Metronomic Photodynamic Therapy with Conjugated Polymer Nanoparticles in Glioblastoma Tumor Microenvironment
Abstract
1. Introduction
2. Materials and Methods
2.1. Materials
2.2. Nanoparticle Synthesis
2.3. Cell Lines and Culture Conditions
2.4. Light Irradiation Device and Experimental Setup for PDT Experiments
2.5. PDT In Vitro of Monocultures of GBM Cell Lines
2.6. ROS Production Measurement after PDT
2.7. HIF-1 Activation Assay after PDT
2.8. Evaluation of Cell Death Mechanism
2.9. PDT In Vitro Evaluation in Co-Cultures of GBM-TAMs
2.10. Gene Expression Analysis in TAMs of Co-Cultures after PDT
2.11. GBM Xenograft Mouse Model
2.12. PDT In Vivo Evaluation
2.13. Statistical Analysis
3. Results and Discussion
3.1. Synthesis of CPNs
3.2. PDT Cytotoxicity in Monocultures of GBM Cell Lines
3.3. PDT Effects on HIF-1 Activation and ROS Production in GBM Cells
3.4. Cell Death Mechanism Evaluation after PDT
3.5. In Vitro Evaluation of PDT in Co-Cultures of GBM-TAMs
3.6. In Vivo Evaluation of PDT with CPNs in GBM Xenograft Mouse Model
4. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Ibarra, L.E.; Porcal, G.V.; Macor, L.P.; Ponzio, R.A.; Spada, R.M.; Lorente, C.; Chesta, C.A.C.A.; Rivarola, V.A.; Palacios, R.E. Metallated porphyrin-doped conjugated polymer nanoparticles for efficient photodynamic therapy of brain and colorectal tumor cells. Nanomedicine 2018, 13, 605–624. [Google Scholar] [CrossRef] [PubMed]
- Ibarra, L.E.; Beaugé, L.; Arias-Ramos, N.; Rivarola, V.A.; Chesta, C.A.; López-Larrubia, P.; Palacios, R.E. Trojan horse monocyte-mediated delivery of conjugated polymer nanoparticles for improved photodynamic therapy of glioblastoma. Nanomedicine 2020, 15, 1687–1707. [Google Scholar] [CrossRef] [PubMed]
- Ibarra, L.E.; Vilchez, M.L.; Caverzán, M.D.; Milla Sanabria, L.N. Understanding the glioblastoma tumor biology to optimize photodynamic therapy: From molecular to cellular events. J. Neurosci. Res. 2021, 99, 1024–1047. [Google Scholar] [CrossRef] [PubMed]
- Bartusik-Aebisher, D.; Żołyniak, A.; Barnaś, E.; Machorowska-Pieniążek, A.; Oleś, P.; Kawczyk-Krupka, A.; Aebisher, D. The Use of Photodynamic Therapy in the Treatment of Brain Tumors—A Review of the Literature. Molecules 2022, 27, 6847. [Google Scholar] [CrossRef]
- Akimoto, J. Photodynamic therapy for malignant brain tumors. Neurol. Med. Chir. 2016, 56, 151–157. [Google Scholar] [CrossRef]
- Leroy, H.A.; Baert, G.; Guerin, L.; Delhem, N.; Mordon, S.; Reyns, N.; Vignion-Dewalle, A.S. Interstitial Photodynamic Therapy for Glioblastomas: A Standardized Procedure for Clinical Use. Cancers 2021, 13, 5754. [Google Scholar] [CrossRef]
- Kostron, H.; Obwegeser, A.; Jakober, R. Photodynamic therapy in neurosurgery: A review. J. Photochem. Photobiol. B Biol. 1996, 36, 157–168. [Google Scholar] [CrossRef]
- Kostron, H. Photodynamic diagnosis and therapy and the brain. Methods Mol. Biol. 2010, 635, 261–280. [Google Scholar] [CrossRef]
- Foresto, E.; Gilardi, P.; Ibarra, L.E.; Cogno, I.S. Light-activated green drugs: How we can use them in photodynamic therapy and mass-produce them with biotechnological tools. Phytomed. Plus 2021, 1, 100044. [Google Scholar] [CrossRef]
