Debaryomyces hansenii Enhances Growth, Nutrient Uptake, and Yield in Rice Plants (Oryza sativa L.) Cultivated in Calcareous Soil

Abstract

Calcareous soils, characterized by high pH and calcium carbonate content, often limit the availability of essential nutrients for crops such as rice (Oryza sativa L.), reducing yield and nutritional quality. In this study, we evaluated the effect of the halotolerant yeast Debaryomyces hansenii on the growth, nutrient uptake, and phosphorus acquisition mechanisms of rice plants cultivated in calcareous soil under controlled greenhouse conditions. Plants inoculated with D. hansenii, particularly via root immersion, exhibited significantly higher SPAD chlorophyll index, plant height, and grain yield compared to controls. A modest increase (~4%) in dry matter content was also observed under sterilized soil conditions. Foliar concentrations of Fe, Zn, and Mn significantly increased in plants inoculated with D. hansenii via root immersion in non-sterilized calcareous soil, indicating improved micronutrient acquisition under these specific conditions. Although leaf phosphorus levels were not significantly increased, D. hansenii stimulated acid phosphatase activity, as visually observed through BCIP staining, and upregulated genes involved in phosphorus acquisition under both P-sufficient and P-deficient conditions. At the molecular level, D. hansenii upregulated the expression of acid phosphatase genes (OsPAP3, OsPAP9) and a phosphate transporter gene (OsPTH1;6), confirming its influence on P-related physiological responses. These findings demonstrate that D. hansenii functions as a plant growth-promoting yeast (PGPY) and may serve as a promising biofertilizer for improving rice productivity and nutrient efficiency in calcareous soils, contributing to sustainable agricultural practices in calcareous soils and other nutrient-limiting environments.

1. Introduction

Iron (Fe) and phosphorus (P) deficiencies are among the most critical agronomic challenges for global crop production, especially in calcareous soils. These soils, which occupy approximately 30% of the world’s agricultural land, are particularly prevalent in countries like Spain, where large areas in regions such as Aragón, Castilla-La Mancha, Andalucía, and the Basque Country are affected [1]. Characterized by a high calcium carbonate (CaCO₃) content and alkaline pH levels above 7.5, calcareous soils limit the bioavailability of essential macro- and micronutrients, including Fe, P, Zn, and Cu [2,3,4,5,6,7].

In these soils, nutrients such as Fe and P exist in forms that are largely inaccessible to plants. Phosphorus tends to precipitate with Ca²⁺ or Mg²⁺ into insoluble forms or become adsorbed onto soil particles and iron oxides, drastically reducing its mobility and availability to roots [8,9]. Similarly, Fe, particularly in its oxidized ferric (Fe³⁺) state, precipitates as hydroxides under high pH, resulting in chlorosis and growth inhibition in susceptible crops like rice [10]. Moreover, the availability of Zn and Cu is also severely restricted in calcareous soils due to pH-induced changes in solubility and competition with other cations such as Ca²⁺ [11,12].

Rice (Oryza sativa L.) is particularly vulnerable to nutrient imbalances in such soil conditions. Although rice belongs to the graminaceous group and partially relies on Strategy II Fe acquisition, which involves the release of phytosiderophores to chelate and solubilize Fe (III) in the rhizosphere. However, unlike the graminaceous species such as maize or barley, rice also displays limited Strategy I-like responses and produces lower levels of phytosiderophores, making it particularly vulnerable to Fe deficiency in calcareous soils [13]. Additionally, high soil pH conditions further exacerbate the problem by reducing the efficacy of Fe³⁺ chelation and uptake [14,15].

