitated by Mitochondria and Is Disrupted in ALS. Front. Mol. Neurosci. 2018, 11, 311. [Google Scholar] [CrossRef]
- Sasaki, Y.; Gross, C.; Xing, L.; Goshima, Y.; Bassell, G.J. Identification of axon-enriched MicroRNAs localized to growth cones of cortical neurons. Dev. Neurobiol. 2013, 74, 397–406. [Google Scholar] [CrossRef]
- Corradi, E.; Baudet, M.L. In the right place at the right time: Mirnas as key regulators in developing axons. Int. J. Mol. Sci. 2020, 21, 8726. [Google Scholar] [CrossRef]
- Bartel, D.P. Metazoan MicroRNAs. Cell 2018, 10, 2035. [Google Scholar] [CrossRef]
- Krol, J.; Loedige, I.; Filipowicz, W. The widespread regulation of microRNA biogenesis, function and decay. Nat. Rev. Genet. 2010, 11, 597–610. [Google Scholar] [CrossRef]
- Friedman, R.C.; Farh, K.K.H.; Burge, C.B.; Bartel, D.P. Most mammalian mRNAs are conserved targets of microRNAs. Genome Res. 2009, 19, 92–105. [Google Scholar] [CrossRef]
- Krek, A.; Grün, D.; Poy, M.N.; Wolf, R.; Rosenberg, L.; Epstein, E.J.; MacMenamin, P.; Da Piedade, I.; Gunsalus, K.C.; Stoffel, M.; et al. Combinatorial microRNA target predictions. Nat. Genet. 2005, 37, 495–500. [Google Scholar] [CrossRef]
- Shomron, N. MicroRNAs and their antagonists as novel therapeutics. Eur. J. Cancer 2009, 45, 388–390. [Google Scholar] [CrossRef] [PubMed]
- Lewis, B.P.; Burge, C.B.; Bartel, D.P. Conserved seed pairing, often flanked by adenosines, indicates that thousands of human genes are microRNA targets. Cell 2005, 120, 15–20. [Google Scholar] [CrossRef] [PubMed]
- Agarwal, V.; Bell, G.W.; Nam, J.W.; Bartel, D.P. Predicting effective microRNA target sites in mammalian mRNAs. eLife 2015, 4, e05005. [Google Scholar] [CrossRef] [PubMed]
- Moore, M.J.; Scheel, T.K.H.; Luna, J.M.; Park, C.Y.; Fak, J.J.; Nishiuchi, E.; Rice, C.M.; Darnell, R.B. MiRNA-target chimeras reveal miRNA 3′-end pairing as a major determinant of Argonaute target specificity. Nat. Commun. 2015, 6, 8864. [Google Scholar] [CrossRef]
- Brennecke, J.; Stark, A.; Russell, R.B.; Cohen, S.M. Principles of microRNA-target recognition. PLoS Biol. 2005, 3, e85. [Google Scholar] [CrossRef]
- Denzler, R.; McGeary, S.E.; Title, A.C.; Agarwal, V.; Bartel, D.P.; Stoffel, M. Impact of MicroRNA Levels, Target-Site Complementarity, and Cooperativity on Competing Endogenous RNA-Regulated Gene Expression. Mol. Cell 2016, 64, 565–579. [Google Scholar] [CrossRef]
- Li, X.; Zhao, X.; Fang, Y.; Jiang, X.; Duong, T.; Fan, C.; Huang, C.C.; Kain, S.R. Generation of destabilized green fluorescent protein as a transcription reporter. J. Biol. Chem. 1998, 273, 34970–34975. [Google Scholar] [CrossRef] [PubMed]
- Griffiths-Jones, S.; Saini, H.K.; van Dongen, S.; Enright, A.J. miRBase: Tools for microRNA genomics. Nucleic Acids Res. 2008, 36, D154–D158. [Google Scholar] [CrossRef]
- Chang, J.T.; Chen, I.H.; Liao, C.T.; Wang, H.M.; Hsu, Y.M.; Hung, K.F.; Lin, C.J.; Hsieh, L.L.; Cheng, A.J. A reverse transcription comparative real-time PCR method for quantitative detection of angiogenic growth factors in head and neck cancer patients. Clin. Biochem. 2002, 35, 591–596. [Google Scholar] [CrossRef]
- Galiveti, C.R.; Rozhdestvensky, T.S.; Brosius, J.; Lehrach, H.; Konthur, Z. Application of housekeeping npcRNAs for quantitative expression analysis of human transcriptome by real-time PCR. RNA 2010, 16, 450–461. [Google Scholar] [CrossRef]
- Voorhoeve, P.M.; Le Sage, C.; Schrier, M.; Gilis, A.J.M.; Stoop, H.; Nagel, R.; Liu, Y.-P.; van Duijse, J.; Drost, J.; Griekspoor, A.; et al. A genetic screen implicates miRNA-372 and miRNA-373 as oncogenes in testicular germ cell tumors. Cell 2006, 124, 1169–1181. [Google Scholar] [CrossRef] [PubMed]
- Andrews, S. Babraham Bioinformatics—FastQC A Quality Control tool for High Throughput Sequence Data. Soil 2020. Available online: https://www.bioinformatics.babraham.ac.uk/projects/fastqc (accessed on 16 August 2022).
