Next Article in Journal
Exploring the Genetic Diversity and Population Structure of Turkish Laurel Germplasm by the iPBS-Retrotransposon Marker System
Next Article in Special Issue
Analysis of Wheat Bread-Making Gene (wbm) Evolution and Occurrence in Triticale Collection Reveal Origin via Interspecific Introgression into Chromosome 7AL
Previous Article in Journal
Comparison of Different Multivariate Statistical Methods for Screening the Drought Tolerant Genotypes of Pearl Millet (Pennisetum americanum L.) and Sorghum (Sorghum bicolor L.)
Previous Article in Special Issue
The Confirmation of a Ploidy Periclinal Chimera of the Meiwa Kumquat (Fortunella crassifolia Swingle) Induced by Colchicine Treatment to Nucellar Embryos and Its Morphological Characteristics
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Communication

Recovery of 2R.2Sk Triticale-Aegilops kotschyi Robertsonian Chromosome Translocations

1
Department of Genomics, Institute of Plant Genetics of the Polish Academy of Sciences, Strzeszyńska 34; 60-479 Poznań, Poland
2
Department of Genetics and Plant Breeding, Poznań University of Life Sciences, Dojazd 11; 60-632 Poznań, Poland
3
Institute of Biological, Environmental and Rural Sciences, Aberystwyth University, Aberystwyth, Ceredigion, Wales SY23 3DA, UK
*
Author to whom correspondence should be addressed.
Agronomy 2019, 9(10), 646; https://doi.org/10.3390/agronomy9100646
Submission received: 9 September 2019 / Revised: 14 October 2019 / Accepted: 15 October 2019 / Published: 17 October 2019
(This article belongs to the Special Issue Chromosome Manipulation for Plant Breeding Purposes)

Abstract

Robertsonian translocations (RobTs) in the progeny of triticale (×Triticosecale Wittmack) plants with monosomic substitution of Aegilops kotschyi chromosome 2Sk (2R) were investigated by fluorescence in-situ hybridization. Chromosome 2Sk of Ae. kotschyi is reported to possess many valuable loci, such as Lr54 + Yr37 leaf and stripe (yellow) rust resistance genes. We used a standard procedure to produce RobTs, which consisted of self-pollination of monosomic triticale plants, carrying 2R and 2Sk chromosomes in monosomic condition. This approach did not result in RobTs. Simultaneously, we succeeded in producing 11 plants carrying 2R.2Sk compensatory RobTs using an alternative approach that utilized ditelosomic lines of triticale carrying 2RS (short arm) and 2RL (long arm) telosomic chromosomes. Identification of molecular markers linked to Lr54 + Yr37 genes in the translocation plants confirmed that these resources can be exploited in current triticale breeding programmes.

1. Introduction

Hexaploid triticale (×Triticosecale Wittmack, 2n = 6x = 42, AABBRR) is one of the few artificial crops cultivated at a large scale. Triticale combines the quality traits of wheat (Triticum aestivum L.) and the adaptation abilities of rye (Secale cereale L). Over the last three decades the global harvested area of triticale has constantly increased (2,101,405 ha in 1996; 3,662,363 ha in 2006, and 4,157,018 ha in 2016) [1], and the range of uses has also grown. Forage production is the principal end use for this crop, but there are new niches proposed, such as: biofuel production [2,3], baking [4], brewing [5] and food production [6]. As a recent man-made crop, triticale suffers narrow genetic variability for breeders to select upon.
In triticale there has been a breakdown of resistance against leaf rust (caused by Puccinia triticiana Eriks.) and stripe (yellow) rust (caused by P. striiformis f. sp. tritici Westend.). As the harvested area of triticale has increased, new pathotypes of Puccinia have evolved, moving from wheat and rye into triticale [7]. Both pathogens can reduce the grain yield by 40% [8,9]. There is an urgent need to improve the genepool of triticale, and introduce genetic resistance to Puccinia infections. There are approximately eighty leaf rust resistance genes identified in Triticeae, and nearly the same amount of stripe rust resistance genes have also been identified. Some of these genes have already been transferred from wild relatives into the wheat genetic background [10]. Recently, several attempts were made to transfer rust resistance genes from Aegilops, Agropyron and Triticum species into triticale [11,12,13,14,15].
Aegilops species are closely related to wheat (and triticale, per se) and carry a number of valuable traits, which have been effectively incorporated into wheat by developing wheat–Aegilops hybrids and deriving addition, substitution and translocation lines [16]. Aegilops kotschyi Boiss. (2n = 4x = 28 chromosomes, U- and S-genomes) is a wild tetraploid goatgrass native to Northern Africa, the Mid-East, and Western Asia. Ae. kotschyi germplasm is exploited in wheat breeding [17] as a source of high grain protein, iron and zinc [18]. Moreover, Antonov and Marais [19] observed leaf rust resistance that was effective against the infection of Puccinia triticina in Ae. kotschyi. Marais et al. [20] identified the Lr54 and Yr37 leaf rust and stripe rust resistance genes, and developed aT2DS.2SkL wheat-Ae. kotschyi translocation line. The first Lr54 + Yr37 marker was developed by Heyns et al. [21]. Moreover, translocation gene sequences were cloned and specific SSR markers were developed [22].
Homoeologous recombination based engineering is the most common way for efficiently utilizing the wild relative gene pool for crop improvement [23]. The generation of translocation lines is the most promising pathway for the exploitation of alien germplasm in crop breeding [23]. In distant hybrids, unpaired chromosomes are present as univalents during meiosis. Monosomic chromosomes are prone to centric breaks at anaphase I of meiosis, which misdivide and the broken ends fuse during the interkinesis of meiosis II [24,25,26]. Fusion of the misdivided products may result in the formation of a Robertsonian translocation (RobT) [27].
Several steps are required to generate RobTs (Figure 1a), with self-pollination of double-monosomic plants being the most common method used in the induction of RobTs [26]. Wheat breeders can use a large collection of aneuploid stocks for the induction of wheat-wheat and wheat-alien RobTs. This can be performed in a directed manner by producing the appropriate wheat or alien monosomic lines [28,29,30,31]. In wheat breeding the most common RobTs are the T1BL.1RS and T1AL.1RS translocations [25]. Lukaszewski and Curtis developed 1RS.1DL chromosome translocation in triticale “Rhino” and transferred this to cv. “Presto” by backcrossing for several generations [32]. The 1RS.1DL translocation was later used for the induction of multi-breakpoint translocation lines [29,33,34]. A key issue for the centric breakage-fusion mechanism is the frequency at which the centric breakage events involving the univalent occurs. Friebe et al. [26] reported that this can range from 1% to 11%. Another issue is the resultant telocentric chromosomes have a tendency of rejoin as RobTs. It was reported that the frequency of wheat–alien RobTs recovered ranges from 4% to 20%, depending on the genetic background, the chromosomes involved, and environmental conditions used [26,30,31].
To increase the rate of RobT formation, it is therefore necessary to reduce the random factors connected with appearance of centric breaks. In this study, we postulated that the use of telosomic plants for cross-hybridization with plants carrying an alien-substitution will overcome the random process of centric break formation in the univalent (Figure 1b). This approach was used to transfer the Lr54 + Yr37 resistance genes into triticale cv. “Sekundo” through a T2RS.2SkL RobT. It was hypothesized that the presence of the 2R donor chromosomes in a telosomic condition would increase the frequency of RobTs recovery (Figure 1b). To test this we used a monosomic substitution triticale line carrying a single 2Sk chromosome, instead of a 2R triticale chromosome (40 + M2R + M2Sk), and crossed this with a triticale line carrying a single copy of 2RS (short arm of 2R chromosome) and 2RL (long arm of 2R chromosome) telosomic chromosomes (40T + D2RS + D2RL). As a control experiment, the classical approach, based on the self-pollination of double monosomic triticale-Ae. kotschyi plants (40T + M2R + M2Sk), was also undertaken (Figure 1a). The goal was to compare the frequencies of chromosomal breaks and recovery of RobTs that arose throughout the two independent approaches tested (Figure 1a,b).

