Intraspecific Genetic Variability of Brassica cretica Lam. (Brassicaceae) Using SSR Markers
Abstract
1. Introduction
2. Materials and Methods
2.1. Plant Material and DNAExtraction
2.2. Molecular Analysis; PCR Amplification and SSRMarkers
2.3. Data Statistical Analysis
2.3.1. Variation Within Population
2.3.2. Variation Among Populations
3. Results
3.1. Genetic Variation Within Populations
3.2. Genetic Variation Between and Within Populations
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Data Availability Statement
Conflicts of Interest
References
- Arias, T.; Pires, J.C. A fully resolved chloroplast phylogeny of the brassica crops and wild relatives (Brassicaceae: Brassiceae): Novel clades and potential taxonomic implications. Taxon 2012, 61, 980–988. [Google Scholar] [CrossRef] [Scilit]
- Lysak, M.A.; Koch, M.A.; Pecinka, A.; Schubert, I. Chromosome triplication found across the tribe Brassiceae. Genome Res. 2005, 15, 516–525. [Google Scholar] [CrossRef] [Scilit]
- Schranz, M.E.; Lysak, M.A.; Mitchell-Olds, T. The ABC’s of comparative genomics in the Brassicaceae: Building blocks of crucifer genomes. Trends Plant Sci. 2006, 11, 535–542. [Google Scholar] [CrossRef] [Scilit]
- Tatout, C.; Warwick, S.; Lenoir, A.; Deragon, J.-M. SINE insertions as clade markers for wild crucifer species. Mol. Biol. Evol. 1999, 16, 1614. [Google Scholar] [CrossRef] [Scilit]
- Eiseley, L.C.; Grote, A. Charles Darwin, Edward Blyth, and the Theory of Natural Selection. Proc. Am. Philos. Soc. 1959, 103, 94–158. [Google Scholar]
- Mabry, M.E.; Turner-Hissong, S.D.; Gallagher, E.Y.; McAlvay, A.C.; An, H.; Edger, P.P.; Moore, J.D.; Pink, D.A.; Teakle, G.R.; Stevens, C.J. The evolutionary history of wild, domesticated, and feral Brassica oleracea (Brassicaceae). Mol. Biol. Evol. 2021, 38, 4419–4434. [Google Scholar] [CrossRef] [Scilit]
- Ndondo, J.T.K. Review of the Food and Agriculture Organisation (FAO) Strategic Priorities on Food Safety 2023. In Food Safety-New Insights; IntechOpen: London, UK, 2023. [Google Scholar]
- Sciandrello, S.; Brullo, C.; Brullo, S.; Giusso Del Galdo, G.; Minissale, P.; Salmeri, C. A new species of Brassica sect. Brassica (Brassicaceae) from Sicily. Plant Biosyst.-Int. J. Deal. All Asp. Plant Biol. 2013, 147, 812–820. [Google Scholar]
- Hodgkin, T. Cabbages, kales, etc. In Evolution of Crop Plants, 2nd ed.; Smartt, J., Simmonds, N.W., Eds.; Longman Scientific and Technical: Harlow, UK, 1995; pp. 76–82. [Google Scholar]
- Maggioni, L.; von Bothmer, R.; Poulsen, G.; Lipman, E. Domestication, diversity and use of Brassica oleracea L., based on ancient Greek and Latin texts. Genet. Resour. Crop Evol. 2018, 65, 137–159. [Google Scholar] [CrossRef] [Scilit]
- Snogerup, S.; Gustafsson, M.; Von Bothmer, R. Brassica sect. Brassica (Brassicaceae) I. taxonomy and variation. Willdenowia 1990, 19, 271–365. [Google Scholar]
- Castillo-Lorenzo, E.; Breman, E.; Gómez Barreiro, P.; Viruel, J. Current status of global conservation and characterisation of wild and cultivated Brassicaceae genetic resources. GigaScience 2024, 13, giae050. [Google Scholar] [CrossRef] [Scilit]
- Gustafsson, M.; Bentzer, B.; Bothmer, R.V.; Snogerup, S. Meiosis in Greek Brassica of the oleracea group. Bot. Not. 1976, 129, 73–84. [Google Scholar]
- Dixon, G. Origins and diversity of Brassica and its relatives. In Vegetable Brassicas and Related Crucifers; CABI: Wallingford, UK, 2006; pp. 1–33. [Google Scholar]