- Spada, R.M.; Macor, L.P.; Hernández, L.I.; Ponzio, R.A.; Ibarra, L.E.; Lorente, C.; Chesta, C.A.; Palacios, R.E. Amplified singlet oxygen generation in metallated-porphyrin doped conjugated polymer nanoparticles. Dyes Pigment. 2018, 149, 212–223. [Google Scholar] [CrossRef]
- Bacellar, I.O.L.; Tsubone, T.M.; Pavani, C.; Baptista, M.S. Photodynamic efficiency: From molecular photochemistry to cell death. Int. J. Mol. Sci. 2015, 16, 20523–20559. [Google Scholar] [CrossRef]
- Kuimova, M.K.; Yahioglu, G.; Ogilby, P.R. Singlet oxygen in a cell: Spatially dependent lifetimes and quenching rate constants. J. Am. Chem. Soc. 2009, 131, 332–340. [Google Scholar] [CrossRef] [PubMed]
- Schmitt, F.J.; Renger, G.; Friedrich, T.; Kreslavski, V.D.; Zharmukhamedov, S.K.; Los, D.A.; Kuznetsov, V.V.; Allakhverdiev, S.I. Reactive oxygen species: Re-evaluation of generation, monitoring and role in stress-signaling in phototrophic organisms. Biochim. Biophys. Acta-Bioenerg. 2014, 1837, 835–848. [Google Scholar] [CrossRef] [PubMed]
- Mahmoudi, K.; Garvey, K.L.; Bouras, A.; Cramer, G.; Stepp, H.; Jesu Raj, J.G.; Bozec, D.; Busch, T.M.; Hadjipanayis, C.G. 5-aminolevulinic acid photodynamic therapy for the treatment of high-grade gliomas. J. Neurooncol. 2019, 141, 595–607. [Google Scholar] [CrossRef]
- Kim, M.M.; Darafsheh, A. Light Sources and Dosimetry Techniques for Photodynamic Therapy. Photochem. Photobiol. 2020, 96, 280–294. [Google Scholar] [CrossRef] [PubMed]
- Caverzán, M.D.; Beaugé, L.; Chesta, C.A.; Palacios, R.E.; Ibarra, L.E. Photodynamic therapy of Glioblastoma cells using doped conjugated polymer nanoparticles: An in vitro comparative study based on redox status. J. Photochem. Photobiol. B Biol. 2020, 212, 112045. [Google Scholar] [CrossRef]
- Hambardzumyan, D.; Bergers, G. Glioblastoma: Defining Tumor Niches. Trends Cancer 2015, 1, 252–265. [Google Scholar] [CrossRef]
- Chédeville, A.L.; Lourdusamy, A.; Monteiro, A.R.; Hill, R.; Madureira, P.A. Investigating glioblastoma response to hypoxia. Biomedicines 2020, 8, 310. [Google Scholar] [CrossRef]
- Algorri, J.F.; Ochoa, M.; Roldán-Varona, P.; Rodríguez-Cobo, L.; López-Higuera, J.M. Light technology for efficient and effective photodynamic therapy: A critical review. Cancers 2021, 13, 3484. [Google Scholar] [CrossRef]
- Kirino, I.; Fujita, K.; Sakanoue, K.; Sugita, R.; Yamagishi, K.; Takeoka, S.; Fujie, T.; Uemoto, S.; Morimoto, Y. Metronomic photodynamic therapy using an implantable LED device and orally administered 5-aminolevulinic acid. Sci. Rep. 2020, 10, 22017. [Google Scholar] [CrossRef]
- Rego-Filho, F.G.; De Araujo, M.T.; De Oliveira, K.T.; Bagnato, V.S. Validation of photodynamic action via photobleaching of a new curcumin-based composite with enhanced water solubility. J. Fluoresc. 2014, 24, 1407–1413. [Google Scholar] [CrossRef] [PubMed]
- James, N.S.; Cheruku, R.R.; Missert, J.R.; Sunar, U.; Pandey, R.K. Measurement of cyanine dye photobleaching in photosensitizer cyanine dye conjugates could help in optimizing light dosimetry for improved photodynamic therapy of cancer. Molecules 2018, 23, 1842. [Google Scholar] [CrossRef] [PubMed]