2. Materials and Methods

2.1. Plant Material

Winter triticale cv. “Sekundo” was obtained from the Danko Hodowla Roślin Sp. z o.o. (Choryń, Poland) plant breeding company. Accession Ak3 of Aegilops kotschyi was received by Prof. B. Wojciechowska (Institute of Plant Genetics of the Polish Academy of Sciences, Poznań, Poland; IPG PAS) from a collection of Professor M. Feldman (Weizmann Institute of Science, Rehovot, Israel) and assembled in the genebank of the IPG PAS. All plants were grown and crossed in the greenhouse of the IPG PAS. In the initial study, monosomic addition triticale line (MA2Sk; 2n = 43) that carried chromosome 2Sk derived from triticale-Aegilops kotschyi hybrids was used. These plants were crossed with triticale nullisomic plants for chromosomes 2R (N2R, 2n = 40); obtained by Kwiatek et al. [35]. Double monosomic (M2R and M2Sk) F1 plants (2n = 42) were identified using GISH, according to Kwiatek et al. [35]. Ditelosomic (Dt2RS and Dt2RL) plants of triticale were generated by Kwiatek et al. [35] by harnessing chromosome fragmentation induced by gametocidal action, in combination with the production of double haploids. Spikes emasculated between April and June of 2018 were used for cross-pollination. The anthers of donor plants were collected, and pollen was transferred onto stigmas by chafing.

2.2. Chromosome Preparation

Accumulation of cells at mitotic metaphase and fixation was carried out according to Kwiatek et al. [35]. The root meristemes were digested at 37 °C for 2 h and 40 min in an enzymes solution containing 0.2% (v/v) Cellulase Onozuka R-10 and Calbiochem cytohelicase (1:1 ratio) and 20% pectinase (Sigma), in 10 mM citrate buffer (pH 4.6). Chromosome preparations were made according Heckmann et al. [36]. Digested root tips were placed on slides with a drop of ice-cold 60% acetic acid. The mixture was spread on a slide using metal needle for 2 min on a heating table (Medax) set at 48 °C. The slides were washed with 200 μL of ice-cold ethanol-acetic acid (3:1, v/v) and placed in 60% acetic acid for 10 min, washed in 96% ethanol, and air dried.
Meiotic chromosome spreads from pollen mother cells were prepared from flower buds fixed with ethanol-acetic acid (3:1, v/v) according to Zwierzykowski et al. [37]. Anthers were transferred to a slide with a drop of ice-cold 60% acetic acid and dispersed with a metal needle. The slide was placed on a hot plate (45 °C) for 2 min, during which the drop was spread using a needle. The slide was removed from the hot plate, a drop of 60% acetic acid added and covered with a cover slip. The slide was frozen in liquid nitrogen, and cover slip was removed with a razor blade.