- Lázaro, A.; Aguinagalde, I. Genetic Diversity in Brassica oleracea L. (Cruciferae) and Wild Relatives (2n = 18) using RAPD Markers. Ann. Bot. 1998, 82, 829–833. [Google Scholar] [CrossRef] [Scilit]
- Widén, B.; Andersson, S.; Rao, G.Y.; Widén, M. Population divergence of genetic (co) variance matrices in a subdivided plant species, Brassica cretica. J. Evol. Biol. 2002, 15, 961–970. [Google Scholar] [CrossRef] [Scilit]
- Grant, V. Modes and origins of mechanical and ethological isolation in angiosperms. Proc. Natl. Acad. Sci. USA 1994, 91, 3–10. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Frankham, R. Inbreeding and extinction: A threshold effect. Conserv. Biol. 1995, 9, 792–799. [Google Scholar] [CrossRef] [Scilit]
- Hu, S.; Yu, C.; Zhao, H.; Sun, G.; Zhao, S.; Vyvadilova, M.; Kucera, V. Genetic diversity of Brassica napus L. Germplasm from China and Europe assessed by some agronomically important characters. Euphytica 2007, 154, 9–16. [Google Scholar] [CrossRef] [Scilit]
- Mishra, P.; Singh, N. Allelic diversity among short duration maize (Zea mays L.) genotypes using SSR markers. Madras Agric. J. 2012, 99, 1. [Google Scholar] [CrossRef] [Scilit]
- Xu, Y.; Xing, M.; Song, L.; Yan, J.; Lu, W.; Zeng, A. Genome-wide analysis of simple sequence repeats in cabbage (Brassica oleracea L.). Front. Plant Sci. 2021, 12, 726084. [Google Scholar] [CrossRef] [Scilit]
- Allender, C.; Allainguillaume, J.; Lynn, J.; King, G.J. Simple sequence repeats reveal uneven distribution of genetic diversity in chloroplast genomes of Brassica oleracea L. and (n = 9) wild relatives. Theor. Appl. Genet. 2007, 114, 609–618. [Google Scholar] [CrossRef] [Scilit]
- Shi, J.; Huang, S.; Zhan, J.; Yu, J.; Wang, X.; Hua, W.; Liu, S.; Liu, G.; Wang, H. Genome-wide microsatellite characterization and marker development in the sequenced Brassica crop species. DNA Res. 2014, 21, 53–68. [Google Scholar] [CrossRef] [Scilit]
- Thakur, A.K.; Singh, K.H.; Singh, L.; Nanjundan, J.; Khan, Y.J.; Singh, D. SSR marker variations in Brassica species provide insight into the origin and evolution of Brassica amphidiploids. Hereditas 2018, 155, 6. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kumar, M.; Choi, J.-Y.; Kumari, N.; Pareek, A.; Kim, S.-R. Molecular breeding in Brassica for salt tolerance: Importance of microsatellite (SSR) markers for molecular breeding in Brassica. Front. Plant Sci. 2015, 6, 688. [Google Scholar] [CrossRef] [Scilit]
- Sun, D.; Wang, C.; Zhang, X.; Zhang, W.; Jiang, H.; Yao, X.; Liu, L.; Wen, Z.; Niu, G.; Shan, X. Draft genome sequence of cauliflower (Brassica oleracea L. var. botrytis) provides new insights into the C genome in Brassica species. Hortic. Res. 2019, 6, 82. [Google Scholar] [CrossRef] [Scilit]
- Doyle, J.J.; Doyle, J.L. A rapid DNA isolation procedure for small quantities of fresh leaf tissue. Phytochem. Bull. 1987, 19, 11–15. [Google Scholar]
- Edh, K.; Widén, B.; Ceplitis, A. Nuclear and chloroplast microsatellites reveal extreme population differentiation and limited gene flow in the Aegean endemic Brassica cretica (Brassicaceae). Mol. Ecol. 2007, 16, 4972–4983. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Peakall, R.; Smouse, P.E. GENALEX 6: Genetic analysis in Excel. Population genetic software for teaching and research. Mol. Ecol. Notes 2006, 6, 288–295. [Google Scholar] [CrossRef] [Scilit]
- Kalinowski, S.T. hp-rare 1.0: A computer program for performing rarefaction on measures of allelic richness. Mol. Ecol. Notes 2005, 5, 187–189. [Google Scholar] [CrossRef] [Scilit]