- Lamberti, M.J.; Pansa, M.F.; Vera, R.E.; Fernández-Zapico, M.E.; Vittar, N.B.R.; Rivarola, V.A. Transcriptional activation of HIF-1 by a ROSERK axis underlies the resistance to photodynamic therapy. PLoS ONE 2017, 12, e0177801. [Google Scholar] [CrossRef]
- Zhan, Q.; Yue, W.; Hu, S. Effect of photodynamic therapy and endostatin on human glioma xenografts in nude mice. Photodiagn. Photodyn. Ther. 2011, 8, 314–320. [Google Scholar] [CrossRef] [PubMed]
- Milla Sanabria, L.; Rodríguez, M.E.; Cogno, I.S.; Rumie Vittar, N.B.; Pansa, M.F.; Lamberti, M.J.; Rivarola, V.A. Direct and indirect photodynamic therapy effects on the cellular and molecular components of the tumor microenvironment. Biochim. Biophys. Acta-Rev. Cancer 2013, 1835, 36–45. [Google Scholar] [CrossRef]
- Simsek, C.; Esin, E.; Yalcin, S. Metronomic Chemotherapy: A Systematic Review of the Literature and Clinical Experience. J. Oncol. 2019, 2019, 5483791. [Google Scholar] [CrossRef]
- Zhou, Q.; Guo, P.; Wang, X.; Nuthalapati, S.; Gallo, J.M. Preclinical pharmacokinetic and pharmacodynamic evaluation of metronomic and conventional temozolomide dosing regimens. J. Pharmacol. Exp. Ther. 2007, 321, 265–275. [Google Scholar] [CrossRef]
- Yamagishi, K.; Kirino, I.; Takahashi, I.; Amano, H.; Takeoka, S.; Morimoto, Y.; Fujie, T. Tissue-adhesive wirelessly powered optoelectronic device for metronomic photodynamic cancer therapy. Nat. Biomed. Eng. 2018, 3, 27–36. [Google Scholar] [CrossRef]
- Bogaards, A.; Varma, A.; Zhang, K.; Zach, D.; Bisland, S.K.; Moriyama, E.H.; Lilge, L.; Muller, P.J.; Wilson, B.C. Fluorescence image-guided brain tumour resection with adjuvant metronomic photodynamic therapy: Pre-clinical model and technology development. Photochem. Photobiol. Sci. 2005, 4, 438–442. [Google Scholar] [CrossRef]
- Bisland, S.K.; Lilge, L.; Lin, A.; Rusnov, R.; Wilson, B.C. Metronomic Photodynamic Therapy as a New Paradigm for Photodynamic Therapy: Rationale and Preclinical Evaluation of Technical Feasibility for Treating Malignant Brain Tumors. Photochem. Photobiol. 2004, 80, 22–30. [Google Scholar] [CrossRef]
- Zhang, C.; Yuan, Q.; Zhang, Z.; Tang, Y. A pH-Responsive Drug Delivery System Based on Conjugated Polymer for Effective Synergistic Chemo-/Photodynamic Therapy. Molecules 2023, 28, 399. [Google Scholar] [CrossRef] [PubMed]
- Pham, T.T.D.; Jung, S.J.; Oh, C.M.; Yang, J.K.; Lee, D.; Kidanemariam, A.; Muhammad, A.; Kim, S.; Shin, T.J.; Park, J.H.; et al. Conjugated Polymer Nanoparticles: Photothermal and Photodynamic Capabilities According to Molecular Ordering in Their Assembly Structures. Macromolecules 2023, 56, 311–322. [Google Scholar] [CrossRef]
- Ibarra, L.E.; Camorani, S.; Agnello, L.; Pedone, E.; Pirone, L.; Chesta, C.A.; Palacios, R.E.; Fedele, M.; Cerchia, L. Selective Photo-Assisted Eradication of Triple-Negative Breast Cancer Cells through Aptamer Decoration of Doped Conjugated Polymer Nanoparticles. Pharmaceutics 2022, 14, 626. [Google Scholar] [CrossRef] [PubMed]
- Ponzio, R.A.; Ibarra, L.E.; Achilli, E.E.; Odella, E.; Chesta, C.A.; Martínez, S.R.; Palacios, R.E. Sweet light o’ mine: Photothermal and photodynamic inactivation of tenacious pathogens using conjugated polymers. J. Photochem. Photobiol. B Biol. 2022, 234, 112510. [Google Scholar] [CrossRef]
