Correction of the Splicing Defect Caused by a Recurrent Variant in ABCA4 (c.769-784C>T) That Underlies Stargardt Disease
Abstract
1. Introduction
2. Materials and Methods
2.1. Antisense Oligonucleotide Design
2.2. In Vitro Rescue Studies in HEK293T Cells Using Midigenes and Antisense Oligonucleotides
2.3. Rescue Studies Using Antisense Oligonucleotides in Fibroblasts
2.4. iPSC Generation and Differentiation to Photoreceptor Precursor Cells
2.5. Rescue Studies Using Antisense Oligonucleotides in Photoreceptor Precursor Cells
2.6. RNA Isolation and cDNA Synthesis
2.7. iPSC and PPC Characterization
2.8. ABCA4 Transcript Analysis
2.9. Statistical Analysis
3. Results
3.1. AONs Are Capable of Rescuing the Splicing Defect in Midigene Splicing Assays
3.2. AON2, -5, and -7 Are the Most Effective None-Overlapping AONs in Splicing Correction in Patient-Derived Fibroblasts
3.3. AON2, -5, and -7 Are Highly Efficacious in Correcting PE in Patient-Derived PPCs
4. Discussion
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Blacharski, P. Fundus flavimaculatus. In Retinal Dystrophies and Degenerations; Newsome, D.A., Ed.; Raven Press: New York, NY, USA, 1988; pp. 135–159. [Google Scholar]
- Allikmets, R.; Singh, N.; Sun, H.; Shroyer, N.F.; Hutchinson, A.; Chidambaram, A.; Gerrard, B.; Baird, L.; Stauffer, D.; Peiffer, A.; et al. A photoreceptor cell-specific ATP-binding transporter gene (ABCR) is mutated in recessive Stargardt macular dystrophy. Nat. Genet. 1997, 15, 236–246. [Google Scholar] [CrossRef] [PubMed]
- Cremers, F.P.; van de Pol, D.J.; van Driel, M.; den Hollander, A.I.; van Haren, F.J.; Knoers, N.V.; Tijmes, N.; Bergen, A.A.; Rohrschneider, K.; Blankenagel, A.; et al. Autosomal recessive retinitis pigmentosa and cone-rod dystrophy caused by splice site mutations in the Stargardt’s disease gene ABCR. Hum. Mol. Genet. 1998, 7, 355–362. [Google Scholar] [CrossRef] [PubMed]
- Lambertus, S.; Lindner, M.; Bax, N.M.; Mauschitz, M.M.; Nadal, J.; Schmid, M.; Schmitz-Valckenberg, S.; den Hollander, A.I.; Weber, B.H.; Holz, F.G.; et al. Progression of Late-Onset Stargardt Disease. Investig. Ophthalmol. Vis. Sci. 2016, 57, 5186–5191. [Google Scholar] [CrossRef] [PubMed]
- Al-Khuzaei, S.; Broadgate, S.; Foster, C.R.; Shah, M.; Yu, J.; Downes, S.M.; Halford, S. An Overview of the Genetics of ABCA4 Retinopathies, an Evolving Story. Genes 2021, 12, 1241. [Google Scholar] [CrossRef] [PubMed]
- Westeneng-van Haaften, S.C.; Boon, C.J.; Cremers, F.P.; Hoefsloot, L.H.; den Hollander, A.I.; Hoyng, C.B. Clinical and genetic characteristics of late-onset Stargardt’s disease. Ophthalmology 2012, 119, 1199–1210. [Google Scholar] [CrossRef]
- Cremers, F.P.M.; Lee, W.; Collin, R.W.J.; Allikmets, R. Clinical spectrum, genetic complexity and therapeutic approaches for retinal disease caused by ABCA4 mutations. Prog. Retin. Eye Res. 2020, 79, 100861. [Google Scholar] [CrossRef] [PubMed]
- Maugeri, A.; van Driel, M.A.; van de Pol, D.J.; Klevering, B.J.; van Haren, F.J.; Tijmes, N.; Bergen, A.A.; Rohrschneider, K.; Blankenagel, A.; Pinckers, A.J.; et al. The 2588G-->C mutation in the ABCR gene is a mild frequent founder mutation in the Western European population and allows the classification of ABCR mutations in patients with Stargardt disease. Am. J. Hum. Genet. 1999, 64, 1024–1035. [Google Scholar] [CrossRef]