- Aronesty, E. ea-utils: Command-line tools for processing biological sequencing data. Expr. Anal. 2011. [Google Scholar]
- Forster, S.C.; Finkel, A.M.; Gould, J.A.; Hertzog, P.J. RNA-eXpress annotates novel transcript features in RNA-seq data. Bioinformatics 2013, 29, 810–812. [Google Scholar] [CrossRef]
- Bu, J.; Chi, X.; Jin, Z. HSA: A Heuristic Splice Alignment Tool. BMC Syst. Biol. 2013, 7, S10. [Google Scholar] [CrossRef]
- Anders, S.; Pyl, P.T.; Huber, W. HTSeq-A Python framework to work with high-throughput sequencing data. Bioinformatics 2015, 31, 166–169. [Google Scholar] [CrossRef]
- Varet, H.; Brillet-Guéguen, L.; Coppée, J.-Y.; Dillies, M.-A. SARTools: A DESeq2- and edgeR-based R pipeline for comprehensive differential analysis of RNA-Seq data. PLoS ONE 2016, 11, e0157022. [Google Scholar] [CrossRef]
- Maza, E. In papyro comparison of TMM (edgeR), RLE (DESeq2), and MRN normalization methods for a simple two-conditions-without-replicates RNA-seq experimental design. Front. Genet. 2016, 7, 164. [Google Scholar] [CrossRef]
- Xia, Z.; Donehower, L.A.; Cooper, T.A.; Neilson, J.R.; Wheeler, D.A.; Wagner, E.J.; Li, W. Dynamic analyses of alternative polyadenylation from RNA-seq reveal a 3′2-UTR landscape across seven tumour types. Nat. Commun. 2014, 5, 5350. [Google Scholar] [CrossRef]
- van der Auwera, G.A.; O’Connor, B. Genomics in the Cloud: Using Docker, GATK, and WDL in Terra. Genom. Cloud Using Docker GATK WDL Terra 2020, 300. [Google Scholar]
- Chen, S.; Zhou, Y.; Chen, Y.; Gu, J. Fastp: An ultra-fast all-in-one FASTQ preprocessor. Bioinformatics 2018, 34, i884–i890. [Google Scholar] [CrossRef] [PubMed]
- Dobin, A.; Davis, C.A.; Schlesinger, F.; Drenkow, J.; Zaleski, C.; Jha, S.; Batut, P.; Chaisson, M.; Gingeras, T.R. STAR: Ultrafast universal RNA-seq aligner. Bioinformatics 2013, 29, 15–21. [Google Scholar] [CrossRef] [PubMed]
- Love, M.I.; Huber, W.; Anders, S. Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2. Genome Biol. 2014, 15, 550. [Google Scholar] [CrossRef] [PubMed]
- Yoshino, H.; Enokida, H.; Chiyomaru, T.; Tatarano, S.; Hidaka, H.; Yamasaki, T.; Gotannda, T.; Tachiwada, T.; Nohata, N.; Yamane, T.; et al. Tumor suppressive microRNA-1 mediated novel apoptosis pathways through direct inhibition of splicing factor serine/arginine-rich 9 (SRSF9/SRp30c) in bladder cancer. Biochem. Biophys. Res. Commun. 2012, 417, 588–593. [Google Scholar] [CrossRef] [PubMed]
- Li, J.; Cao, Y.; Ma, X.-J.; Wang, H.-J.; Zhang, J.; Luo, X.; Chen, W.; Wu, Y.; Meng, Y.; Yuan, Y.; et al. Roles of miR-1-1 and miR-181c in ventricular septal defects. Int. J. Cardiol. 2013, 168, 1441–1446. [Google Scholar] [CrossRef]