- Ibarra, L.E. Development of nanosystems for active tumor targeting in photodynamic therapy. Ther. Deliv. 2022, 13, 71–74. [Google Scholar] [CrossRef]
- Chen, Z.; Feng, X.; Herting, C.J.; Garcia, V.A.; Nie, K.; Pong, W.W.; Rasmussen, R.; Dwivedi, B.; Seby, S.; Wolf, S.A.; et al. Cellular and molecular identity of tumor-associated macrophages in glioblastoma. Cancer Res. 2017, 77, 2266–2278. [Google Scholar] [CrossRef]
- Caverzán, M.D.; Beaugé, L.; Oliveda, P.M.; González, B.C.; Bühler, E.M.; Ibarra, L.E. Exploring Monocytes-Macrophages in Immune Microenvironment of Glioblastoma for the Design of Novel Therapeutic Strategies. Brain Sci. 2023, 13, 542. [Google Scholar] [CrossRef] [PubMed]
- Costa, E.C.; Gaspar, V.M.; Marques, J.G.; Coutinho, P.; Correia, I.J. Evaluation of Nanoparticle Uptake in Co-culture Cancer Models. PLoS ONE 2013, 8, e70072. [Google Scholar] [CrossRef]
- Foglietta, F.; Pinnelli, V.; Giuntini, F.; Barbero, N.; Panzanelli, P.; Durando, G.; Terreno, E.; Serpe, L.; Canaparo, R. Sonodynamic Treatment Induces Selective Killing of Cancer Cells in an In Vitro Co-Culture Model. Cancers 2021, 13, 3852. [Google Scholar] [CrossRef] [PubMed]
- Gallastegui, A.; Spada, R.M.; Cagnetta, G.; Ponzio, R.A.; Martínez, S.R.; Previtali, C.M.; Gómez, M.L.; Palacios, R.E.; Chesta, C.A. Conjugated Polymer Nanoparticles as Unique Coinitiator-Free, Water-Soluble, Visible-Light Photoinitiators of Vinyl Polymerization. Macromol. Rapid Commun. 2020, 41, 1900601. [Google Scholar] [CrossRef]
- Lamberti, M.J.; Morales Vasconsuelo, A.B.; Ferrara, M.G.; Rumie Vittar, N.B. Recapitulation of Hypoxic Tumor–stroma Microenvironment to Study Photodynamic Therapy Implications. Photochem. Photobiol. 2020, 96, 897–905. [Google Scholar] [CrossRef] [PubMed]
- Starr, T.; Bauler, T.J.; Malik-Kale, P.; Steele-Mortimer, O. The phorbol 12-myristate-13-acetate differentiation protocol is critical to the interaction of THP-1 macrophages with Salmonella Typhimurium. PLoS ONE 2018, 13, e0193601. [Google Scholar] [CrossRef] [PubMed]
- Herold-Mende, C.; Linder, B.; Andersen, J.K.; Miletic, H.; Hossain, J.A. Tumor-Associated Macrophages in Gliomas—Basic Insights and Treatment Opportunities. Cancers 2022, 14, 1319. [Google Scholar] [CrossRef]
- Georgieva, P.B.; Mathivet, T.; Alt, S.; Giese, W.; Riva, M.; Balcer, M.; Gerhardt, H. Long-lived tumor-associated macrophages in glioma. Neuro-Oncol. Adv. 2020, 2, vdaa127. [Google Scholar] [CrossRef]
- Chen, Z.; Ross, J.L.; Hambardzumyan, D. Intravital 2-photon imaging reveals distinct morphology and infiltrative properties of glioblastoma-associated macrophages. Proc. Natl. Acad. Sci. USA 2019, 116, 14254–14259. [Google Scholar] [CrossRef]
- Lu-Emerson, C.; Snuderl, M.; Kirkpatrick, N.D.; Goveia, J.; Davidson, C.; Huang, Y.; Riedemann, L.; Taylor, J.; Ivy, P.; Duda, D.G.; et al. Increase in tumor-associated macrophages after antiangiogenic therapy is associated with poor survival among patients with recurrent glioblastoma. Neuro Oncol. 2013, 15, 1079–1087. [Google Scholar] [CrossRef]