- Cornelis, S.S.; Bax, N.M.; Zernant, J.; Allikmets, R.; Fritsche, L.G.; den Dunnen, J.T.; Ajmal, M.; Hoyng, C.B.; Cremers, F.P. In Silico Functional Meta-Analysis of 5962 ABCA4 Variants in 3928 Retinal Dystrophy Cases. Hum. Mutat. 2017, 38, 400–408. [Google Scholar] [CrossRef]
- Cornelis, S.S.; Runhart, E.H.; Bauwens, M.; Corradi, Z.; De Baere, E.; Roosing, S.; Haer-Wigman, L.; Dhaenens, C.-M.; Vulto-van Silfhout, A.T.; Cremers, F.P.M. Personalized genetic counseling for Stargardt disease: Offspring risk estimates based on variant severity. Am. J. Hum. Genet. 2022, 109, 498–507. [Google Scholar] [CrossRef]
- Sangermano, R.; Khan, M.; Cornelis, S.S.; Richelle, V.; Albert, S.; Garanto, A.; Elmelik, D.; Qamar, R.; Lugtenberg, D.; van den Born, L.I.; et al. ABCA4 midigenes reveal the full splice spectrum of all reported noncanonical splice site variants in Stargardt disease. Genome Res. 2018, 28, 100–110. [Google Scholar] [CrossRef]
- Sangermano, R.; Garanto, A.; Khan, M.; Runhart, E.H.; Bauwens, M.; Bax, N.M.; van den Born, L.I.; Khan, M.I.; Cornelis, S.S.; Verheij, J.B.G.M.; et al. Deep-intronic ABCA4 variants explain missing heritability in Stargardt disease and allow correction of splice defects by antisense oligonucleotides. Genet. Med. 2019, 21, 1751–1760. [Google Scholar] [CrossRef] [PubMed]
- Khan, M.; Cornelis, S.S.; Pozo-Valero, M.D.; Whelan, L.; Runhart, E.H.; Mishra, K.; Bults, F.; AlSwaiti, Y.; AlTalbishi, A.; De Baere, E.; et al. Resolving the dark matter of ABCA4 for 1054 Stargardt disease probands through integrated genomics and transcriptomics. Genet. Med. 2020, 22, 1235–1246. [Google Scholar] [CrossRef] [PubMed]
- Runhart, E.H.; Valkenburg, D.; Cornelis, S.S.; Khan, M.; Sangermano, R.; Albert, S.; Bax, N.M.; Astuti, G.D.N.; Gilissen, C.; Pott, J.R.; et al. Late-Onset Stargardt Disease Due to Mild, Deep-Intronic ABCA4 Alleles. Investig. Ophthalmol. Vis. Sci. 2019, 60, 4249–4256. [Google Scholar] [CrossRef] [PubMed]
- Arechavala-Gomeza, V.; Garanto, A. (Eds.) Antisense RNA Design, Delivery, and Analysis; Springer: New York, NY, USA, 2022; pp. 33–49. [Google Scholar]
- Cideciyan, A.V.; Jacobson, S.G.; Ho, A.C.; Garafalo, A.V.; Roman, A.J.; Sumaroka, A.; Krishnan, A.K.; Swider, M.; Schwartz, M.R.; Girach, A. Durable vision improvement after a single treatment with antisense oligonucleotide sepofarsen: A case report. Nat. Med. 2021, 27, 785–789. [Google Scholar] [CrossRef]
- Russell, S.R.; Drack, A.V.; Cideciyan, A.V.; Jacobson, S.G.; Leroy, B.P.; Van Cauwenbergh, C.; Ho, A.C.; Dumitrescu, A.V.; Han, I.C.; Martin, M.; et al. Intravitreal antisense oligonucleotide sepofarsen in Leber congenital amaurosis type 10: A phase 1b/2 trial. Nat. Med. 2022, 28, 1014–1021. [Google Scholar] [CrossRef]
- Slijkerman, R.W.; Vache, C.; Dona, M.; Garcia-Garcia, G.; Claustres, M.; Hetterschijt, L.; Peters, T.A.; Hartel, B.P.; Pennings, R.J.; Millan, J.M.; et al. Antisense Oligonucleotide-based Splice Correction for USH2A-associated Retinal Degeneration Caused by a Frequent Deep-intronic Mutation. Mol. Ther. Nucleic Acids 2016, 5, e381. [Google Scholar] [CrossRef]