In this context, the use of plant growth-promoting yeasts (PGPY) such as Debaryomyces hansenii has emerged as a sustainable alternative to alleviate nutrient deficiencies. These microorganisms are known to improve plant nutrition by enhancing solubilization of mineral elements, modifying rhizospheric pH, and stimulating plant hormonal pathways [16,17]. Specifically, D. hansenii has been reported to induce Fe deficiency responses in cucumber [6] and to alleviate arsenic toxicity in rice, thereby promoting growth and nutrient status [18]. The potential of yeasts to solubilize phosphate through acidification of the medium, typically via secretion of organic acids such as citric acid, has been well documented for species like Yarrowia lipolytica, Rhodotorula sp., and Candida tropicalis [19,20]. Similarly, other yeast species are capable of releasing Zn and K from insoluble mineral forms [21,22], supporting root development and biomass accumulation [23]. In addition to nutrient solubilization, PGPY strains, such as Y. lipolytica and Rhodosporidium paludigenum, have demonstrated the capacity to synthesize phytohormones such as indole-3-acetic acid (IAA), gibberellins, cytokinins, and abscisic acid (ABA), which are integral to root proliferation, nutrient uptake, and stress tolerance [24,25].

The objective of this study is to evaluate the role of D. hansenii (strain CBS767) in promoting the growth, development, and yield of rice cultivated in limestone soil. While previous works have highlighted the potential of plant growth-promoting yeasts in various crops, studies specifically focused on D. hansenii in rice under calcareous soil conditions remain scarce. Moreover, the use of both hydroponic and soil-based systems in this work allowed us to dissect physiological, biochemical, and molecular responses, including acid phosphatase activity and the expression of genes associated with phosphorus acquisition. To our knowledge, this is the first report demonstrating the effect of D. hansenii on the expression of OsPAP3, OsPAP9, and OsPHT1;6 in rice. These findings provide novel insights into the functional mechanisms underlying yeast–plant interactions and support the use of D. hansenii as a promising biofertilizer for sustainable rice production in alkaline, nutrient-limited soils.

2. Material and Methods

2.1. Biological Material

Experiments were conducted using rice plants (Oryza sativa L. var. ‘Puntal’). Seeds were sterilized following the methodology described by Aparicio et al. [26]. They were sown on a layer of moist perlite at the bottom of a tray, to which 20 mL of a 5 mM CaCl₂ solution was added. The seeds were covered with another layer of moist perlite, and the tray was sealed with a plastic bag to prevent desiccation. Germination was carried out in the dark at 27 °C for 4 days. After germination, the seedlings were transferred to a growth chamber maintained at 25 °C during the day and 22 °C at night, with 70% relative humidity and a 14 h photoperiod at an irradiance of 300 μmol m⁻² s⁻¹ for 7 days. Subsequently, seedlings were moved to either a hydroponic system or calcareous soil. The hydroponic culture experiments were conducted in a growth chamber during June 2023. The pot experiments using calcareous soil were carried out under greenhouse conditions from June to October 2023, allowing the rice crop to complete its full growth cycle in order to assess the role of D. hansenii on crop yield. To maintain appropriate water availability for rice cultivation, pots were placed in trays with a constant water level, simulating field-like moisture conditions without inducing full soil flooding.

To transfer seedlings to the hydroponic system, they were removed from the perlite tray and thoroughly cleaned to remove root residues. The nutrient solution used was R&M [27], and aeration was continuously provided to avoid anoxia. Plants were kept under these conditions for 22 to 25 days, after which the treatments were applied.

For yeast inoculation, the wild-type genotype CBS767 of D. hansenii, obtained from the Dutch “Central Bureau von Schimmelcultures” (https://wi.knaw.nl/ [accesed on 10 October 2023]) and supplied by the Microbiology group at the University of Córdoba, was used. Yeast cultures were grown in YPD medium consisting of 2% D-glucose, 1% yeast extract, and 2% peptone at 26 °C [28].

2.2. Inoculation and Experimental Setup in Calcareous Soil

To evaluate the effects of D. hansenii on rice plants under field-like conditions, experiments were conducted in 2 L pots filled with calcareous soil. Seedlings previously grown in perlite trays were transplanted into the pots, and two inoculation methods were tested. Each treatment consisted of six replicate pots, each containing a minimum of four rice plants.

The soil used to fill the pots was obtained from Santa Cruz (Córdoba; 37°47′03″ N 4°36′35″ W) and sterilized or not at 121 °C for 50 min twice. The physical–chemical properties and phosphorus and iron availability for the plant in the sampled soil are shown in

Table 1. Physical–chemical properties and phosphorus and iron availability for the plant (average) in the calcareous soil used.