- Chapuis, M.-P.; Estoup, A. Microsatellite null alleles and estimation of population differentiation. Mol. Biol. Evol. 2007, 24, 621–631. [Google Scholar] [CrossRef] [Scilit]
- Nei, M. Analysis of gene diversity in subdivided populations. Proc. Natl. Acad. Sci. USA 1973, 70, 3321–3323. [Google Scholar] [CrossRef] [Scilit]
- Cavalli-Sforza, L.L.; Edwards, A.W. Phylogenetic analysis. Models and estimation procedures. Am. J. Hum. Genet. 1967, 19, 233. [Google Scholar]
- Evanno, G.; Regnaut, S.; Goudet, J. Detecting the number of clusters of individuals using the software STRUCTURE: A simulation study. Mol. Ecol. 2005, 14, 2611–2620. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kopelman, N.M.; Mayzel, J.; Jakobsson, M.; Rosenberg, N.A.; Mayrose, I. Clumpak: A program for identifying clustering modes and packaging population structure inferences across K. Mol. Ecol. Resour. 2015, 15, 1179–1191. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Paradis, E.; Schliep, K. ape 5.0: An environment for modern phylogenetics and evolutionary analyses in R. Bioinformatics 2019, 35, 526–528. [Google Scholar] [CrossRef] [Scilit]
- Schliep, K.; Potts, A.A.; Morrison, D.A.; Grimm, G.W. Intertwining phylogenetic trees and networks. PeerJ Prepr. 2016, 2167–9843. [Google Scholar] [CrossRef] [Scilit]
- Higgins, S.I.; Lavorel, S.; Revilla, E. Estimating plant migration rates under habitat loss and fragmentation. Oikos 2003, 101, 354–366. [Google Scholar] [CrossRef] [Scilit]
- Neilson, R.P.; Pitelka, L.F.; Solomon, A.M.; Nathan, R.; Midgley, G.F.; Fragoso, J.M.; Lischke, H.; Thompson, K. Forecasting regional to global plant migration in response to climate change. Bioscience 2005, 55, 749–759. [Google Scholar] [CrossRef] [Scilit]
- Snogerup, S. The Mediterranean islands. In Plant Conservation in the Mediterranean Area; Gomez-Campo, C., Ed.; Series Geobotany 7; Dr W. Junk Publishers: Dordrecht, The Netherlands, 1985; pp. 159–173. [Google Scholar]
- Runemark, H. Reproductive drift, a neglected principle in reproductive biology. Bot. Not. 1969, 122, 90–129. [Google Scholar]
- Bittkau, C.; Comes, H.P. Molecular inference of a Late Pleistocene diversification shift in Nigella s. lat. (Ranunculaceae) resulting from increased speciation in the Aegean archipelago. J. Biogeogr. 2009, 36, 1346–1360. [Google Scholar] [CrossRef] [Scilit]
- El-Esawi, M.A.; Germaine, K.; Bourke, P.; Malone, R. Genetic diversity and population structure of Brassica oleracea germplasm in Ireland using SSR markers. Comptes Rendus Biol. 2016, 339, 133–140. [Google Scholar] [CrossRef] [Scilit]
- Maggioni, L.; von Bothmer, R.; Poulsen, G.; Härnström Aloisi, K. Survey and genetic diversity of wild Brassica oleracea L. germplasm on the Atlantic coast of France. Genet. Resour. Crop Evol. 2020, 67, 1853–1866. [Google Scholar] [CrossRef] [Scilit]
- Watson-Jones, S.; Maxted, N.; Ford-Lloyd, B. Population baseline data for monitoring genetic diversity loss for 2010: A case study for Brassica species in the UK. Biol. Conserv. 2006, 132, 490–499. [Google Scholar] [CrossRef] [Scilit]
- POWO. Plants of the World Online. Facilitated by the Royal Botanic Gardens, Kew. Published on the Internet. 2023. Available online: https://powo.science.kew.org/ (accessed on 12 May 2025).
- Euro+Med PlantBase—The Information Resource for Euro-Mediterranean Plant Diversity. 2006. Available online: https://www.emplantbase.org/home.html (accessed on 12 May 2025).