2.3. Probe Preparation and Fluorescence in Situ Hybridization

Total genomic DNA was isolated using GeneMATRIX Plant & Fungi DNA Purification Kit (EURx, Gdansk, Poland). DNA of Aegilops sharonensis Eig. (a progenitor of the S-genome of Ae. kotschyi; PI 551020, U.S. National Plant Germplasm System, Aberdeen, ID, United States of America) was labeled by nick translation with Atto-488 dye (Atto-488NT kit; Jena Bioscience, Jena, Germany) to investigate Aegilops chromosomes behavior during meiosis in the hybrid. Blocking DNA from triticale (Sekundo, Lamberto and Bogo) was sheared by boiling for 30-45 min and used at a ratio of 1:50 (probe:block). Genomic in-situ hybridization (GISH) or multicolor GISH was carried out according to previously published protocols [35]. Mitotic chromosomes were identified using fluorescence in situ hybridization (FISH) with the repetitive sequences from pTa-86, pTa-535, pTa-465, pTa-k-566 and pTa713 clones characterized by Komuro et al. [38]. They were amplified from genomic DNA of wheat (Chinese Spring) according to Kwiatek et al. [39], and labelled with Atto-488, Atto-550, and Atto-647 dyes using a nick translation kit (Jena Bioscience). FISH was performed according to Kwiatek et al. [35]. Slides were examined with the Olympus BX 61 automatic epifluorescence microscope equipped with Olympus XM10 CCD camera. Image processing was carried out using Olympus Cell-F (version 3.1; Olympus Soft Imaging Solutions GmbH: Münster, Düsseldorf, Germany) imaging software and PaintShop Pro X5 software (version 15.0.0.183; Corel Corporation, Ottawa, ON, Canada). Chromosomes of Aegilops and triticale were identified by comparing the signal patterns of the probes [39].

2.4. Lr54 + Lr37 SSR Marker Screening

Genomic DNA of parental forms and offspring plants were isolated using Plant DNA Purification Kit (EurX Ltd., Gdańsk, Poland). All primers (Table 1) were manufactured by Sigma-Aldrich (Merck).
PCR reactions were performed in a LabCycler thermal cycler (SensoQuest Biomedizinische Elektronik, Goettingen, Germany). The 20 μL PCR reaction consisted of 150 nM each primer, 0.2 mM of each nucleotide, 1.5 mM MgCl2, 0.2 units of Taq-DNA hot-start polymerase (TaqNovaHS, Blirt, Poland), and 50 ng of genomic DNA as a template. A typical PCR procedure was as follows: 5 min at 95 °C, then 35 cycles of 30 s at 94 °C, 30 s at 50–60 °C (depending on the primer, Table 1), 1 min at 72 °C, and 5 min at 72 °C. 0.5μL Midori Green Direct (Nippon Genetics Europe) was added to each amplification product, ran on 2% agarose gel (Sigma), and then visualized and photographed (EZ GelDoc System, BioRad).

3. Results

3.1. Chromosome Segregation in 40 + M2R + M2Sk Plants of Triticale

In the control experiment, pollen mother cells (PMCs) of ten triticale plants carrying 40 + M2R + M2Sk chromosomes were examined to identify metaphase I (MI) and anaphase I (AI) of meiosis (Figure 2a). We observed a 2Sk univalent in all of 100 analyzed PMCs (Figure 2b). The number of misdivided 2Sk chromosomes during AI was 9 (Figure 2c). No other misdivided chromosome of triticale was observed. Next, 48 spikes of the monosomic substitution plants (40 + M2R + M2Sk) were allowed to self-pollinate, and 2601 seeds were obtained. A subset of 289 plants were screened using GISH and none were found with the expected RobT. 185 (63.1%) of the derived plants carried a whole Aegilops chromosome. In the remaining offspring (104 plants; 36.9%), no Ae. kotschyi chromosome fragments were identified.

3.2. Chromosome Segregation in 40 + M2RS + M2RL + M2Sk Plants of Triticale

The main goal of the experiment was to obtain triticale plants with introgression of a 2Sk chromosome segment on the 2R chromosome. Hence, we crossed monosomic substitution (40 + M2R + M2Sk) plants with double ditelosomic D2RSD2RL plants of triticale to obtain triple monosomic triticale plants (40 + M2RS + M2RL + M2Sk). These plants contained a single telosomic 2RS, a single telosomic 2RL and a single monosomic 2Sk chromosome (Figure 1b). 13,457 flowers of the ditelosomic line were pollinated with pollen collected from monosomic substitution M2Sk (M2R) plants, and 3464 seeds were obtained (25.74% crossing efficiency). The chromosomal constitution of 100 randomly chosen plants were examined by a combination of genomic and fluorescence in situ hybridization methods (GISH/FISH), using total genomic DNA of rye and Aegilops species, and pTa-103 centromere sequence, as probes. 38 plants were found to be triple monosomic (40 + M2RS + M2RL + M2Sk) (Figure 3), 35 lacked the 2R chromosomes (40 + N2R + M2Sk), 15 plants were ditelosomic (40 + M2RS + M2RL) and 12 plants were double telosomic (40 + D2RL).
The triple monosomics were selected from further analysis (38 plants; 40 + M2RS + M2RL + M2Sk), and MI and AI were observed in 10 PMCs of each plant. Chromosome 2Sk was present as a univalent in all PMCs examined. In most cases (35 plants; 92.11%), the Aegilops univalent underwent chromosome segregation and was moved randomly to one of the opposite poles of the cell (Figure 4a).
We also observed the misdivision of the 2Sk chromosome arms in three plants (7.89%) (Figure 4b). Next, a total number of 68 spikes of 38 offspring plants (40 + M2RS + M2RL + M2Sk) were self-pollinated, and 3489 seeds were obtained. The chromosome constitutions of 100 randomly chosen plants were examined by FISH/GISH, using repetitive sequences as probes (pTa-86; pTa-535 and total genomic DNA from rye). The results of chromosome 2Sk misdivision were observed in 13 plants, including: a double RobT-T2RS.2SkL and T2SkS.2RL (1 plant; Figure 5a, b and c); six plants carrying T2RS.2SkL, four plants with T2SkS.2RL, and two telosomic plants with the 2RS, 2RL and 2SkS chromosome arms (Table 2).