Clay g kg−1	Organic Carbon g kg−1	CaCO3 g kg−1	pH1:2.5	EC1:5 dS m−1	CEC cmol kg−1	POlsen mg kg−1	FeDTPA mg kg−1
370	9.3	338	7.9	1.5	31.3	13.4	4.3

CaCO₃: carbonate content. pH1:2.5: soil pH in the extract 1:2.5 (soil/deionized water). EC1:5: electrical conductivity in the extract 1:5 (soil/deionized water). CEC: cation exchange capacity. POlsen: P available on soil. FeDTPA: labile Fe in the soil.

.

In the pot experiments with calcareous soil, the following treatments were applied:

• Plants grown in previously sterilized calcareous soil.
• Plants grown in non-sterilized calcareous soil.
• Plants inoculated by root immersion and grown in sterilized calcareous soil.
• Plants inoculated by root immersion and grown in non-sterilized calcareous soil.
• Plants inoculated by surface irrigation and grown in sterilized calcareous soil.
• Plants inoculated by surface irrigation and grown in non-sterilized calcareous soil.

2.2.1. Root Inoculation

Some plants were inoculated by immersing their bare roots in a 1.5 L suspension of yeast (10⁷ cells/mL in deionized water) under constant agitation for 30 min prior to transplanting, ensuring effective contact between the yeast and the root surface [29].

2.2.2. Irrigation Inoculation

For this method, pots were irrigated with the inoculum suspension (10⁷ cells/mL in deionized water) until field capacity was reached.

2.2.3. Chlorophyll Content (SPAD)

Chlorophyll content was measured using a Minolta SPAD-502 (Konica Minolta, Tokyo, Japan) portable device. Four readings were taken from the youngest fully extended leaf per plant, averaging the values for representation.

2.2.4. Growth Promotion and Yield Production

At the end of the growth cycle, rice plants from all treatments were harvested to measure fresh shoot weight. Samples were then dried at 75 °C for 3 days to obtain dry weight and calculate the dry matter percentage:

$$\% \mathrm{D}\mathrm{r}\mathrm{y} \mathrm{m}\mathrm{a}\mathrm{t}\mathrm{t}\mathrm{e}\mathrm{r}={\displaystyle \frac{\mathrm{D}\mathrm{r}\mathrm{y} \mathrm{w}\mathrm{e}\mathrm{i}\mathrm{g}\mathrm{h}\mathrm{t} \mathrm{m}\mathrm{a}\mathrm{t}\mathrm{t}\mathrm{e}\mathrm{r} \left(\mathrm{g}\right)}{\mathrm{W}\mathrm{e}\mathrm{t} \mathrm{w}\mathrm{e}\mathrm{i}\mathrm{g}\mathrm{h}\mathrm{t} \mathrm{m}\mathrm{a}\mathrm{t}\mathrm{t}\mathrm{e}\mathrm{r} \left(\mathrm{g}\right)}} \times 100$$

(1)

Rice grain yield was also determined, accounting for moisture percentage uniformity across treatments.

2.2.5. Elemental Analysis of Leaves

Leaf samples for all nutrient analyses were collected from a single sampling at the end of the experimental period. Dried leaves were homogenized using a grinder. Samples were digested with 3 mL of 65% HNO₃ and incubated at room temperature for 16 h, followed by heating at 85 °C for 1.5 h. When vapor began to appear, 1 mL of 60% HClO₄ was added, and heating continued until white vapor indicated complete digestion. Samples were diluted to 10 mL with deionized water. Elemental analysis (Zn, Fe, Cu, Mn) was performed using flame atomic absorption spectrometry. Phosphorus was determined using the molybdovanadate method.