- Yuan, W.; Tang, C.; Zhu, W.; Zhu, J.; Lin, Q.; Fu, Y.; Deng, C.; Xue, Y.; Yang, M.; Wu, S.; et al. CDK6 mediates the effect of attenuation of miR-1 on provoking cardiomyocyte hypertrophy. Mol. Cell Biochem. 2016, 412, 289–296. [Google Scholar] [CrossRef] [PubMed]
- Tang, Z.; Liang, R.; Zhao, S.; Wang, R.; Huang, R.; Li, K. CNN3 is regulated by microrna-1 during muscle development in pigs. Int. J. Biol. Sci. 2014, 10, 377–385. [Google Scholar] [CrossRef]
- Gong, L.; Zhu, H.; Li, T.; Ming, G.; Duan, X.; Wang, J.; Jiang, Y. Molecular signatures of cytotoxic effects in human embryonic kidney 293 cells treated with single and mixture of ochratoxin A and citrinin. Food Chem. Toxicol. 2019, 123, 374–384. [Google Scholar] [CrossRef]
- Takaya, T.; Ono, K.; Kawamura, T.; Takanabe, R.; Kaichi, S.; Morimoto, T.; Wada, H.; Kita, T.; Shimatsu, A.; Hasegawa, K. MicroRNA-1 and microRNA-133 in spontaneous myocardial differentiation of mouse embryonic stem cells. Circ. J. 2009, 73, 1492–1497. [Google Scholar] [CrossRef]
- Wang, L.; Yuan, Y.; Li, J.; Ren, H.; Cai, Q.; Chen, X.; Liang, H.; Shan, H.; Fu, Z.D.; Gao, X.; et al. MicroRNA-1 aggravates cardiac oxidative stress by post-transcriptional modification of the antioxidant network. Cell Stress Chaperones 2015, 20, 411–420. [Google Scholar] [CrossRef]
- Xie, C.; Huang, H.; Sun, X.; Guo, Y.; Hamblin, M.; Ritchie, R.P.; Garcia-Barrio, M.T.; Zhang, J.; Chen, Y.E. MicroRNA-1 regulates smooth muscle cell differentiation by repressing kruppel-like factor 4. Stem Cells Dev. 2011, 20, 205–210. [Google Scholar] [CrossRef] [PubMed]
- Ai, J.; Zhang, R.; Gao, X.; Niu, H.-F.; Wang, N.; Xu, Y.; Li, Y.; Ma, N.; Sun, L.-H.; Pan, Z.-W.; et al. Overexpression of microRNA-1 impairs cardiac contractile function by damaging sarcomere assembly. Cardiovasc. Res. 2012, 95, 385–393. [Google Scholar] [CrossRef] [PubMed]
- Kusakabe, R.; Tani, S.; Nishitsuji, K.; Shindo, M.; Okamura, K.; Miyamoto, Y.; Nakai, K.; Suzuki, Y.; Kusakabe, T.G.; Inoue, K. Characterization of the compact bicistronic microRNA precursor, miR-1/miR-133, expressed specifically in Ciona muscle tissues. Gene Expr. Patterns 2013, 13, 43–50. [Google Scholar] [CrossRef] [PubMed]
- Rao, P.K.; Kumar, R.M.; Farkhondeh, M.; Baskerville, S.; Lodish, H.F. Myogenic factors that regulate expression of muscle-specific microRNAs. Proc. Natl. Acad. Sci. USA 2006, 103, 8721–8726. [Google Scholar] [CrossRef] [PubMed]
- Mattioli, C.C.; Rom, A.; Franke, V.; Imami, K.; Arrey, G.; Terne, M.; Woehler, A.; Akalin, A.; Ulitsky, I.; Chekulaeva, M. Alternative 3 UTRs direct localization of functionally diverse protein isoforms in neuronal compartments. Nucleic Acids Res. 2019, 47, 2560–2573. [Google Scholar] [CrossRef]