3.3. Lr54 + Yr37 SSR Markers Analysis

Initial analysis of molecular markers S14-297 and S14-410, linked to Lr54 + Yr37 loci [21,22], was conducted on the parental lines; namely the monosomic substitution M2Sk (M2R) line and double ditelosomic D2RSD2RL triticale line. The same protocol was used to examine the subsequent offspring. An amplicon of 297bp (base pairs) was for obtained for the S14-297 marker, and 410bp for the S14-410 marker, as observed in control samples of Ae. kotschyi and double 40 + M2R + M2Sk monosomic plants (Figure 6). The same 410bp product was amplified form the 6 plants with T2RS.2SkL RobTs and for 1 plant carrying double RobTs-T2RS.2SkL and T2SkS.2RL (Figure 6; Table 2).

4. Discussion

Many reports have shown that RobTs in wheat can arise by centromeric misdivision of univalents at AI, followed by segregation of the derived telocentric chromosomes to the same nucleus, and fusion of the broken parts [26,30,31]. The focus of this study was to exploit the formation of RobTs to transfer of the Lr54 + Yr37 gene loci from Ae. kotschyi into triticale. We have focused on two essential aspects of this process: the frequency of univalent misdivision, and the frequency at which the broken chromosomes fuse to form a RobT. The control experiment used the standard approach of self-pollinating monosomic substitution (40 + M2R + M2Sk) of triticale. Genomic in-situ hybridization identified that chromosome 2Sk was present in all meiotic cells assayed, and the centromere was divided during AI in 9% of the PMCs surveyed. The same event was observed in PMCs isolated from the 40 + M2RS + M2RL + M2Sk plants. The frequency of PMCs where the centromere of the 2Sk univalent divided was 7.89%. Our results are comparable with other reports, showing that the frequency of univalent misdivision range between 3% up to 51% [26,30,31]. When both approaches were compared (40 + M2R + M2Sk vs 40 + M2RS + M2RL + M2Sk), no significant difference in the frequency at which the Aegilops univalent misdivided was observed. However, the 2R univalent did not misdivide in the control experiment, and the use of the double ditelosomic D2RS + D2RL in the alternative approach was justified.
It can be assumed that the probability of RobTs formation is dependent on the rate of centromere breakage, and subsequent formation of telocentric chromosomes, occurs during meiosis. In wheat, the frequency of recovery of wheat–alien RobTs is between 2% and 20%, depending on the chromosomes involved [23,26,30,31,40,41,42,43,44]. In our experiment, the progeny of monosomic substitution plants lacked any kind of triticale-Aegilops translocation. This could correlate with the lack of the 2R chromosome misdivision observed in these plants. Similar issues were reported by Ghazali et al. [45], who aimed to produce whole arm RobTs involving chromosomes 2B (wheat) and 2Eb (Thinopyrum bessarabicum). Surprisingly, the authors obtained only T2EbS.2BL, while no 2BS.2EbL RobTs were recovered [45]. It has been reported that rye chromosomes rearrange at a higher rate when compared to wheat chromosomes [46], with the long arm of chromosome 2R more readily fused with the chromosome arm of an alien species. For example, Fiebe et al. [47] derived 2BL.2RL RobTs carrying Hessian fly resistance gene H21 in wheat cv. Hamlet. Rahmatov et al. [48] also obtained 2DS.2RL RobT, which transfered the stem rust resistance gene Sr59 into wheat.
In our study, we have effectively used ditelosomic lines of triticale to increase the frequency of 2Sk.2R RobTs generated. Moreover, we have obtained both 2SkS.2RL and 2RS.2SkL RobTs. The ability to produce both types of RobTs was an important goal as the particular chromosome segments of Aegilops may harbor other desirable genes. To summarize, we obtained plants with chromosome translocations, which probably carry the Lr54 + Lr37 leaf and stem rust resistance genes. The next step of this project will be to phenotype the eleven RobTs lines for leaf rust or stripe rust resistance. If these tests succeed, such germplasm could be a valuable source for triticale resistance breeding.

Author Contributions

Conceptualization, M.T.K.; methodology, M.T.K.; validation, W.U.; formal analysis, W.U.; investigation, W.U., J.B., J.S. and R.S.; resources, M.T.K., H.W.; data curation, M.T.K., W.U.; writing—original draft preparation, W.U., M.T.K.; writing—review and editing, W.U., D.P. and M.T.K.; visualization, W.U., M.T.K.; supervision, M.T.K., D.P. and H.W.; project administration, M.T.K.; funding acquisition, M.T.K.

Funding

This research and the APC were funded by NATIONAL CENTRE FOR RESEARCH AND DEVELOPMENT, Poland (Narodowe Centrum Badań i Rozwoju, Polska), grant number LIDER/3/0004/L-8/16/NCBR/2017.