2.3. Inoculation in Hydroponic System

The experiments were conducted using rice plants (Oryza sativa L. var. ‘Puntal’). The seeds were surface-sterilized as described by Aparicio et al. [26]. Subsequently, the seedlings were grouped in sets of eight and transferred to a hydroponic system. Each group of eight seedlings was placed in plastic lids and held in holes of a thin polyurethane sheet floating on an aerated nutrient solution R&M [27] containing 2 mM Ca(NO₃)₂, 0.75 mM K₂SO₄, 0.65 mM MgSO₄, 0.5 mM KH₂PO₄, 50 μM KCl, 10 μM H₃BO₃, 1 μM MnSO₄, 0.5 μM CuSO₄, 0.5 μM ZnSO₄, 0.05 μM (NH₄)₆Mo₇O₂₄, and 45 μM Fe-EDTA for plants grown in complete nutrient solution. For plants grown in the P-deficient nutrient solution, 0.5 mM KH₂PO₄ was replaced by 0.5 mM KOH. Hydroponic experiments were performed with six replicate containers per treatment, each containing eight plants.

For hydroponic experiments, the yeast suspension (10⁷ cells/mL) was directly added to the nutrient solution with and without phosphorus (P). Control treatments without inoculation were included. Plants were sampled at three time points (7, 9, and 11 days post-treatment) to assess acid phosphatase activity and gene expression. Six replicates were performed for each treatment.

The following treatments were applied:

• Plants grown in a complete nutrient solution.
• Plants grown in a complete nutrient solution plus inoculum.
• Plants grown in a P-deficient nutrient solution.
• Plants grown in a P-deficient nutrient solution plus inoculum.

2.3.1. Acid Phosphatase Determination

Acid phosphatase activity was evaluated using the BCIP substrate, which turns blue upon enzymatic dephosphorylation. Roots were incubated in a 0.01% BCIP solution for 2 h at 22 °C (growth chamber temperature). Color intensity was evaluated qualitatively by visual comparison relative to the control plants [30]. For phosphatase activity assays, six individual plants per treatment were analyzed at each time point.

2.3.2. Gene Expression Analysis by qRT-PCR

Gene expression analysis was conducted using three independent biological replicates, each consisting of pooled root samples from multiple plants, with two technical replicates per sample. Roots were ground to a fine powder with a mortar and pestle in liquid nitrogen. RNA extraction was carried out using Tri Reagent (Molecular Research Center, Inc., Cincinnati, OH, USA) following the manufacturer’s protocol. RNA concentration was measured at 260 nm. M-MLV reverse transcriptase (Promega, Madison, WI, USA) was used to generate cDNA from 3 μg of DNase-treated root RNA, using random hexamers for amplification. The study of gene expression by qRT-PCR was performed by using a qRT-PCR Bio-Rad CFX connect thermal cycler. The amplification profile consisted of cycles with the following conditions: initial denaturation and polymerase activation (95 °C for 3 min), amplification and quantification (90 °C for 10 s, 57 °C for 15 s, and 72 °C for 30 s), and a final melting curve stage of 65 to 95 °C with an increment of 0.5 °C for 5 s to ensure the absence of primer dimer or nonspecific amplification products. PCR reactions were set up in 20 μL of SYBR Green Bio-RAD PCR Master Mix, following the manufacturer’s instructions. Controls containing water instead of cDNA were included to detect contamination in the reaction components. Normalization was performed using a reference gene (OsActin). Relative expression levels were calculated using the 2^−ΔΔCt method, taking the expression level at day 0 as the calibrator. The gene expression determination was carried out using the primer pairs shown on

Table 2. Primers used in this study.

Gene	Forward (5′-3′)	Reverse (5′-3′)
OsPHT1;6	CCGCCGCCTCACAAACTGTA	GAACTGGGCGGTTTTCCTGA
OsPAP9	ACCTACGTAGAGACAACATCAGGC	CATATACGTGTTGCCGGTAGTGA
OsPAP3	TCATACCATGAGGAGTGAGTGATG	GTCTTCGTTTTGTGAAAATGGC
OsACTIN	TGCATGTAGTACAGTGC CATCCAG	AATGAGTAACCACGCTCCGTCA

.

2.4. Statistical Analysis

Data normality and variance homogeneity were verified. ANOVA and post hoc Tukey’s or Dunnett’s tests (p < 0.05) were applied to compare treatments. Specifically, Tukey’s HSD test was used for agronomic, physiological, and biochemical parameters, while Dunnett’s test was applied for gene expression data when comparing each treatment against the non-inoculated control. All statistical analyses were conducted using GraphPad Prism v9, and the graphs were generated using Microsoft Excel.