- Kioukis, A.; Michalopoulou, V.A.; Briers, L.; Pirintsos, S.; Studholme, D.J.; Pavlidis, P.; Sarris, P.F. Intraspecific diversification of the crop wild relative Brassica cretica Lam. using demographic model selection. BMC Genom. 2020, 21, 48. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Rakow, G. Species origin and economic importance of Brassica. In Brassica; Springer: Berlin/Heidelberg, Germany, 2004; pp. 3–11. [Google Scholar]
- Aguinagalde, I.; Gómez-Campo, C.; Sanchez-Yelamo, M. A chemosystematic survey on wild relatives of Brassica oleracea L. Bot. J. Linn. Soc. 1992, 109, 57–67. [Google Scholar] [CrossRef] [Scilit]
- Maggioni, L.; von Bothmer, R.; Poulsen, G.; Branca, F. Origin and Domestication of Cole Crops (Brassica oleracea L.): Linguistic and Literary Considerations1. Econ. Bot. 2010, 64, 109–123. [Google Scholar] [CrossRef] [Scilit]
- Palmgren, M.; Shabala, S. Adapting crops for climate change: Regaining lost abiotic stress tolerance in crops. Front. Sci. 2024, 2, 1416023. [Google Scholar] [CrossRef] [Scilit]
- Batool, M.; El-Badri, A.M.; Hassan, M.U.; Haiyun, Y.; Chunyun, W.; Zhenkun, Y.; Jie, K.; Wang, B.; Zhou, G. Drought stress in Brassica napus: Effects, tolerance mechanisms, and management strategies. J. Plant Growth Regul. 2022, 42, 21–45. [Google Scholar] [CrossRef] [Scilit]
- Trunschke, J.; Junker, R.R.; Kudo, G.; Alexander, J.M.; Richman, S.K.; Till-Bottraud, I. Effects of climate change on plant-pollinator interactions and its multitrophic consequences. Alp. Bot. 2024, 134, 115–121. [Google Scholar] [CrossRef] [Scilit]
- Mohd Saad, N.S.; Severn-Ellis, A.A.; Pradhan, A.; Edwards, D.; Batley, J. Genomics armed with diversity leads the way in Brassica improvement in a changing global environment. Front. Genet. 2021, 12, 600789. [Google Scholar] [CrossRef] [Scilit]
- Saban, J.M.; Romero, A.J.; Ezard, T.H.; Chapman, M.A. Extensive crop–wild hybridization during Brassica evolution and selection during the domestication and diversification of Brassica crops. Genetics 2023, 223, iyad027. [Google Scholar] [CrossRef] [Scilit]





| CODE | Taxon | Locality | Country | Seed Collection Date | Latitude | Longitude |
|---|---|---|---|---|---|---|
| A | Brassica cretica subsp. aegaea | Manikia, Evia | Greece | June 2022 | 38°32.582′ | 24°1.052′ |
| B | Brassica cretica subsp. aegaea | Ymittos, Attiki | Greece | June 2022 | 37°56.671′ | 23°48.030′ |
| C | Brassica cretica subsp. cretica or nivea | Akrokorinthos, Korinthos | Greece | May 2022 | 37°53.363′ | 22°52.138′ |
| D | Brassica cretica subsp. cretica | Lasithi, Crete | Greece | May 2021 | 35°19.772′ | 25°41.458′ |
| E | Brassica cretica subsp. laconica | Leonidio, Arkadia | Greece | June 2022 | 37°9.940′ | 22°52.255′ |
| F | Brassica oleracea var Rubra | commercial variety of cabbage as outgroup | Seeds produced in E.U. |
| Locus | Forward and Reverse Primer Sequences (5′→3′) | Repeat Motif | Size Range (bp) | Ta (°C) | Citation |
|---|---|---|---|---|---|
| Ol10B11 | AAAATGTGAGGCTGTTTGGG TTTCGCAGCAGTAAACATGG | (GA)25 | 76–180 | 52.5 | [24] |
| Ol10B01 | CCTCTTCAGTCGAGGTCTGG AATTTGGAAACAGAGTCGCC | (GA)20 | 160–280 | 56 | [24] |
| Ol09A01 | TTCGAAGCTCATTATCGCAG CCGGGCTCTCTCTCTCTCTC | (GA)75 | 120–340 | 56.5 | [24] |
| Ol10F11 | TTTGGAACGTCCGTAGAAGG CAGCTGACTTCGAAAGGTCC | (GGC)7 | 139–184 | 56 | [24,28] |