- Su, Y.-Y.; Ye, M.; Li, L.; Liu, C.; Pan, J.; Liu, W.-W.; Jiang, Y.; Jiang, X.; Zhang, X.; Shu, Y.; et al. KIF5B promotes the forward transport and axonal function of the voltage-gated sodium channel Nav1.8. J. Neurosci. 2013, 33, 17884–17896. [Google Scholar] [CrossRef]
- Ma, H.; Cai, Q.; Lu, W.; Sheng, Z.-H.; Mochida, S. KIF5B motor adaptor syntabulin maintains synaptic transmission in sympathetic neurons. J. Neurosci. 2009, 29, 13019–13029. [Google Scholar] [CrossRef]
- Altman, T.; Ionescu, A.; Ibraheem, A.; Priesmann, D.; Gradus-Pery, T.; Farberov, L.; Alexandra, G.; Shelestovich, N.; Dafinca, R.; Shomron, N.; et al. Axonal TDP-43 condensates drive neuromuscular junction disruption through inhibition of local synthesis of nuclear encoded mitochondrial proteins. Nat. Commun. 2021, 12, 6914. [Google Scholar] [CrossRef]
- Deglincerti, A.; Liu, Y.; Colak, D.; Hengst, U.; Xu, G.; Jaffrey, S. Coupled local translation and degradation regulate growth cone collapse. Nat. Commun. 2015, 6, 6888. [Google Scholar] [CrossRef]
- Bassell, G.J.; Zhang, H.; Byrd, A.L.; Femino, A.M.; Singer, R.H.; Taneja, K.L.; Lifshitz, L.M.; Herman, I.M.; Kosik, K.S. Sorting of β-actin mRNA and protein to neurites and growth cones in culture. J. Neurosci. 1998, 18, 251–265. [Google Scholar] [CrossRef]
- Campbell, D.S.; Holt, C.E. Chemotropic responses of retinal growth cones mediated by rapid local protein synthesis and degradation. Neuron 2001, 32, 1013–1026. [Google Scholar] [CrossRef] [PubMed]
- Antar, L.N.; Li, C.; Zhang, H.; Carroll, R.C.; Bassell, G.J. Local functions for FMRP in axon growth cone motility and activity-dependent regulation of filopodia and spine synapses. Mol. Cell. Neurosci. 2006, 32, 37–48. [Google Scholar] [CrossRef] [PubMed]
- Parvin, S.; Takeda, R.; Sugiura, Y.; Neyazaki, M.; Nogi, T.; Sasaki, Y. Fragile X mental retardation protein regulates accumulation of the active zone protein Munc18-1 in presynapses via local translation in axons during synaptogenesis. Neurosci. Res. 2019, 146, 36–47. [Google Scholar] [CrossRef] [PubMed]
- Kang, H.; Schuman, E.M. A requirement for local protein synthesis in neurotrophin-induced hippocampal synaptic plasticity. Science 1996, 273, 1402–1406. [Google Scholar] [CrossRef] [PubMed]
- Perlson, E.; Hanz, S.; Ben-Yaakov, K.; Segal-Ruder, Y.; Seger, R.; Fainzilber, M. Vimentin-Dependent Spatial Translocation of an Activated MAP Kinase in Injured Nerve. Neuron 2005, 45, 715–726. [Google Scholar] [CrossRef] [PubMed]
- Terenzio, M.; Koley, S.; Samra, N.; Rishal, I.; Zhao, Q.; Sahoo, P.K.; Urisman, A.; Marvaldi, L.; Oses-Prieto, J.A.; Forester, C.; et al. Locally translated mTOR controls axonal local translation in nerve injury. Science 2018, 359, 1416–1421. [Google Scholar] [CrossRef] [PubMed]