- Chen, Z.; Hambardzumyan, D. Macrophage-tumor cell intertwine drives the transition into a mesenchymal-like cellular state of glioblastoma. Cancer Cell 2021, 39, 743–745. [Google Scholar] [CrossRef]
- Martínez, S.R.; Ibarra, L.E.; Ponzio, R.A.; Forcone, M.V.; Wendel, A.B.; Chesta, C.A.; Spesia, M.B.; Palacios, R.E. Photodynamic Inactivation of ESKAPE Group Bacterial Pathogens in Planktonic and Biofilm Cultures Using Metallated Porphyrin-Doped Conjugated Polymer Nanoparticles. ACS Infect. Dis. 2020, 6, 2202–2213. [Google Scholar] [CrossRef] [PubMed]
- Eruslanov, E.; Kusmartsev, S. Identification of ROS using oxidized DCFDA and flow-cytometry. Methods Mol. Biol. 2010, 594, 57–72. [Google Scholar] [CrossRef]
- Soriano Pérez, M.L.; Funes, J.A.; Flores Bracamonte, C.; Ibarra, L.E.; Forrellad, M.A.; Taboga, O.; Cariddi, L.N.; Salinas, F.J.; Ortega, H.H.; Alustiza, F.; et al. Development and biological evaluation of pNIPAM-based nanogels as vaccine carriers. Int. J. Pharm. 2023, 630, 122435. [Google Scholar] [CrossRef] [PubMed]
- Genin, M.; Clement, F.; Fattaccioli, A.; Raes, M.; Michiels, C. M1 and M2 macrophages derived from THP-1 cells differentially modulate the response of cancer cells to etoposide. BMC Cancer 2015, 15, 577. [Google Scholar] [CrossRef]
- Maeß, M.B.; Sendelbach, S.; Lorkowski, S. Selection of reliable reference genes during THP-1 monocyte differentiation into macrophages. BMC Mol. Biol. 2010, 11, 90. [Google Scholar] [CrossRef] [PubMed]
- Daigneault, M.; Preston, J.A.; Marriott, H.M.; Whyte, M.K.B.; Dockrell, D.H. The identification of markers of macrophage differentiation in PMA-stimulated THP-1 cells and monocyte-derived macrophages. PLoS ONE 2010, 5, e8668. [Google Scholar] [CrossRef]
- Arias-Ramos, N.; Ibarra, L.E.; Serrano-Torres, M.; Yagüe, B.; Caverzán, M.D.; Chesta, C.A.; Palacios, R.E.; López-Larrubia, P. Iron Oxide Incorporated Conjugated Polymer Nanoparticles for Simultaneous Use in Magnetic Resonance and Fluorescent Imaging of Brain Tumors. Pharmaceutics 2021, 13, 1258. [Google Scholar] [CrossRef] [PubMed]
- Kersemans, V.; Cornelissen, B.; Allen, P.D.; Beech, J.S.; Smart, S.C. Subcutaneous tumor volume measurement in the awake, manually restrained mouse using MRI. J. Magn. Reson. Imaging 2013, 37, 1499–1504. [Google Scholar] [CrossRef] [PubMed]
- Zhang, Y.; Dube, C.; Gibert, M.; Cruickshanks, N.; Wang, B.; Coughlan, M.; Yang, Y.; Setiady, I.; Deveau, C.; Saoud, K.; et al. The p53 Pathway in Glioblastoma. Cancers 2018, 10, 297. [Google Scholar] [CrossRef] [PubMed]
- Maria Forte, I.; Indovina, P.; Antonella Iannuzzi, C.; Cirillo, D.; Marzo, D.D.I.; Barone, D.; Capone, F.; Pentimalli, F.; Giordano, A. Targeted therapy based on p53 reactivation reduces both glioblastoma cell growth and resistance to temozolomide. Int. J. Oncol. 2019, 54, 2189–2199. [Google Scholar] [CrossRef]
- Lee, S.Y. Temozolomide resistance in glioblastoma multiforme. Genes Dis. 2016, 3, 198–210. [Google Scholar] [CrossRef]
- Aguilar Cosme, J.R.; Gagui, D.C.; Green, N.H.; Bryant, H.E.; Claeyssens, F. In Vitro Low-Fluence Photodynamic Therapy Parameter Screening Using 3D Tumor Spheroids Shows that Fractionated Light Treatments Enhance Phototoxicity. ACS Biomater. Sci. Eng. 2021, 7, 5078–5089. [Google Scholar] [CrossRef]