3. Results

3.1. Effect of Debaryomyces hansenii Inoculation on SPAD Index in Calcareous Soil

Figure 1 shows the temporal dynamics of chlorophyll content (SPAD index) in rice leaves under the different soil and inoculation treatments. Across all conditions, SPAD values increased progressively from early stages of development until approximately 80–90 days after transplanting, followed by a gradual decline towards the end of the growth cycle. While similar overall trends were observed across treatments, differences emerged in the magnitude of SPAD values during the peak growth phase. Notably, plants inoculated with D. hansenii, particularly via root immersion, tended to exhibit higher SPAD values over time compared to their respective controls. Visual representations of plant growth stages under each condition are provided to aid in the interpretation of physiological development.

3.2. Effect of Debaryomyces hansenii on Dry Matter Content, Plant Height, and Grain Yield in Calcareous Soil

The inoculation of rice plants with D. hansenii significantly affected key agronomic parameters. As illustrated in Figure 2a, the treatment NSS-Dh Immersion led to the highest dry matter percentage, showing statistically significant differences compared to NSS-Control and all other inoculation methods. This trend was also observed in grain yield per plant (Figure 2b), with NSS-Dh Immersion showing the highest mean value (>2.0 g), significantly higher than the corresponding control and other inoculated treatments under non-sterilized conditions. In contrast, plants inoculated via irrigation (NSS-Dh Irrigation and SS-Dh Irrigation) and SS-Dh Immersion produced lower grain yields than their respective controls. Interestingly, no significant differences in dry matter content or grain production were detected between the control treatments grown in sterilized (SS-Control) and non-sterilized (NSS-Control) soils.

In line with these findings, visual assessment of plant height at 90 days after sowing (Figure 3) revealed that the tallest plants corresponded to the Dh Immersion treatment, both in sterilized and non-sterilized calcareous soils. These plants clearly outperformed those from all other treatments in terms of shoot length. This enhanced shoot elongation further supports the plant growth-promoting effect of D. hansenii when applied via root immersion, reinforcing its potential role in stimulating vegetative development under calcareous soil conditions.

3.3. Effect of Debaryomyces hansenii on Leaf Content of Cu, Fe, Zn, Mn, and P in Rice Plants in Calcareous Soil

The nutrient content in plant foliage is essential for photosynthesis, growth and development, grain yield and quality, as well as for overall plant health and stress tolerance [11]. As shown in Figure 4, the effect of D. hansenii inoculation on the foliar content of Cu, Fe, Zn, Mn, and P in rice plants grown in calcareous soil varied depending on the element and treatment condition.

In the case of copper (Cu), higher concentrations were found in control plants grown in non-sterilized soil, whereas lower values were detected in plants cultivated in sterilized soil. Interestingly, D. hansenii inoculation, regardless of the method, only resulted in significantly higher Cu content compared to the control when plants were grown in sterilized soil (Figure 4).

Regarding iron (Fe), the highest foliar concentrations were observed in the NSS-Dh Immersion treatment (non-sterilized soil, inoculated via root immersion). For zinc (Zn), elevated levels were detected in both NSS-Dh Immersion and NSS-Dh Irrigation treatments, whereas the increase in Fe was exclusive to the NSS-Dh Immersion treatment. In the case of manganese (Mn), higher concentrations were also found in the NSS-Dh Immersion treatment, although the difference compared to the SS-Control group was less pronounced.

In the case of phosphorus (P), the SS-Dh Irrigation and SS-Dh Immersion treatments showed significantly higher foliar P concentrations compared to the SS-Control and all non-sterilized treatments. In contrast, no significant differences in P content were observed between NSS-Control and NSS-Dh Irrigation, whereas a significant decrease was detected in the NSS-Dh Immersion treatment.