- Rangaraju, V.; Lauterbach, M.; Schuman, E.M. Spatially Stable Mitochondrial Compartments Fuel Local Translation during Plasticity. Cell 2019, 176, 73–84.e15. [Google Scholar] [CrossRef]
- Cioni, J.-M.; Lin, J.Q.; Holtermann, A.V.; Franze, K.; Harris, W.A.; Holt Correspondence, C.E.; Koppers, M.; Jakobs, M.A.H.; Azizi, A.; Turner-Bridger, B.; et al. Late Endosomes Act as mRNA Translation Platforms and Sustain Mitochondria in Axons. Cell 2019, 176, 56–72. [Google Scholar] [CrossRef]
- Haramati, S.; Chapnik, E.; Sztainberg, Y.; Eilam, R.; Zwang, R.; Gershoni, N.; McGlinn, E.; Heiser, P.W.; Wills, A.-M.; Wirguin, I.; et al. miRNA malfunction causes spinal motor neuron disease. Proc. Natl. Acad. Sci. USA 2010, 107, 13111–13116. [Google Scholar] [CrossRef]
- Campos-Melo, D.; Droppelmann, C.A.; He, Z.; Volkening, K.; Strong, M.J. Altered microRNA expression profile in Amyotrophic Lateral Sclerosis: A role in the regulation of NFL mRNA levels. Mol. Brain 2013, 6, 26. [Google Scholar] [CrossRef]
- Altman, T.; Ionescu, A.; Ibraheem, A.; Priesmann, D.; Gradus-Pery, T.; Farberov, L.; Gayster, A.; Shelestovich, N.; Dafinca, R.; Shomron, N.; et al. Axonal TDP-43 Drives NMJ Disruption through Inhibition of Local Protein Synthesis. 2021.
- Ionescu, A.; Gradus, T.; Altman, T.; Maimon, R.; Saraf Avraham, N.; Geva, M.; Hayden, M.; Perlson, E. Targeting the Sigma-1 Receptor via Pridopidine Ameliorates Central Features of ALS Pathology in a SOD1 G93A Model. Cell Death Dis. 2019, 10, 210. [Google Scholar] [CrossRef] [PubMed]
- Brenner, D.; Yilmaz, R.; Müller, K.; Grehl, T.; Petri, S.; Meyer, T.; Grosskreutz, J.; Weydt, P.; Ruf, W.; Neuwirth, C.; et al. Hot-spot KIF5A mutations cause familial ALS. Brain 2018, 141, 688–697. [Google Scholar] [CrossRef] [PubMed]
- Smith, E.F.; Shaw, P.J.; de Vos, K.J. The role of mitochondria in amyotrophic lateral sclerosis. Neurosci. Lett. 2019, 710, 132933. [Google Scholar] [CrossRef] [PubMed]
- Loffreda, A.; Nizzardo, M.; Arosio, A.; Ruepp, M.-D.; Calogero, R.A.; Volinia, S.; Galasso, M.; Bendotti, C.; Ferrarese, C.; Lunetta, C.; et al. miR-129-5p: A key factor and therapeutic target in amyotrophic lateral sclerosis. Prog. Neurobiol. 2020, 190, 101803. [Google Scholar] [CrossRef]
- Paez-Colasante, X.; Figueroa-Romero, C.; Rumora, A.E.; Hur, J.; Mendelson, F.E.; Hayes, J.M.; Backus, C.; Taubman, G.F.; Heinicke, L.; Walter, N.G.; et al. Cytoplasmic TDP43 Binds microRNAs: New Disease Targets in Amyotrophic Lateral Sclerosis. Front. Cell Neurosci. 2020, 14, 117. [Google Scholar] [CrossRef]