- Busch, T.M. Local physiological changes during photodynamic therapy. Lasers Surg. Med. 2006, 38, 494–499. [Google Scholar] [CrossRef]
- Shi, X.; Zhang, H.; Jin, W.; Liu, W.; Yin, H.; Li, Y.; Dong, H. Metronomic photodynamic therapy with 5-aminolevulinic acid induces apoptosis and autophagy in human SW837 colorectal cancer cells. J. Photochem. Photobiol. B Biol. 2019, 198, 111586. [Google Scholar] [CrossRef]
- Moserova, I.; Kralova, J. Role of ER Stress Response in Photodynamic Therapy: ROS Generated in Different Subcellular Compartments Trigger Diverse Cell Death Pathways. PLoS ONE 2012, 7, e32972. [Google Scholar] [CrossRef] [PubMed]
- Lange, C.; Lehmann, C.; Mahler, M.; Bednarski, P.J. Comparison of Cellular Death Pathways after mTHPC-mediated Photodynamic Therapy (PDT) in Five Human Cancer Cell Lines. Cancers 2019, 11, 702. [Google Scholar] [CrossRef] [PubMed]
- Fernando, L.P.; Kandel, P.K.; Yu, J.B.; McNeill, J.; Ackroyd, P.C.; Christensen, K. a Mechanism of Cellular Uptake of Highly Fluorescent Conjugated Polymer Nanoparticles. Biomacromolecules 2010, 11, 2675–2682. [Google Scholar] [CrossRef]
- Villalpando-Rodriguez, G.E.; Gibson, S.B. Reactive Oxygen Species (ROS) Regulates Different Types of Cell Death by Acting as a Rheostat. Oxid. Med. Cell. Longev. 2021, 2021, 9912436. [Google Scholar] [CrossRef]
- Huis in ‘t Veld, R.V.; Heuts, J.; Ma, S.; Cruz, L.J.; Ossendorp, F.A.; Jager, M.J. Current Challenges and Opportunities of Photodynamic Therapy against Cancer. Pharmaceutics 2023, 15, 330. [Google Scholar] [CrossRef] [PubMed]
- Davies, N.; Wilson, B.C. Interstitial in vivo ALA-PpIX mediated metronomic photodynamic therapy (mPDT) using the CNS-1 astrocytoma with bioluminescence monitoring. Photodiagn. Photodyn. Ther. 2007, 4, 202–212. [Google Scholar] [CrossRef]
- Lerouge, L.; Gries, M.; Chateau, A.; Daouk, J.; Lux, F.; Rocchi, P.; Cedervall, J.; Olsson, A.-K.; Tillement, O.; Frochot, C.; et al. Targeting Glioblastoma-Associated Macrophages for Photodynamic Therapy Using AGuIX®-Design Nanoparticles. Pharmaceutics 2023, 15, 997. [Google Scholar] [CrossRef]
- Gattas, M.J.; Estecho, I.G.; Lago Huvelle, M.A.; Errasti, A.E.; Carrera Silva, E.A.; Simian, M. A heterotypic tridimensional model to study the interaction of macrophages and glioblastoma in vitro. Int. J. Mol. Sci. 2021, 22, 5105. [Google Scholar] [CrossRef]
- Park, J.V.; Chandra, R.; Cai, L.; Ganguly, D.; Li, H.; Toombs, J.E.; Girard, L.; Brekken, R.A.; Minna, J.D. Tumor Cells Modulate Macrophage Phenotype in a Novel In Vitro Co-Culture Model of the NSCLC Tumor Microenvironment. J. Thorac. Oncol. 2022, 17, 1178–1191. [Google Scholar] [CrossRef]
- Soyama, T.; Sakuragi, A.; Oishi, D.; Kimura, Y.; Aoki, H.; Nomoto, A.; Yano, S.; Nishie, H.; Kataoka, H.; Aoyama, M. Photodynamic therapy exploiting the anti-tumor activity of mannose-conjugated chlorin e6 reduced M2-like tumor-associated macrophages. Transl. Oncol. 2021, 14, 101005. [Google Scholar] [CrossRef] [PubMed]