- Garanto, A.; van der Velde-Visser, S.D.; Cremers, F.P.M.; Collin, R.W.J. Antisense Oligonucleotide-Based Splice Correction of a Deep-Intronic Mutation in CHM Underlying Choroideremia. Adv. Exp. Med. Biol. 2018, 1074, 83–89. [Google Scholar]
- Bonifert, T.; Gonzalez Menendez, I.; Battke, F.; Theurer, Y.; Synofzik, M.; Schols, L.; Wissinger, B. Antisense Oligonucleotide Mediated Splice Correction of a Deep Intronic Mutation in OPA1. Mol. Ther. Nucleic Acids 2016, 5, e390. [Google Scholar] [CrossRef]
- Albert, S.; Garanto, A.; Sangermano, R.; Khan, M.; Bax, N.M.; Hoyng, C.B.; Zernant, J.; Lee, W.; Allikmets, R.; Collin, R.W.J.; et al. Identification and Rescue of Splice Defects Caused by Two Neighboring Deep-Intronic ABCA4 Mutations Underlying Stargardt Disease. Am. J. Hum. Genet. 2018, 102, 517–527. [Google Scholar] [CrossRef]
- Bauwens, M.; Garanto, A.; Sangermano, R.; Naessens, S.; Weisschuh, N.; De Zaeytijd, J.; Khan, M.; Sadler, F.; Balikova, I.; Van Cauwenbergh, C.; et al. ABCA4-associated disease as a model for missing heritability in autosomal recessive disorders: Novel noncoding splice, cis-regulatory, structural, and recurrent hypomorphic variants. Genet. Med. 2019, 21, 1761–1771. [Google Scholar] [CrossRef]
- Garanto, A.; Duijkers, L.; Tomkiewicz, T.Z.; Collin, R.W.J. Antisense Oligonucleotide Screening to Optimize the Rescue of the Splicing Defect Caused by the Recurrent Deep-Intronic ABCA4 Variant c.4539+2001G>A in Stargardt Disease. Genes 2019, 10, 452. [Google Scholar] [CrossRef]
- Tomkiewicz, T.Z.; Suárez-Herrera, N.; Cremers, F.P.M.; Collin, R.W.J.; Garanto, A. Antisense Oligonucleotide-Based Rescue of Aberrant Splicing Defects Caused by 15 Pathogenic Variants in ABCA4. Int. J. Mol. Sci. 2021, 22, 4621. [Google Scholar] [CrossRef] [PubMed]
- Garanto, A.; Collin, R.W.J. Retinal Gene Therapy: Methods and Protocols; Boon, C.J.F., Wijnholds, J., Eds.; Springer: New York, NY, USA, 2018; pp. 61–78. [Google Scholar]
- Zuker, M. Mfold web server for nucleic acid folding and hybridization prediction. Nucleic Acids Res. 2003, 31, 3406–3415. [Google Scholar] [CrossRef] [PubMed]
- Smith, P.J.; Zhang, C.; Wang, J.; Chew, S.L.; Zhang, M.Q.; Krainer, A.R. An increased specificity score matrix for the prediction of SF2/ASF-specific exonic splicing enhancers. Hum. Mol. Genet. 2006, 15, 2490–2508. [Google Scholar] [CrossRef]
- Cartegni, L.; Wang, J.; Zhu, Z.; Zhang, M.Q.; Krainer, A.R. ESEfinder: A web resource to identify exonic splicing enhancers. Nucleic Acids Res. 2003, 31, 3568–3571. [Google Scholar] [CrossRef]
- Sangermano, R.; Bax, N.M.; Bauwens, M.; van den Born, L.I.; De Baere, E.; Garanto, A.; Collin, R.W.J.; Goercharn-Ramlal, A.S.A.; den Engelsman-van Dijk, A.H.A.; Rohrschneider, K.; et al. Photoreceptor Progenitor mRNA Analysis Reveals Exon Skipping Resulting from the ABCA4 c.5461-10T→C Mutation in Stargardt Disease. Ophthalmology 2016, 123, 1375–1385. [Google Scholar] [CrossRef] [PubMed]
- Flamier, A.; Barabino, A.; Bernier, G. Differentiation of Human Embryonic Stem Cells into Cone Photoreceptors. Bio-Protocol 2016, 6, e1870. [Google Scholar] [CrossRef]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef]
- Schindelin, J.; Arganda-Carreras, I.; Frise, E.; Kaynig, V.; Longair, M.; Pietzsch, T.; Preibisch, S.; Rueden, C.; Saalfeld, S.; Schmid, B.; et al. Fiji: An open-source platform for biological-image analysis. Nat. Methods 2012, 9, 676–682. [Google Scholar] [CrossRef]