- Zhao, J.; Fok, A.H.K.; Fan, R.; Kwan, P.-Y.; Chan, H.-L.; Lo, L.H.-Y.; Chan, Y.-S.; Yung, W.-H.; Huang, J.; Lai, C.S.W.; et al. Specific depletion of the motor protein KIF5B leads to deficits in dendritic transport, synaptic plasticity and memory. eLife 2020, 9, e53456. [Google Scholar] [CrossRef]
- Nicolas, A.; Kenna, K.P.; Renton, A.E.; Ticozzi, N.; Faghri, F.; Chia, R.; Dominov, J.A.; Kenna, B.J.; Nalls, M.A.; Keagle, P.; et al. Genome-wide Analyses Identify KIF5A as a Novel ALS Gene. Neuron 2018, 97, 1268–1283.e6. [Google Scholar] [CrossRef]
- Crimella, C.; Baschirotto, C.; Arnoldi, A.; Tonelli, A.; Tenderini, E.; Airoldi, G.; Martinuzzi, A.; Trabacca, A.; Losito, L.; Scarlato, M.; et al. Mutations in the motor and stalk domains of KIF5A in spastic paraplegia type 10 and in axonal Charcot-Marie-Tooth type 2. Clin. Genet. 2012, 82, 157–164. [Google Scholar] [CrossRef]







| Primers/miRNAs | Sequence and Dye |
|---|---|
| miR-1-3p-CY3 | 5′-UGGAAUGUAAAGAAGUAUGUAU-CY3-3′ |
| miR-1-3p full complementation 3′UTR (WT) | 5′-TTACATACTTCTTTACATTCCA-3′ |
| miR-1-3p 8mer 3′UTR | 5′-CATCATTATAACGGACATTCCA-3′ |
| miR-1-3p 7mer-8m 3′UTR | 5′-CATCATTATAACGGACATTCCT-3′ |
| miR-1-3p 7mer-1A 3′UTR | 5′-CATCATTATAACGGGCATTCCA-3′ |
| miR-1-3p 6mer 3′UTR | 5′-CATCATTATAACGGGCATTCCT-3′ |
| miR-124-3p-CY3 | 5′-UAAGGCACGCGGUGAAUGCCAA-CY3-3′ |
| miR-206-CY3 | 5′-UGGAAUGUAAGGAAGUGUGUGG-CY3-3′ |
| miR-206 full complementation 3′UTR | 5′-CCACACACTTCCTTACATTCCA-3′ |
| miR-206 8mer 3′UTR | 5′-AATACTTAGAAAGGACATTCCA-3′ |
| miR-1-3p-8mer-CY3 | 5′-UGGAAUGUCCGUUAUAAUGAUG-CY3-3′ |
| miR-1-3p-7mer-8m-CY3 | 5′-AGGAAUGUCCGUUAUAAUGAUG-CY3-3′ |
| miR-1-3p-7mer-1A-CY3 | 5′-UGGAAUGCCCGUUAUAAUGAUG-CY3-3′ |
| miR-1-3p-6mer-CY3 | 5′-AGGAAUGCCCGUUAUAAUGAUG -CY3-3′ |
| miR-129-5p-CY3 | 5′-CUUUUGCGGUCUGGGCUUGC -CY3- 3′ |
| miR-129-5p 7mer-1A 3′UTR | 5′-TCTCAAAAATAAATCAAAAAA-3′ |
| Primer. | Sequence |
|---|---|
| hsa-Kif5b For | CATACAATGAGTCTGAAACAAAATCTACACTCTTATT |
| hsa-Kif5b Rev | CACAAACTGTGTTCTTAATTGTTTTGGC |
| hsa-GAPDH for | CCACTCCTCCACCTTTGACGCT |
| hsa-GAPDH rev | ACCCTGTTGCTGTAGCCAAATTCG |
| mmu-Kif5b CDS For | TAACCTTTCAGTCCATGAAGACAAAAACC |
| mmu-Kif5b CDS Rev | GACTTCATCTGGACTACACACGAAACG |
| mmu-Gapdh For | GAGTATGTCGTGGAGTCTACTGGTGTCTTC |
| mmu-Gapdh Rev | CGGAGATGATGACCCTTTTGGCT |
| Short 3′UTR For | GGTGTGTCCTTCGTGTCTTCACTGT |
| Short 3′UTR Rev | TTAGTAGAAAAGGGAAAATGAAAAGCAATAGC |
| Long 3′UTR For | GATAATTGGTTCAGAAGAGAAACTCAATGAAA |
| Long 3′UTR Rev | TAGACTCTCCTCTGTTACCTCAAATCAAACTG |
| miRNA | Thermo Fisher Scientific Assay ID |
|---|---|
| miR-129-5p | 000590 |
| miR-124a-3p | 000446 |
| miR-1-3p | 002222 |
| miR-206 | 000510 |
| miR1-124 | miR1-6mer | miR1-8mer | miR1-7mer-A1 | miR 1 -7mer 8m | pmiR1-miR1 | |
|---|---|---|---|---|---|---|
| p-miR1|miR1-124-cy3 | 0.18723866 | 0.00140018 | 0.00318815 | 0.01248199 | 8.1725E-14 | |