Acknowledgments

We would like to acknowledge the administrative support provided by the Institute of Plan Genetics of the Polish Academy of Sciences.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Food and Agriculture Organization of the United Nations. FAOSTAT Statistics Database 1998. Available online: http://www.fao.org/faostat (accessed on 28 June 2019).
  2. McGoverin, C.M.; Snyders, F.; Muller, N.; Botes, W.; Fox, G.; Manley, M. A review of triticale uses and the effect of growth environment on grain quality. J. Sci. Food Agric. 2011, 91, 1155–1165. [Google Scholar] [CrossRef] [Scilit]
  3. Meale, S.J.; McAllister, T.A. Grain for Feed and Energy. In Triticale; Eudes, F., Ed.; Springer International Publishing: Cham, Switzerland, 2015; pp. 167–187. [Google Scholar]
  4. Pattison, A.L.; Trethowan, R.M. Characteristics of modern triticale quality: Commercially significant flour traits and cookie quality. Crop Pasture Sci. 2013, 64, 874–880. [Google Scholar] [CrossRef] [Scilit]
  5. Rakha, A.; Åman, P.; Andersson, R. Dietary fiber in triticale grain: Variation in content, composition, and molecular weight distribution of extractable components. J. Cereal Sci. 2011, 54, 324–331. [Google Scholar] [CrossRef] [Scilit]
  6. Woś, H.; Brzeziński, W. Triticale for Food—The Quality Driver. In Triticale; Eudes, F., Ed.; Springer International Publishing: Cham, Switzerland, 2015; pp. 213–232. [Google Scholar]
  7. Arseniuk, E. Triticale Diseases—A Review. In Triticale: Today and Tomorrow; Guedes-Pinto, H., Darvey, N., Carnide, V.P., Eds.; Springer: Dordrecht, The Netherlands, 1996; pp. 499–525. [Google Scholar]
  8. Arseniuk, E.; Góral, T. Triticale Biotic Stresses—Known and Novel Foes. In Triticale; Eudes, F., Ed.; Springer International Publishing: Cham, Switzerland, 2015; pp. 83–108. [Google Scholar]
  9. Tian, S.; Weinert, J.; Wolf, G.A. Infection of triticale cultivars by Puccinia striiformis: First report on disease severity and yield loss/Blatt-und Äenbefall sowie Ertragsverluste durch Puccinia striiformis in Triticale-Sorten. Z. Für Pflanzenkrankh. Und Pflanzenschutz/J. Plant Dis. Prot. 2004, 111, 461–464. [Google Scholar]
  10. McIntosh, R.; Yamazaki, Y.; Devos, K.M.; Dubcovsky, J.; Rogers, W.J.; Appels, R. Catalogue of Gene Symbols for Wheat; Akadémiai Kiadó: Budapest, Hungary, 2003; Volume 49. [Google Scholar]
  11. Adonina, I.G.; Orlovskaya, O.A.; Tereshchenko, O.Y.; Koren, L.V.; Khotyleva, L.V.; Shumny, V.K.; Salina, E.A. Development of commercially valuable traits in hexaploid triticale lines with Aegilops introgressions as dependent on the genome composition. Russ. J. Genet. 2011, 47, 453–461. [Google Scholar] [CrossRef] [Scilit]
  12. Kwiatek, M.; Belter, J.; Majka, M.; Wiśniewska, H. Allocation of the S-genome chromosomes of Aegilops variabilis Eig. carrying powdery mildew resistance in triticale (×Triticosecale Wittmack). Protoplasma 2016, 253, 329–343. [Google Scholar] [CrossRef] [Scilit]
  13. Kwiatek, M.; Majka, M.; Wiśniewska, H.; Apolinarska, B.; Belter, J. Effective transfer of chromosomes carrying leaf rust resistance genes from Aegilops tauschii Coss. into hexaploid triticale (X Triticosecale Witt.) using Ae. tauschii × Secale cereale amphiploid forms. J. Appl. Genet. 2015, 56, 163–168. [Google Scholar] [CrossRef] [Scilit]
  14. Salmanowicz, B.P.; Langner, M.; Wiśniewska, H.; Apolinarska, B.; Kwiatek, M.; Błaszczyk, L. Molecular, physicochemical and rheological characteristics of introgressive Triticale/Triticum monococcum ssp. monococcum lines with wheat 1D/1A chromosome substitution. Int. J. Mol. Sci. 2013, 14, 15595–15614. [Google Scholar]
  15. Kang, H.; Wang, H.; Huang, J.; Wang, Y.; Li, D.; Diao, C.; Zhu, W.; Tang, Y.; Wang, Y.; Fan, X.; et al. Divergent Development of Hexaploid Triticale by a Wheat–Rye–Psathyrostachys huashanica Trigeneric Hybrid Method. PLoS ONE 2016, 11, e0155667. [Google Scholar] [CrossRef] [Scilit]
  16. Schneider, A.; Molnár, I.; Molnár-Láng, M. Utilisation of Aegilops (goatgrass) species to widen the genetic diversity of cultivated wheat. Euphytica 2008, 163, 1–19. [Google Scholar] [CrossRef] [Scilit]
  17. Prażak, R.; Paczos-Grzęda, E. Gene transfer from Aegilops kotschyi Boiss. to Triticum aestivum L. Adv. Agric. Sci. Probl. 2010, 555, 613–620. [Google Scholar]
  18. Rawat, N.; Neelam, K.; Tiwari, V.K.; Randhawa, G.S.; Friebe, B.; Gill, B.S.; Dhaliwal, H.S. Development and molecular characterization of wheat-Aegilops kotschyi addition and substitution lines with high grain protein, iron, and zinc. Genome 2011, 54, 943–953. [Google Scholar] [CrossRef] [Scilit]
  19. Antonov, A.I.; Marais, G.F. Identification of leaf rust resistance genes in Triticum species for transfer to common wheat. S. Afr. J. Plant Soil 1996, 13, 55–60. [Google Scholar] [CrossRef] [Scilit]
  20. Marais, G.F.; McCallum, B.; Snyman, J.E.; Pretorius, Z.A.; Marais, A.S. Leaf rust and stripe rust resistance genes Lr54 and Yr37 transferred to wheat from Aegilops kotschyi. Plant Breed. 2005, 124, 538–541. [Google Scholar] [CrossRef] [Scilit]
  21. Heyns, I.; Pretorius, Z.A.; Marais, F. Derivation and Characterization of Recombinants of the Lr54/Yr37 Translocation in Common Wheat. Open Plant Sci. J. 2011, 5, 1–8. [Google Scholar] [CrossRef] [Scilit]
  22. Smit, C. Pyramiding of Novel Rust Resistance Genes in Wheat, Utilizing Marker Assisted Selection and Doubled Haploid Technology. Master’s Thesis, Stellenbosch University, Stellenbosch, South Africa, 2013. RSA. [Google Scholar]