3.4. Effect of Debaryomyces hansenii on the Physiological Mechanism of Acid Phosphatase Activity in Rice Plants in a Hydroponic System

As extensively described in the literature, plants can only assimilate phosphorus in its inorganic form (Pi) [2,7]. Therefore, acid phosphatases play a critical role by hydrolyzing organic phosphorus compounds in the soil into Pi, which can be absorbed by plant roots. The degree of acid phosphatase induction is visually estimated by the intensity of blue staining in the roots: the more intense the coloration, the greater the enzymatic activity.

Three sampling points were conducted at 7, 9, and 11 days after treatment application (data). As shown in Figure 5, plants subjected to phosphorus deficiency (-P) exhibited stronger blue staining than those cultivated under phosphorus-sufficient conditions (+P), confirming a higher induction of acid phosphatase activity in response to nutrient stress. On the other hand, the effect of D. hansenii under sufficient phosphorus conditions (+P+Dh) was not clearly visible during the first two sampling points (7 and 9 days). However, by day 11, a more pronounced induction of acid phosphatase activity was observed in this treatment, indicating a delayed but positive effect of the yeast.

Under phosphorus-deficient conditions (-P), the effect of D. hansenii on acid phosphatase activity became apparent as early as the first sampling point. The highest level of induction compared to the corresponding control was observed at day 9 and remained elevated at day 11, suggesting a sustained stimulatory effect of the yeast under nutrient-limiting conditions.

3.5. Effect of Debaryomyces hansenii on the Expression of Genes Related to Acid Phosphatase Activity and Phosphorus Transport in Hydroponic System

Gene expression analysis of acid phosphatases and the Pi transporter, shown in Figure 6, confirms the inductive role of D. hansenii at the molecular level. The PAP gene family is closely associated with phosphorus acquisition in plants, as these genes encode acid phosphatases, enzymes whose activity was previously demonstrated in Figure 5.

The gene OsPAP9 showed a significant increase in expression at 7 and 9 days after treatment application in plants grown under phosphorus-sufficient conditions inoculated with D. hansenii (Figure 6a). Under phosphorus-deficient conditions, expression of OsPAP9 was also enhanced, with the most significant differences compared to the control observed at 9 and 11 days (Figure 6b). Similarly, OsPAP3 expression was significantly upregulated at 7 and 9 days under phosphorus sufficiency (Figure 6c) and at 11 days under phosphorus deficiency (Figure 6d), suggesting a time- and condition-dependent response to the presence of the yeast.

As for the gene encoding the phosphorus transporter analyzed in this study, OsPTH1;6, its relative expression level increased significantly compared to the control at 9 days, both under phosphorus-sufficient and phosphorus-deficient conditions (Figure 6e,f). These data indicate that D. hansenii not only enhances enzymatic activity related to Pi acquisition but also stimulates molecular pathways involved in phosphorus uptake and transport.

4. Discussion

Rice plants cultivated in calcareous soils often face multiple nutrient deficiencies due to the high pH and the specific physicochemical characteristics of these soils. Typically, calcareous soils have a pH above 7.5 and contain significant amounts of calcium carbonate (CaCO₃). The elevated pH can limit the availability of certain nutrients, while high calcium content may interfere with the uptake of others. Among the nutrients whose availability is commonly restricted under these conditions are iron (Fe), copper (Cu), manganese (Mn) [11], zinc (Zn) [31], and phosphorus (P) [32], among others. These deficiencies often result in stunted growth, reduced tillering, and lower grain yields [33]. Additionally, they can impair grain filling, leading to poorer grain quality and reduced market value [34]. Nutrient-deficient plants are also more susceptible to pest and disease attacks [35], which translates into economic losses for farmers [36].

Numerous studies have shown that beneficial soil microorganisms provide promising strategies to address nutrient deficiencies, particularly in calcareous soils. These organisms can enhance nutrient availability through various mechanisms, such as siderophore production, acidification of the rhizosphere, or activation of plant responses related to nutrient uptake [37,38,39,40,41]. In the present study, the inoculation of rice roots with D. hansenii led to significant improvements in physiological traits, including chlorophyll content (SPAD index), plant height, and grain yield, especially when applied via root immersion in non-sterilized soil. Furthermore, this treatment resulted in significantly higher foliar concentrations of Fe, Zn, and Mn, suggesting that D. hansenii may contribute to micronutrient solubilization or uptake. These findings support the hypothesis that certain yeasts can exert biofertilizer-like effects comparable to those previously described for plant growth-promoting bacteria (PGPB) or arbuscular mycorrhizal fungi (AMF) [37,38], possibly through mechanisms such as organic acid or siderophore production [39], or the activation of iron acquisition pathways [40,41].