| p-miR1-6mer | 0.18723866 | 0.01491379 | 0.01201426 | 0.04581773 | 5.8869E-13 | |
| p-miR1-8mer | 0.00140018 | 0.01491379 | 0.27336066 | 0.49944018 | 9.0681E-17 | |
| p-miR1-7mer-A1 | 0.00318815 | 0.01201426 | 0.27336066 | 0.32428856 | 6.5754E-06 | |
| p-miR 1 -7mer 8m | 0.01248199 | 0.04581773 | 0.49944018 | 0.32428856 | 2.1994E-07 | |
| p-miR1|miR1-cy3 | 8.1725E-14 | 5.8869E-13 | 9.0681E-17 | 6.5754E-06 | 2.1994E-07 |
| miR-124 | miR-206 | 8mer | GFP (miR-1) | GFP only | |
|---|---|---|---|---|---|
| p-miR206|miR124-cy3 | 2.23E-07 | 4.185E-15 | 1.08E-07 | 0.209767 | |
| p-miR206|miR206-cy3 | 2.23E-07 | 0.0158373 | 0.395211 | 5.75E-06 | |
| p-miR206-8mer | 4.19E-15 | 0.015837 | 0.001321 | 2.75E-13 | |
| p-miR206|miR1-cy3 | 1.08E-07 | 0.395211 | 0.0013213 | 2.2E-06 | |
| p-miR206 | 0.209767 | 5.75E-06 | 2.746E-13 | 2.2E-06 |
| miR124-Cy3 | miR1-Cy3 | 8mer-Cy3 | 6mer-Cy3 | 7mer8m-Cy3 | 7mer1A-Cy3 | miR206-cy3 | |
|---|---|---|---|---|---|---|---|
| miR124-Cy3 | 8.173E-14 | 4.806E-06 | 0.046807 | 2.083E-07 | 0.0234587 | 0.0002063 | |
| miR1-Cy3 | 8.173E-14 | 9.497E-06 | 9.615E-14 | 2.381E-05 | 5.69E-12 | 4.508E-06 | |
| 8mer-Cy3 | 4.806E-06 | 9.497E-06 | 0.0004608 | 0.2907446 | 0.029917 | 0.379676 | |
| 6mer-Cy3 | 0.046807 | 9.615E-14 | 0.0004608 | 2.738E-05 | 0.1732727 | 0.0043319 | |
| 7mer8m-Cy3 | 2.083E-07 | 2.381E-05 | 0.2907446 | 2.738E-05 | 0.0056587 | 0.204547 | |
| 7mer1A-Cy3 | 0.0234587 | 5.69E-12 | 0.029917 | 0.1732727 | 0.0056587 | 0.0608088 | |
| miR206-cy3 | 0.0002063 | 4.508E-06 | 0.379676 | 0.0043319 | 0.204547 | 0.0608088 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Farberov, L.; Ionescu, A.; Zoabi, Y.; Shapira, G.; Ibraheem, A.; Azan, Y.; Perlson, E.; Shomron, N. Multiple Copies of microRNA Binding Sites in Long 3′UTR Variants Regulate Axonal Translation. Cells 2023, 12, 233. https://doi.org/10.3390/cells12020233
Farberov L, Ionescu A, Zoabi Y, Shapira G, Ibraheem A, Azan Y, Perlson E, Shomron N. Multiple Copies of microRNA Binding Sites in Long 3′UTR Variants Regulate Axonal Translation. Cells. 2023; 12(2):233. https://doi.org/10.3390/cells12020233
Chicago/Turabian StyleFarberov, Luba, Ariel Ionescu, Yazeed Zoabi, Guy Shapira, Amjd Ibraheem, Yosi Azan, Eran Perlson, and Noam Shomron. 2023. "Multiple Copies of microRNA Binding Sites in Long 3′UTR Variants Regulate Axonal Translation" Cells 12, no. 2: 233. https://doi.org/10.3390/cells12020233
APA StyleFarberov, L., Ionescu, A., Zoabi, Y., Shapira, G., Ibraheem, A., Azan, Y., Perlson, E., & Shomron, N. (2023). Multiple Copies of microRNA Binding Sites in Long 3′UTR Variants Regulate Axonal Translation. Cells, 12(2), 233. https://doi.org/10.3390/cells12020233