- Akasov, R.A.; Sholina, N.V.; Khochenkov, D.A.; Alova, A.V.; Gorelkin, P.V.; Erofeev, A.S.; Generalova, A.N.; Khaydukov, E.V. Photodynamic therapy of melanoma by blue-light photoactivation of flavin mononucleotide. Sci. Rep. 2019, 9, 9679. [Google Scholar] [CrossRef] [PubMed]
- Mugas, M.L.; Calvo, G.; Marioni, J.; Céspedes, M.; Martinez, F.; Vanzulli, S.; Sáenz, D.; Di Venosa, G.; Nuñez Montoya, S.; Casas, A. Photosensitization of a subcutaneous tumour by the natural anthraquinone parietin and blue light. Sci. Rep. 2021, 11, 23820. [Google Scholar] [CrossRef] [PubMed]
- Henderson, B.W.; Busch, T.M.; Snyder, J.W. Fluence rate as a modulator of PDT mechanisms. Lasers Surg. Med. 2006, 38, 489–493. [Google Scholar] [CrossRef] [PubMed]
- Chiba, K.; Aihara, Y.; Oda, Y.; Fukui, A.; Tsuduki, S.; Saito, T.; Nitta, M.; Muragaki, Y.; Kawamata, T. Photodynamic therapy for malignant brain tumors in children and young adolescents. Front. Oncol. 2022, 12, 5851. [Google Scholar] [CrossRef]
- Foglar, M.; Aumiller, M.; Bochmann, K.; Buchner, A.; El Fahim, M.; Quach, S.; Sroka, R.; Stepp, H.; Thon, N.; Forbrig, R.; et al. Interstitial Photodynamic Therapy of Glioblastomas: A Long-Term Follow-up Analysis of Survival and Volumetric MRI Data. Cancers 2023, 15, 2603. [Google Scholar] [CrossRef]
Marker | Gene | Forward 5′-3′ | Reverse 3′-5′ | Length (bp) | NM |
---|---|---|---|---|---|
M1 | TNFα | GAGGCCAAGCCCTGGTATG | CGGGCCGATTGATCTCAGC | 91 | NM_000594.4 |
CCR7 | TGAGGTCACGGACGATTACAT | GTAGGCCCACGAAACAAATGAT | 143 | NM_001838.4 | |
M2 | MRC-1 | GGGTTGCTATCACTCTCTATGC | TTTCTTGTCTGTTGCCGTAGTT | 126 | NM_002438.4 |
VEGFA | GGCGAGGCAGCTTGAGTTAA | CACCGCCTCGGCTTGTC | 57 | NM_001025366.3 | |
Ref. | GADPH | GACCTGACCTGCCGTCTAGAAAAA | ACCACCCTGTTGCTGTAGCCAAAT | 245 | NM_001357943.2 |
IC50 * | U87-MG | T98G | M059K |
---|---|---|---|
mPDT | 0.8 (40 J/cm2) | 24.7 (40 J/cm2) | 1.2 (40 J/cm2) |
4.5 (10 J/cm2) | 31.7 (10 J/cm2) | 9 (10 J/cm2) | |
cPDT | 3.5 (40 J/cm2) | 27.6 (40 J/cm2) | 4.7 (40 J/cm2) |
11.3 (10 J/cm2) | 39.6 (10 J/cm2) | 17.4 (10 J/cm2) |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Caverzán, M.D.; Oliveda, P.M.; Beaugé, L.; Palacios, R.E.; Chesta, C.A.; Ibarra, L.E. Metronomic Photodynamic Therapy with Conjugated Polymer Nanoparticles in Glioblastoma Tumor Microenvironment. Cells 2023, 12, 1541. https://doi.org/10.3390/cells12111541
Caverzán MD, Oliveda PM, Beaugé L, Palacios RE, Chesta CA, Ibarra LE. Metronomic Photodynamic Therapy with Conjugated Polymer Nanoparticles in Glioblastoma Tumor Microenvironment. Cells. 2023; 12(11):1541. https://doi.org/10.3390/cells12111541
Chicago/Turabian StyleCaverzán, Matías Daniel, Paula Martina Oliveda, Lucía Beaugé, Rodrigo Emiliano Palacios, Carlos Alberto Chesta, and Luis Exequiel Ibarra. 2023. "Metronomic Photodynamic Therapy with Conjugated Polymer Nanoparticles in Glioblastoma Tumor Microenvironment" Cells 12, no. 11: 1541. https://doi.org/10.3390/cells12111541
APA StyleCaverzán, M. D., Oliveda, P. M., Beaugé, L., Palacios, R. E., Chesta, C. A., & Ibarra, L. E. (2023). Metronomic Photodynamic Therapy with Conjugated Polymer Nanoparticles in Glioblastoma Tumor Microenvironment. Cells, 12(11), 1541. https://doi.org/10.3390/cells12111541