Plant growth-promoting yeasts (PGPY), such as D. hansenii, have gained attention for their ability to colonize plant tissues and produce phytohormones, thus enhancing nutrient availability and soil fertility [42]. In the present study, D. hansenii significantly improved growth parameters in rice, including plant height, chlorophyll content, dry biomass, and grain production, particularly under non-sterilized conditions when applied via root immersion. These findings support its potential biofertilizing role in calcareous soils. The halotolerant nature of D. hansenii, with the capacity to grow under both high (5–15%) and low (<0.1 M) salinity conditions [43,44], further strengthens its applicability in environments affected by salinity or high pH. Based on our results, D. hansenii emerges as a promising candidate for improving rice cultivation in challenging soils through enhanced physiological performance and nutrient uptake.

These benefits may be linked to enhanced nutrient uptake and photosynthetic efficiency, possibly mediated by early root colonization and better establishment of the yeast when applied via root immersion. The delivery method appears to be critical, as immersion likely facilitates more intimate contact with the rhizoplane compared to irrigation-based applications. Furthermore, the greater effectiveness of D. hansenii in non-sterilized soil suggests a potential synergistic effect with the native microbiota, which could amplify the yeast’s biofertilizer properties.

Indeed, our results demonstrated that D. hansenii promoted rice plant growth by increasing chlorophyll content (SPAD index), plant height, dry matter accumulation, and grain production (Figure 1, Figure 2 and Figure 3). These effects were particularly evident under non-sterilized soil conditions and when the yeast was applied via root immersion, suggesting that early root colonization and interaction with the native microbiota may have played a role in enhancing plant responses. While no previous studies have directly reported the effect of D. hansenii on chlorophyll content in rice, yeasts are known to produce phytohormones and metabolites that influence photosynthetic activity and biomass accumulation. The increase in the SPAD index observed in our study may reflect an improvement in nitrogen status or in micronutrient uptake (notably Fe and Mn), both of which are critical for chlorophyll biosynthesis and function. These findings provide a physiological explanation for the enhanced productivity observed in inoculated plants.

Moreover, increases in foliar concentrations of Cu, Fe, Zn, and Mn were observed in plants inoculated with D. hansenii under specific cultivation conditions (Figure 4). Such interactions might also explain the increased foliar levels of Fe, Zn, and Mn under specific conditions, reflecting either improved solubilization or mobilization of micronutrients. Kaur et al. [18] reported improved growth and nutritional status in rice plants inoculated with D. hansenii. Similar results have been obtained with other microorganisms in different crops. For example, Pseudomonas aeruginosa and Enterobacter spp. promoted the growth of alfalfa under alkaline conditions [45], while Agrobacterium, Bacillus, and Alcaligenes strains enhanced growth and mineral nutrition in strawberry plants [46].

Although no clear increase in phosphorus content was detected in inoculated plants (Figure 4), D. hansenii significantly induced acid phosphatase activity under both phosphorus-sufficient and phosphorus-deficient conditions (Figure 5). It is well established that arbuscular mycorrhizal fungi enhance P uptake by increasing acid phosphatase activity in the root zone, thereby aiding in the solubilization of organic phosphorus compounds [47]. Certain endophytic strains, such as Pantoea and Colletotrichum, have also been shown to produce acid phosphatases and improve phosphorus uptake in plants [48]. The increased P concentration observed in sterilized soil inoculated with D. hansenii, despite the absence of other microbes, suggests a yeast-driven mechanism, possibly related to intrinsic phosphate solubilization capabilities. Although D. hansenii activated acid phosphatase activity under phosphorus-deficient conditions in the hydroponic system, no significant increase in foliar phosphorus concentration was detected in the soil-grown plants. This may be due to the fact that, although approximately 90% of calcareous soils are deficient in P that is readily available for biological processes [49], the specific soil used in our experiment likely provided sufficient available phosphorus to meet the plant’s nutritional demand. Under such conditions, any potential effect of the yeast on phosphorus uptake may have been masked.