  23. Qi, L.; Friebe, B.; Zhang, P.; Gill, B.S. Homoeologous recombination, chromosome engineering and crop improvement. Chromosome Res. 2007, 15, 3–19. [Google Scholar] [CrossRef] [Scilit]
  24. Sears, E. Misdivision of univalents in common wheat. Chromosoma 1950, 4, 535–550. [Google Scholar] [CrossRef] [Scilit]
  25. Sánchez-Monge, E. Two Types of Misdivision of the Centromere. Nature 1950, 165, 80–81. [Google Scholar] [CrossRef] [Scilit]
  26. Friebe, B.; Zhang, P.; Linc, G.; Gill, B.S. Robertsonian translocations in wheat arise by centric misdivision of univalents at anaphase I and rejoining of broken centromeres during interkinesis of meiosis II. Cytogenet. Genome Res. 2005, 109, 293–297. [Google Scholar] [CrossRef] [Scilit]
  27. Robertson, W.R.B. Chromosome studies. I. Taxonomic relationships shown in the chromosomes of tettigidae and acrididae: V-shaped chromosomes and their significance in acrididae, locustidae, and gryllidae: Chromosomes and variation. J. Morph. 1916, 27, 179–331. [Google Scholar] [CrossRef] [Scilit]
  28. Lukaszewski, A.J.; Gustafson, J.P. Translocations andmodifications of chromosomes in triticale × wheat hybrids. Theor. Appl. Genet. 1983, 64, 239–248. [Google Scholar] [CrossRef] [Scilit]
  29. Lukaszewski, A.J. Further manipulation by centric misdivision of the 1RS.1BL translocation in wheat. Euphytica 1997, 94, 257–261. [Google Scholar] [CrossRef] [Scilit]
  30. Qi, L.L.; Pumphrey, M.O.; Friebe, B.; Zhang, P.; Qian, C.; Bowden, R.L.; Rouse, M.N.; Jin, Y.; Gill, B.S. A novel Robertsonian translocation event leads to transfer of a stem rust resistance gene (Sr52) effective against race Ug99 from Dasypyrum villosum into bread wheat. Theor. Appl. Genet. 2011, 123, 159–167. [Google Scholar] [CrossRef] [Scilit]
  31. Türkösi, E.; Darko, E.; Rakszegi, M.; Molnár, I.; Molnár-Láng, M.; Cseh, A. Development of a new 7BS.7HL winter wheat-winter barley Robertsonian translocation line conferring increased salt tolerance and (1,3;1,4)-β-D-glucan content. PLoS ONE 2018, 13, e0206248. [Google Scholar]
  32. Lukaszewski, A.J.; Curtis, C.A. Transfer of the Glu-D1 gene fromchromosome 1D of bread wheat to chromosome 1R in hexaploidtriticale. Plant Breed. 1992, 109, 203–210. [Google Scholar] [CrossRef] [Scilit]
  33. Lukaszewski, A.J. Manipulation of the 1RS.1BL translocation in wheat by induced homoeologous recombination. Crop Sci. 2000, 40, 216–225. [Google Scholar] [CrossRef] [Scilit]
  34. Lukaszewski, A.J. Cytogenetically engineered rye chromosomes 1R to improve bread-making quality of hexaploid triticale. Crop Sci. 2006, 46, 2183–2194. [Google Scholar] [CrossRef] [Scilit]
  35. Kwiatek, M.T.; Wiśniewska, H.; Ślusarkiewicz-Jarzina, A.; Majka, J.; Majka, M.; Belter, J.; Pudelska, H. Gametocidal Factor Transferred from Aegilops geniculata Roth Can Be Adapted for Large-Scale Chromosome Manipulations in Cereals. Front. Plant Sci. 2017, 8, 409. [Google Scholar] [CrossRef] [Scilit]
  36. Heckmann, S.; Jankowska, M.; Schubert, V.; Kumke, K.; Ma, W.; Houben, A. Alternative meiotic chromatid segregation in the holocentric plant Luzula elegans. Nat. Commun. 2014, 5, 4979. [Google Scholar] [CrossRef] [Scilit]
  37. Zwierzykowski, Z.; Zwierzykowska, E.; Taciak, M.; Jones, N.; Kosmala, A.; Krajewski, P. Chromosome pairing in allotetraploid hybrids of Festuca pratensis x Lolium perenne revealed by genomic in situ hybridization (GISH). Chromosome Res. 2008, 16, 575–585. [Google Scholar] [CrossRef] [Scilit]
  38. Komuro, S.; Endo, R.; Shikata, K.; Kato, A. Genomic and chromosomal distribution patterns of various repeated DNA sequences in wheat revealed by a fluorescence in situ hybridization procedure. Genome 2013, 56, 131–137. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  39. Kwiatek, M.T.; Kurasiak-Popowska, D.; Mikołajczyk, S.; Niemann, J.; Tomkowiak, A.; Weigt, D.; Nawracała, J. Cytological markers used for identification and transfer of Aegilops spp. chromatin carrying valuable genes into cultivated forms of Triticum. Comp. Cytogenet. 2019, 13, 41–59. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  40. Ardalani, S.; Mirzaghaderi, G.; Badakhshan, H. A Robertsonian translocation from Thinopyrum bessarabicum into bread wheat confers high iron and zinc contents. Plant Breed. 2016, 135, 286–290. [Google Scholar] [CrossRef] [Scilit]
  41. Tanaka, H.; Nabeuchi, C.; Kurogaki, M.; Garg, M.; Saito, M.; Ishikawa, G.; Nakamura, T.; Tsujimoto, H. A novel compensating wheat–Thinopyrum elongatum Robertsonian translocation line with a positive effect on flour quality. Breed. Sci. 2017, 67, 509–517. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  42. Danilova, T.V.; Friebe, B.; Gill, B.S.; Poland, J.; Jackson, E. Development of a complete set of wheat–barley group-7 Robertsonian translocation chromosomes conferring an increased content of β-glucan. Theor. Appl. Genet. 2018, 131, 377–388. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  43. Vega, J.M.; Feldman, M. Effect of the pairing gene Ph1 on centromere misdivision in common wheat. Genetics 1998, 148, 1285–1294. [Google Scholar] [PubMed]
  44. Steinitz-Sears, L.M. Somatic Instability of Telocentric Chromosomes in Wheat and the Nature of the Centromere. Genetics 1966, 54, 241–248. [Google Scholar]
  45. Ghazali, S.; Mirzaghaderi, G.; Majdi, M. Production of a novel Robertsonian translocation from Thinopyrum bessarabicum into bread wheat. Cytol. Genet. 2015, 49, 378–381. [Google Scholar] [CrossRef] [Scilit]