- Collin, R.W.; den Hollander, A.I.; van der Velde-Visser, S.D.; Bennicelli, J.; Bennett, J.; Cremers, F.P. Antisense Oligonucleotide (AON)-based Therapy for Leber Congenital Amaurosis Caused by a Frequent Mutation in CEP290. Mol. Ther. Nucleic Acids 2012, 1, e14. [Google Scholar] [CrossRef]
- Gerard, X.; Perrault, I.; Hanein, S.; Silva, E.; Bigot, K.; Defoort-Delhemmes, S.; Rio, M.; Munnich, A.; Scherman, D.; Kaplan, J.; et al. AON-mediated Exon Skipping Restores Ciliation in Fibroblasts Harboring the Common Leber Congenital Amaurosis CEP290 Mutation. Mol. Ther. Nucleic Acids 2012, 1, e29. [Google Scholar] [CrossRef] [PubMed]
- Duijkers, L.; van den Born, L.I.; Neidhardt, J.; Bax, N.M.; Pierrache, L.H.M.; Klevering, B.J.; Collin, R.W.J.; Garanto, A. Antisense Oligonucleotide-Based Splicing Correction in Individuals with Leber Congenital Amaurosis due to Compound Heterozygosity for the c.2991+1655A>G Mutation in CEP290. Int. J. Mol. Sci. 2018, 19, 753. [Google Scholar] [CrossRef] [PubMed]
- Dulla, K.; Aguila, M.; Lane, A.; Jovanovic, K.; Parfitt, D.A.; Schulkens, I.; Chan, H.L.; Schmidt, I.; Beumer, W.; Vorthoren, L.; et al. Splice-Modulating Oligonucleotide QR-110 Restores CEP290 mRNA and Function in Human c.2991+1655A>G LCA10 Models. Mol. Ther. Nucleic Acids 2018, 12, 730–740. [Google Scholar] [CrossRef] [PubMed]
- Bennett, C.F.; Baker, B.F.; Pham, N.; Swayze, E.; Geary, R.S. Pharmacology of Antisense Drugs. Annu. Rev. Pharmacol. Toxicol. 2017, 57, 81–105. [Google Scholar] [CrossRef] [PubMed]
- Crooke, S.T.; Baker, B.F.; Kwoh, T.J.; Cheng, W.; Schulz, D.J.; Xia, S.; Salgado, N.; Bui, H.-H.; Hart, C.E.; Burel, S.A.; et al. Integrated Safety Assessment of 2′-O-Methoxyethyl Chimeric Antisense Oligonucleotides in NonHuman Primates and Healthy Human Volunteers. Mol. Ther. 2016, 24, 1771–1782. [Google Scholar] [CrossRef]
- Sheng, L.; Rigo, F.; Bennett, C.F.; Krainer, A.R.; Hua, Y. Comparison of the efficacy of MOE and PMO modifications of systemic antisense oligonucleotides in a severe SMA mouse model. Nucleic Acids Res. 2020, 48, 2853–2865. [Google Scholar] [CrossRef]
- Khan, M.; Arno, G.; Fakin, A.; Parfitt, D.A.; Dhooge, P.P.A.; Albert, S.; Bax, N.M.; Duijkers, L.; Niblock, M.; Hau, K.L.; et al. Detailed Phenotyping and Therapeutic Strategies for Intronic ABCA4 Variants in Stargardt Disease. Mol. Ther. Nucleic Acids 2020, 21, 412–427. [Google Scholar] [CrossRef]
- Parfitt, D.A.; Lane, A.; Ramsden, C.M.; Carr, A.J.; Munro, P.M.; Jovanovic, K.; Schwarz, N.; Kanuga, N.; Muthiah, M.N.; Hull, S.; et al. Identification and Correction of Mechanisms Underlying Inherited Blindness in Human iPSC-Derived Optic Cups. Cell Stem Cell 2016, 18, 769–781. [Google Scholar] [CrossRef]
- Dulla, K.; Slijkerman, R.; van Diepen, H.C.; Albert, S.; Dona, M.; Beumer, W.; Turunen, J.J.; Chan, H.L.; Schulkens, I.A.; Vorthoren, L.; et al. Antisense oligonucleotide-based treatment of retinitis pigmentosa caused by USH2A exon 13 mutations. Mol. Ther. 2021, 29, 2441–2455. [Google Scholar] [CrossRef]
- Garces, F.; Jiang, K.; Molday, L.L.; Stöhr, H.; Weber, B.H.; Lyons, C.J.; Maberley, D.; Molday, R.S. Correlating the Expression and Functional Activity of ABCA4 Disease Variants With the Phenotype of Patients With Stargardt Disease. Investig. Ophthalmol. Vis. Sci. 2018, 59, 2305–2315. [Google Scholar] [CrossRef]
- Sparrow, J.R.; Blonska, A.; Flynn, E.; Duncker, T.; Greenberg, J.P.; Secondi, R.; Ueda, K.; Delori, F.C. Quantitative Fundus Autofluorescence in Mice: Correlation With HPLC Quantitation of RPE Lipofuscin and Measurement of Retina Outer Nuclear Layer Thickness. Investig. Ophthalmol. Vis. Sci. 2013, 54, 2812–2820. [Google Scholar] [CrossRef] [PubMed]
- Wu, L.; Ueda, K.; Nagasaki, T.; Sparrow, J.R. Light damage in Abca4 and Rpe65rd12 mice. Investig. Ophthalmol. Vis. Sci. 2014, 55, 1910–1918. [Google Scholar] [CrossRef] [PubMed]
- Scharner, J.; Ma, W.K.; Zhang, Q.; Lin, K.-T.; Rigo, F.; Bennett, C.F.; Krainer, A.R. Hybridization-mediated off-target effects of splice-switching antisense oligonucleotides. Nucleic Acids Res. 2020, 48, 802–816. [Google Scholar] [CrossRef] [PubMed]
- Michel, S.; Schirduan, K.; Shen, Y.; Klar, R.; Tost, J.; Jaschinski, F. Using RNA-seq to Assess Off-Target Effects of Antisense Oligonucleotides in Human Cell Lines. Mol. Diagn. Ther. 2021, 25, 77–85. [Google Scholar] [CrossRef] [PubMed]
- Lee, W.; Zernant, J.; Nagasaki, T.; Molday, L.L.; Su, P.Y.; Fishman, G.A.; Tsang, S.H.; Molday, R.S.; Allikmets, R. Cis-acting modifiers in the ABCA4 locus contribute to the penetrance of the major disease-causing variant in Stargardt disease. Hum. Mol. Genet. 2021, 30, 1293–1304. [Google Scholar] [CrossRef] [PubMed]
Name | Sequence 5′→3′ | Length (nt) | % GC | Tm (°C) |
---|---|---|---|---|
AON1 | GAUGGAAUCACUGAUCCUAG | 20 | 45 | 49.7 |
AON2 | AGCUCCAGAGACUGAUGUGA | 20 | 50 | 51.8 |
AON3 | CUCACCACUGCUCCUGC | 17 | 65 | 51.9 |
AON4 | CCUAGAAGAGUCAUGUAGGA | 20 | 45 | 49.7 |
AON5 | ACCACUGCUCCUGCUUUUGC | 20 | 55 | 53.8 |
AON6 | GGAAUCACUGAUCCUAGAAGA | 21 | 53 | 50.5 |
AON7 | CUGGAAACCAAGGUCAUGUC | 20 | 50 | 51.8 |
AON8 | AUGUGAACUCACCACUGCUCC | 21 | 52 | 54.4 |
AON9 | CAAGCUCCAGAGACUGAUGU | 20 | 50 | 51.8 |
SON | UCACAUCAGUCUCUGGAGCU | 20 | 50 | 51.8 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Tomkiewicz, T.Z.; Nieuwenhuis, S.E.; Cremers, F.P.M.; Garanto, A.; Collin, R.W.J. Correction of the Splicing Defect Caused by a Recurrent Variant in ABCA4 (c.769-784C>T) That Underlies Stargardt Disease. Cells 2022, 11, 3947. https://doi.org/10.3390/cells11243947
Tomkiewicz TZ, Nieuwenhuis SE, Cremers FPM, Garanto A, Collin RWJ. Correction of the Splicing Defect Caused by a Recurrent Variant in ABCA4 (c.769-784C>T) That Underlies Stargardt Disease. Cells. 2022; 11(24):3947. https://doi.org/10.3390/cells11243947
Chicago/Turabian StyleTomkiewicz, Tomasz Z., Sara E. Nieuwenhuis, Frans P. M. Cremers, Alejandro Garanto, and Rob W. J. Collin. 2022. "Correction of the Splicing Defect Caused by a Recurrent Variant in ABCA4 (c.769-784C>T) That Underlies Stargardt Disease" Cells 11, no. 24: 3947. https://doi.org/10.3390/cells11243947
APA StyleTomkiewicz, T. Z., Nieuwenhuis, S. E., Cremers, F. P. M., Garanto, A., & Collin, R. W. J. (2022). Correction of the Splicing Defect Caused by a Recurrent Variant in ABCA4 (c.769-784C>T) That Underlies Stargardt Disease. Cells, 11(24), 3947. https://doi.org/10.3390/cells11243947