| Ni4-B10 | GTCCTTGAGAAACTCCACCG CCGATCCCATTTCTAATCCC | (CT)20 | 170–200 | 56 | [26] |
| sORA26 | TGTTTACCTGTTGGAGAT AACCCTAAGCATCTGCGA | (GA)5 | 62–76 | 49 | [24,28] |
| BN12A | GCCGTTCTAGGGTTTGTGGGA GCCGTTCTAGGGTTTGTGGGA | (GA)11(AAG)4 | 250–330 | 59 | [28] |
| Na10-F06 | CTCTTCGGTTCGATCCTCG TTTTTAACAGGAACGGTGGC | (CCG)6 | 84–126 | 54.5 | [28] |
| nga111 | TGTTTTTTAGGACAAATGGCG CTCCAGTTGGAAGCTAAAGGG | (GA)16 | 120–150 | 54.5 | [28] |
| MB4 | TGTTTTGATGTTTCCTACTG GAACCTGTGGCTTTTATTAC | (TG)10 | 57–69 | 50 | [28] |
| Locus | Ol10B11 | Ol10B01 | Ol09A01 | Ol10F11 | Ni4-B10 | sORA26 | BN12A | Na10-F06 | nga111 | MB4 | MEAN |
|---|---|---|---|---|---|---|---|---|---|---|---|
| Na | 27 | 30 | 32 | 19 | 19 | 18 | 18 | 16 | 20 | 20 | 21.9 |
| Ne | 3.606 | 3.985 | 4.107 | 2.489 | 2.844 | 2.759 | 2.629 | 2.413 | 2.805 | 2.859 | 3.049 |
| I | 1.374 | 1.438 | 1.418 | 0.977 | 1.081 | 1.052 | 1.005 | 0.907 | 1.082 | 1.114 | 1.145 |
| Ho | 0.075 | 0.35 | 0.308 | 0.308 | 0.175 | 0 | 0 | 0.05 | 0.017 | 0 | 0.128 |
| He | 0.720 | 0.734 | 0.705 | 0.583 | 0.638 | 0.634 | 0.61 | 0.568 | 0.631 | 0.645 | 0.647 |
| Population | Na | Ne | I | He | Ho | AR | pAR | Fst |
|---|---|---|---|---|---|---|---|---|
| A | 4.400 | 3.519 | 1.279 | 0.677 | 0140 | 3.69 | 0.82 | 0.808 |
| B | 3800 | 3.191 | 1.218 | 0678 | 0.095 | 3.44 | 0.86 | 0.862 |
| C | 3200 | 2.917 | 1.091 | 0645 | 0.060 | 3.05 | 0.62 | 0.886 |
| D | 3700 | 3.043 | 1.131 | 0.636 | 0.125 | 3.25 | 0.09 | 0.840 |
| E | 3.300 | 2.747 | 1.075 | 0.629 | 0.130 | 3.05 | 0.60 | 0.792 |
| F | 3500 | 2.879 | 1.075 | 0.617 | 0.220 | 3.09 | 0.72 | 0.682 |
| Mean | 3.650 | 3.050 | 1.145 | 0.647 | 0.128 | 3.26 | 0.62 | 0.812 |
| A | B | C | D | E | F | |
|---|---|---|---|---|---|---|
| 0.000 | 0.081 | 0.147 | 0.094 | 0.145 | 0.125 | A |
| 0.122 | 0.000 | 0.128 | 0.123 | 0.156 | 0.148 | B |
| 0.203 | 0.172 | 0.000 | 0.074 | 0. 179 | 0,177 | C |
| 0.131 | 0.175 | 0.106 | 0.000 | 0.151 | 0.129 | D |
| 0.200 | 0.212 | 0.234 | 0.212 | 0.000 | 0.154 | E |
| 0.172 | 0.199 | 0.236 | 0.179 | 0.215 | 0.000 | F |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Stathi, E.; Avramidou, E.V.; Trigas, P.; Katsileros, A.; Karavidas, I.; Ntanasi, T.; Ntatsi, G.; Bebeli, P.J.; Tani, E. Intraspecific Genetic Variability of Brassica cretica Lam. (Brassicaceae) Using SSR Markers. Agronomy 2025, 15, 1201. https://doi.org/10.3390/agronomy15051201
Stathi E, Avramidou EV, Trigas P, Katsileros A, Karavidas I, Ntanasi T, Ntatsi G, Bebeli PJ, Tani E. Intraspecific Genetic Variability of Brassica cretica Lam. (Brassicaceae) Using SSR Markers. Agronomy. 2025; 15(5):1201. https://doi.org/10.3390/agronomy15051201
Chicago/Turabian StyleStathi, Efthalia, Evangelia V. Avramidou, Panayiotis Trigas, Anastasios Katsileros, Ioannis Karavidas, Theodora Ntanasi, Georgia Ntatsi, Penelope J. Bebeli, and Eleni Tani. 2025. "Intraspecific Genetic Variability of Brassica cretica Lam. (Brassicaceae) Using SSR Markers" Agronomy 15, no. 5: 1201. https://doi.org/10.3390/agronomy15051201
APA StyleStathi, E., Avramidou, E. V., Trigas, P., Katsileros, A., Karavidas, I., Ntanasi, T., Ntatsi, G., Bebeli, P. J., & Tani, E. (2025). Intraspecific Genetic Variability of Brassica cretica Lam. (Brassicaceae) Using SSR Markers. Agronomy, 15(5), 1201. https://doi.org/10.3390/agronomy15051201