  46. Devos, K.M.; Atkinson, M.D.; Chinoy, C.N.; Francis, H.A.; Harcourt, R.L.; Koebner, R.M.D.; Liu, C.J.; Masojć, P.; Xie, D.X.; Gale, M.D. Chromosomal rearrangements in the rye genome relative to that of wheat. Theor. Appl. Genet. 1993, 85, 673–680. [Google Scholar] [CrossRef] [Scilit]
  47. Friebe, B.; Hatchett, J.H.; Sears, R.G.; Gill, B.S. Transfer of Hessian fly resistance from ‘Chaupon’ rye to hexaploid wheat via a 2BS/2RL wheat-rye chromosome translocation. Theor. Appl. Genet. 1990, 79, 385–389. [Google Scholar] [CrossRef] [Scilit]
  48. Rahmatov, M.; Rouse, M.N.; Nirmala, J.; Danilova, T.; Friebe, B.; Steffenson, B.J.; Johansson, E. A new 2DS•2RL Robertsonian translocation transfers stem rust resistance gene Sr59 into wheat. Theor. Appl. Genet. 2016, 129, 1383–1392. [Google Scholar] [CrossRef] [Scilit] [PubMed]
Figure 1. Ideogram of the two contrasting approaches for the recovery of Robertsonian translocations.
Figure 1. Ideogram of the two contrasting approaches for the recovery of Robertsonian translocations.
Agronomy 09 00646 g001
Figure 2. (a) Chromosome set of a 40 + M2R + M2Sk triticale plant (b) Segregation of chromosome 2Sk (green, Atto-488) at anaphase I in a 40 + M2R + M2Sk triticale plant. (c) Centric misdivision of chromosome 2Sk (yellow, Atto-647) at anaphase I in a 40 + M2R + M2Sk triticale plant. Scale bar, 10 μm.
Figure 2. (a) Chromosome set of a 40 + M2R + M2Sk triticale plant (b) Segregation of chromosome 2Sk (green, Atto-488) at anaphase I in a 40 + M2R + M2Sk triticale plant. (c) Centric misdivision of chromosome 2Sk (yellow, Atto-647) at anaphase I in a 40 + M2R + M2Sk triticale plant. Scale bar, 10 μm.
Agronomy 09 00646 g002
Figure 3. Karyotype of triticale plant carrying 40 + M2RS + M2RL + M2Sk chromosomes, examined by genomic/fluorescence in situ hybridization (GISH/FISH). Total genomic DNA of rye (red) and Ae. tauschii (yellow), and pTa103 centromere sequence (green) were used as probes. Scale bar, 10 μm.
Figure 3. Karyotype of triticale plant carrying 40 + M2RS + M2RL + M2Sk chromosomes, examined by genomic/fluorescence in situ hybridization (GISH/FISH). Total genomic DNA of rye (red) and Ae. tauschii (yellow), and pTa103 centromere sequence (green) were used as probes. Scale bar, 10 μm.
Agronomy 09 00646 g003
Figure 4. (a) Chromosome segregation of 2Sk (green, Atto-488) at anaphase I of triticale line 40 + M2RS + M2RL + M2Sk. (b) Centric misdivision of chromosome 2Sk (green, Atto-488) at anaphase I of triticale line 40 + M2RS + M2RL + M2Sk. Scale bar, 10 μm.
Figure 4. (a) Chromosome segregation of 2Sk (green, Atto-488) at anaphase I of triticale line 40 + M2RS + M2RL + M2Sk. (b) Centric misdivision of chromosome 2Sk (green, Atto-488) at anaphase I of triticale line 40 + M2RS + M2RL + M2Sk. Scale bar, 10 μm.
Agronomy 09 00646 g004
Figure 5. (a) T2Sk.2R Robertsonian translocations in triticale analysed by fluorescence in situ hybridization (R-genome chromatin—purple, Sk-genome chromatin—blue, pTa-713—green, pTa-465—yellow, pTa-k566—red). Genomic in-situ hybridization pattern of triticale plant carrying Robertsonian traslocations with segments of 2Sk chromosome (green) at prophase (b) and metaphase (c) of root meristem cell. Scale bar, 10 μm.
Figure 5. (a) T2Sk.2R Robertsonian translocations in triticale analysed by fluorescence in situ hybridization (R-genome chromatin—purple, Sk-genome chromatin—blue, pTa-713—green, pTa-465—yellow, pTa-k566—red). Genomic in-situ hybridization pattern of triticale plant carrying Robertsonian traslocations with segments of 2Sk chromosome (green) at prophase (b) and metaphase (c) of root meristem cell. Scale bar, 10 μm.
Agronomy 09 00646 g005
Figure 6. Amplification products of S14-410 marker linked to loci of Lr54 + Lr37 leaf and stem rust resistance genes. (1) Aegilops kotschyi (UUSkSk); (2) triticale ‘Sekundo’(AABBRR); (3) double 40T + M2R + M2Sk monosomic; (4) T2RS.2SkL and T2SkS.2RL; (5) double ditelosomic D2RS + D2RL; (6) telosomic M2RS + M2RL + M2SkS; (7) T2SkS.2RL; (8) T2RS.2SkL.
Figure 6. Amplification products of S14-410 marker linked to loci of Lr54 + Lr37 leaf and stem rust resistance genes. (1) Aegilops kotschyi (UUSkSk); (2) triticale ‘Sekundo’(AABBRR); (3) double 40T + M2R + M2Sk monosomic; (4) T2RS.2SkL and T2SkS.2RL; (5) double ditelosomic D2RS + D2RL; (6) telosomic M2RS + M2RL + M2SkS; (7) T2SkS.2RL; (8) T2RS.2SkL.
Agronomy 09 00646 g006
Table 1. Primer sequences and PCR conditions used for Lr54 + Lr37 marker identification on 2Sk chromosome.
Table 1. Primer sequences and PCR conditions used for Lr54 + Lr37 marker identification on 2Sk chromosome.
MarkerPrimer Sequence (5′ to 3′)Amplification Temperature (°C)Amplicon Size (bp)Reference
S14-297CATGCAGAAAACGACACACC60297[21]
GGTAAGTGGTCAGGCGTTGT
S14-410ACCAATTCAACTTGCCAAGAG61410[22]
GAGTAACATGCAGAAAACGACA
Table 2. Chromosome constitutions and Lr54 + Yr37 SSR marker analysis of triticale plants carrying divided 2Sk chromosome.
Table 2. Chromosome constitutions and Lr54 + Yr37 SSR marker analysis of triticale plants carrying divided 2Sk chromosome.
Plant No.Chromosome ConstitutionChromosome NumberAmplicon Size for S14-410 Marker (bp)Amplicon Size for S14-297 Marker (bp)
140 + M2RS + M2RL + M2SkS43nullnull
240 + T2RS.2SkL + M2RL42410297
340 + T2SkS.2RL41nullnull
440 + T2RS.2SkL41410297
540 + T2RS.2SkL + M2RL42410297
640 + T2RS.2SkL + t2SkS.2RL42410297
740 + T2SkS.2RL41nullnull
840 + T2RS.2SkL41410297
940 + M2RS + M2RL + M2SkS43nullnull
1040 + T2RS.2SkL41410297
1140 + T2SkS.2RL + M2RS42nullnull
1240 + T2RS.2SkL + M2RL42410297
1340 + T2SkS.2RL41nullnull