The activation of physiological responses to phosphorus deficiency—such as increased acid phosphatase activity—is regulated at the transcriptional level by specific genes. According to Zhang et al. [50], only ten PAP genes in rice are induced under P-deficient conditions. In this study, we examined two of these genes, which showed higher expression levels in plants inoculated with D. hansenii (Figure 6a–d). Arbuscular mycorrhizal fungi are known to upregulate PAP genes in symbiosis with rice roots [51], and phosphate-solubilizing bacteria have also been shown to influence PAP gene expression in rice [52]. Additionally, the gene encoding the phosphate transporter analyzed in this study, OsPTH1;6, was upregulated under both phosphorus-sufficient and deficient conditions (Figure 6), suggesting that this yeast may contribute to enhanced P acquisition in rice.

The upregulation of phosphate-related genes such as OsPAP3, OsPAP9, and OsPHT1;6 in D. hansenii-inoculated plants suggests that the yeast may enhance phosphorus mobilization and uptake at the molecular level. This transcriptional response aligns with the increased acid phosphatase activity observed and may contribute to maintaining plant growth and productivity despite the low phosphorus availability characteristic of calcareous soils. Thus, the molecular and physiological responses appear to be coordinated and reinforce the potential of D. hansenii as a biofertilizer in phosphorus-limiting conditions.

To address the variability observed across treatments, a condition-specific interpretation is required. In non-sterilized soils, D. hansenii applied by root immersion consistently resulted in enhanced physiological and agronomic parameters, such as higher SPAD values, dry matter accumulation, and grain yield. These effects may be attributed to more effective root colonization and synergistic interactions with native microbiota. Conversely, under sterilized soil conditions, the same treatment did not produce significant improvements and in some cases even led to reduced performance, suggesting that the absence of indigenous microorganisms might impair the yeast’s beneficial effects or alter soil dynamics negatively. Similarly, inoculation via irrigation showed either neutral or detrimental effects, particularly in sterilized soils, potentially due to limited yeast establishment or reduced root–yeast contact. Notably, there were no significant differences between control plants in sterilized and non-sterilized soils, indicating that the native microbial community alone was not sufficient to alter plant performance under the conditions tested. These findings highlight that the mode of inoculation and the presence of native microbiota are key factors determining the outcome of biofertilizer applications. The novelty of this work lies in the demonstration that D. hansenii can upregulate phosphorus-related genes (OsPAP3, OsPAP9, and OsPHT1;6) in rice for the first time, even under P-sufficient conditions, and that its effectiveness depends on the microbiological context and application strategy. This study also provides novel insight into the use of a non-conventional yeast as a plant growth-promoting agent in calcareous soil, a context rarely explored previously in the literature.

5. Conclusions

In conclusion, the yeast D. hansenii demonstrated a clear capacity to promote rice plant growth in calcareous soils, particularly when applied via root immersion. This treatment resulted in significant improvements in physiological parameters such as chlorophyll content (SPAD index), plant height, dry matter accumulation, and grain yield. Although no significant differences were observed between control plants grown in sterilized and non-sterilized soils, the potential for synergistic effects between D. hansenii and native soil microbiota cannot be ruled out and may warrant further investigation under field conditions.

In addition to promoting overall growth, D. hansenii increased the foliar content of essential micronutrients (Cu, Fe, Zn, Mn), which are often limited in calcareous soils. Although no marked increase in phosphorus content was observed, D. hansenii significantly enhanced acid phosphatase activity and upregulated phosphorus-related genes (OsPAP3, OsPAP9, OsPHT1;6) under both P-sufficient and P-deficient conditions. These findings support the role of D. hansenii as a plant growth-promoting yeast (PGPY) with strong biotechnological potential for development as a biofertilizer in saline and alkaline soils.