Share and Cite

MDPI and ACS Style

Ulaszewski, W.; Belter, J.; Wiśniewska, H.; Szymczak, J.; Skowrońska, R.; Phillips, D.; Kwiatek, M.T. Recovery of 2R.2Sk Triticale-Aegilops kotschyi Robertsonian Chromosome Translocations. Agronomy 2019, 9, 646. https://doi.org/10.3390/agronomy9100646

AMA Style

Ulaszewski W, Belter J, Wiśniewska H, Szymczak J, Skowrońska R, Phillips D, Kwiatek MT. Recovery of 2R.2Sk Triticale-Aegilops kotschyi Robertsonian Chromosome Translocations. Agronomy. 2019; 9(10):646. https://doi.org/10.3390/agronomy9100646

Chicago/Turabian Style

Ulaszewski, Waldemar, Jolanta Belter, Halina Wiśniewska, Joanna Szymczak, Roksana Skowrońska, Dylan Phillips, and Michał T. Kwiatek. 2019. "Recovery of 2R.2Sk Triticale-Aegilops kotschyi Robertsonian Chromosome Translocations" Agronomy 9, no. 10: 646. https://doi.org/10.3390/agronomy9100646

APA Style

Ulaszewski, W., Belter, J., Wiśniewska, H., Szymczak, J., Skowrońska, R., Phillips, D., & Kwiatek, M. T. (2019). Recovery of 2R.2Sk Triticale-Aegilops kotschyi Robertsonian Chromosome Translocations. Agronomy, 9(10), 646. https://doi.org/10.3390/agronomy9100646

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop