Occurrence and Distribution of Root-Knot Nematodes Meloidogyne spp. in Serbia
Abstract
1. Introduction
2. Materials and Methods
2.1. Sampling
2.2. Nematode Extraction
2.3. Morphological Analysis
2.4. Molecular Identification
2.5. Culturing of Meloidogyne Populations
2.6. Statistical and Meloidogyne spp. Community Analyses
3. Results
3.1. Meloidogyne Detection
3.2. Identification, Distribution and New Host Plant Records for Meloidogyne Species
Species | Region | District | Host Plant | Cultivation Conditions |
---|---|---|---|---|
M. arenaria | Northern Serbia | South Banat | Calla (C. palustris) | Greenhouse |
North Banat | Carrot (D. carota subsp. sativus) | Field | ||
Central Serbia | Braničevo | |||
M. incognita | Northern Serbia | North Banat | Potato (S. tuberosum) | Field |
South Banat | Calla (C. palustris) Pepper (C. annuum) Tomato (S. lycopersicum) Cucumber (C. sativus) | Greenhouse | ||
West Bačka | ||||
South Bačka | ||||
Srem | ||||
Central Serbia | Mačva | |||
Braničevo | ||||
Raška | ||||
Nišava | ||||
Jablanica | ||||
Pčinja | ||||
M. luci | Northern Serbia | West Bačka | Tomato (S. lycopersicum) Cucumber (C. sativus) | Greenhouse |
Central Serbia | Jablanica | |||
M. hapla | Northern Serbia | North Banat | Carrot (D. carota subsp. sativus) Parsley (P. crispum) | Field |
South Banat | Pepper (C. annuum) Tomato (S. lycopersicum) Melon (C. melo) | Greenhouse | ||
South Bačka | ||||
Srem | ||||
Central Serbia | Raška | |||
Jablanica | ||||
M. hapla and M. javanica | Northern Serbia | North Banat | Carrot (D. carota subsp. sativus) | Field |
M. hapla and M. incognita | Central Serbia | Jablanica | Tomato (S. lycopersicum) | Greenhouse |
3.3. Meloidogyne spp. Community Analyses
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Moens, M.; Perry, R.N.; Starr, J.L. Meloidogyne Species—A Diverse Group of Novel and Important Plant Parasites. In Root-Knot Nematodes; Perry, R.N., Moens, M., Starr, J.L., Eds.; Oxon (CABI): Wallingford, UK, 2009; pp. 1–17. [Google Scholar]
- Blok, V.C.; Jones, J.T.; Phillips, M.S.; Trudgill, D.L. Parasitism genes and host range disparities in biotrophic nematodes: The conundrum of polyphagy versus specialisation. BioEssays 2008, 30, 249–259. [Google Scholar] [CrossRef]
- Subbotin, S.A.; Palomares-Rius, J.E.; Castillo, P. Chapter 1 Taxonomic history. In Systematics of Root-Knot Nematodes (Nematoda: Meloidogynidae) Nematology Monographs and Perspectives; Hunt, D.J., Perry, R.N., Eds.; Brill: Leiden, The Netherlands, 2021; Volume 14, p. 857. [Google Scholar]
- Karssen, G. Chapter 5 Revision of the European Root-Knot Nematodes III. On Mono-and Dicotyledons. In The Plant-Parasitic Nematode Genus Meloidogyne Goldi, 1892 (Tylenchida) in Europe; Brill: Leiden, The Netherlands, 2002; p. 91. [Google Scholar]
- European and Mediterranean Plant Protection Organization. EPPO A1 List of Pests Recommended for Regulation as Quarantine Pests. Version 2023-09. 2023. Available online: https://www.eppo.int/ACTIVITIES/plant_quarantine/A1_list (accessed on 8 January 2025).
- European and Mediterranean Plant Protection Organization. EPPO A2 List of Pests Recommended for Regulation as Quarantine Pests. Version 2023-09. 2023. Available online: https://www.eppo.int/ACTIVITIES/plant_quarantine/A2_list (accessed on 8 January 2025).
- Anonymous. Study on the State of Agriculture in Five Applicant Country, Country Report: Serbia. ACOTRASS-Consortium. 2006. Available online: https://agriculture.ec.europa.eu/system/files/2020-02/ext-study-applicant-serbia_2006_en_0.pdf (accessed on 8 January 2025).
- Anonymous. Brochure: 2023 Census of Agriculture, Statistical Office of the Republic of Serbia 2024. Available online: https://popispoljoprivrede.stat.gov.rs/media/31091/brosura-engleski-sa-koricom.pdf (accessed on 8 January 2025).
- Grujičić, G. Efikasnost nekih nematocida kod suzbijanja korenove nematode u staklarama. Zašt. Bilja 1959, 55, 63–68. (In Serbian) [Google Scholar]
- Grujičić, G. Prilog proučavanju ekologije Meloidogyne spp. Zašt. Bilja 1959, 54, 69–75. (In Serbian) [Google Scholar]
- Jovičić, D.; Grujičić, G. Root-knot nematodes (Meloidogyne spp.) in the SR Serbia [Yugoslavia]. Zašt. Bilja 1986, 37, 31–40, (In Serbian with English abstract). [Google Scholar]
- Grujičić, G. Korenova nematoda (Meloidogyne naasi Franklin) u Srbiji. Prethodno saopštenje. Zašt. Bilja 1967, 18, 193–197. (In Serbian) [Google Scholar]
- Grujičić, G.; Borić, B. Korenova nematoda (Meloidogyne incognita Chitwood) na suncokretu u Vojvodini. Zašt. Bilja 1971, 112, 143–145. (In Serbian) [Google Scholar]
- Grujičić, G.; Jovičić, D. Harmful nematofauna in tobacco fields in Serbia. Zašt. Bilja 1988, 39, 149–157, (In Serbian with English abstract). [Google Scholar]
- Bačić, J.; Gerič Stare, B.; Strajnar, P.; Širca, S.; Urek, G. First report of a highly damaged potato crop from Serbia caused by Meloidogyne incognita. Plant Dis. 2016, 100, 1021–1022. [Google Scholar] [CrossRef]
- Bačić, J.; Bosnić, D.; Samardžić, J.; Avdalović, R.; Mickovski Stefanović, V.; Tišma Kušić, J. Occurrence of root-knot nematode Meloidogyne arenaria in the potato field in Serbia. Ratar. Povrt. 2022, 59, 51–55. [Google Scholar] [CrossRef]
- Milovanović, N.; Petrović, V.; Oro, V. Status of Root-Knot Nematodes in Serbia. Bilj. Lek. 2017, 45, 415–424, (In Serbian with English abstract). [Google Scholar]
- Oro, V. The Root-Knot Nematodes on Root Vegetables. Bilj. Lek. 2020, 48, 636–645. [Google Scholar] [CrossRef]
- Bačić, J.; Kušić, J.; Strajnar, P.; Gerič Stare, B.; Širca, S. First Report of Meloidogyne arenaria on Calla (Zantedeschia aethiopica) in Serbia. In Proceedings of the Abstract Book of 7th International Congress of Nematology, Antibes Juan Les Pins, France, 1–6 May 2022; p. 527. [Google Scholar]
- Bačić, J.; Pavlović, M.; Kušić-Tišma, J.; Širca, S.; Theuerschuh, M.; Gerič Stare, B. First Report of the Root-Knot Nematode Meloidogyne luci on Tomato in Serbia. Plant Dis. 2023, 107, 2554. [Google Scholar] [CrossRef] [PubMed]
- Rehak Biondić, T.; Puškarić, J.; Gerič Stare, B.; Brmež, M. The status of root-knot nematodes of the Meloidogyne Genus in Croatia, with a special reference to the quarantine species. Poljoprivreda 2023, 29, 27–34. [Google Scholar] [CrossRef]
- Klindić, O. Vrste nematoda prouzrokovača korenovih guka–Meloidogyne spp. na području Južne Hercegovine. Zašt. Bilja 1968, 102, 411–430. (In Serbian) [Google Scholar]
- Nježić, B.; Mitrović, B.; Macanović, I.; Grujić, N.; Waeyenberge, L. Occurrence of the Northern Root-Knot Nematode in Republic of Srpska, Bosnia and Herzegovina. In Proceedings of the 31st International Symposium of the European Society of Nematologists, Adana, Turkey, 23–27 September 2012; p. 199. [Google Scholar]
- Krnjaić, D.J. Fitopatogene nematode u staklarama SR Makedonije. Zašt. Bilja 1977, 142, 429–433. (In Serbian) [Google Scholar]
- Dautova, M.; Gommers, F.J. Meloidogyne spp. In Macedonia: Distribution and virulence for Mi resistance in tomato. Nem. Medit. 2000, 28, 121–128. [Google Scholar]
- Širca, S.; Urek, G.; Karssen, G. The incidence of the root-knot nematode Meloidogyne incognita and Meloidogyne hapla in Slovenia. Acta Agric. Slov. 2004, 83, 15–22. [Google Scholar] [CrossRef]
- Širca, S.; Urek, G. Dissemination of the root knot nematodes, Meloidogyne spp. in Slovenia. Dissertationes 2004, 46, 161–170, ISNN 0352-5090. Available online: https://plus.cobiss.net/cobiss/ul/sl/bib/ul/22863917 (accessed on 26 January 2025).
- Pajović, I.; Bird, G.W.; Širca, S.; Urek, G.; Rajković, D.; Barši, L.; Radivojević, M. Meloidogyne (Nematoda: Heteroderidae) detected in greenhouses in Zeta-Bjelopavlići valley. Nat. Mont. 2010, 9, 913–925. [Google Scholar]
- Zeck, W.M. A rating scheme for field evaluation of root-knot infestations. Pflanzenschutz-Nachrichten Bayer 1971, 24, 141–144. [Google Scholar]
- Hartman, K.M.; Sasser, J.N. Identification of Meloidogyne Species on the Basis of Different Host Test and Perineal Pattern Morphology. In An Advanced Treatise on Meloidogyne: Methodology; Barker, K.R., Carter, C.C., Sasser, J.N., Eds.; Department of Plant Pathology, North Carolina State University: Raleigh, NC, USA, 1985; Volume 2, pp. 69–77. [Google Scholar]
- Karssen, G. The Plant-Parasitic Nematode Genus Meloidogyne Goldi, 1892 (Tylenchida) in Europe; Brill: Leiden, The Netherlands, 2002; p. 160. [Google Scholar]
- Adam, M.A.M.; Phillips, M.S.; Blok, V.C. Molecular diagnostic key for identification for single juveniles of seven common and economically important species of root-knot nematode (Meloidogyne spp.). Plant Pathol. 2007, 56, 190–197. [Google Scholar] [CrossRef]
- Wishart, J.; Phillips, M.S.; Blok, V.C. Ribosomal intergenic spacer: A polymerase chain reaction diagnostic for Meloidogyne chitwoodi, M. fallax, and M. hapla. Phytopathology 2002, 92, 884–892. [Google Scholar] [CrossRef] [PubMed]
- Powers, T.O.; Harris, T.S. A polymerase chain reaction method for identification of five mayor Meloidogyne species. J. Nematol. 1993, 25, 1–6. [Google Scholar] [PubMed]
- Gerič Stare, B.; Aydinli, G.; Devran, Z.; Mennan, S.; Strajnar, P.; Širca, S. Recognition of species belonging to Meloidogyne ethiopica group and development of a diagnostic method for its detection. Eur. J. Plant Pathol. 2019, 154, 621–633. [Google Scholar] [CrossRef]
- Maleita, C.; Cardoso, M.S.J.; Rusinque, L.; Estevez, I.; Abrantes, I. Species-Specific Molecular Detection of the Root-Knot Nematode Meloidogyne luci. Biology 2021, 10, 775. [Google Scholar] [CrossRef] [PubMed]
- Norton, D.C. Ecology of Plant-Parasitic Nematodes; Wiley-Interscience: New York, NY, USA, 1978; p. 268. [Google Scholar]
- Karssen, G.; Wesemael, W.; Moens, M. Root-knot nematodes. In Plant Nematology, 2nd ed.; Perry, R.N., Moens, M., Eds.; Oxon (CABI): Wallingford, UK, 2013; pp. 73–108. [Google Scholar]
- Wesemael, W.M.L.; Viaene, N.; Moens, M. Root-knot nematodes (Meloidogyne spp.) in Europe. Nematology 2011, 13, 3–16. [Google Scholar] [CrossRef]
- Archidona-Yuste, A.; Cantalapiedra-Navarrete, C.; Liébanas, G.; Rapoport, H.F.; Castillo, P.; Palomares-Rius, J. Diversity of root-knot nematodes of the genus Meloidogyne Göeldi, 1892 (Nematoda: Meloidogynidae) associated with olive plants and environmental cues regarding their distribution in southern Spain. PLoS ONE 2018, 13, e0198236. [Google Scholar] [CrossRef] [PubMed]
- Samaliev, H.Y.; Salkova, D.S.; Baycheva, O.T.; Zinovieva, S.V.; Udalova, Z.V. Investigations of the Root-Knot Nematodes of the Genus Meloidogyne (Göldi, 1887) on the Territories of Bulgaria and Russian Federation. Russ. J. Parasitol. 2018, 12, 94–98. [Google Scholar] [CrossRef]
- Boros, L.; Fanelli, E.; Sesan, E.T.; Dobrin, I.; Iacomi, B.; De Luka, F. Detection and characterization of root-knot nematodes (Meloidogyne spp.) associated with three host plants in Romania. Rom. Biotechnol. Lett. 2018, 23, 14097–14106. [Google Scholar] [CrossRef]
- Amin, A.W. Root-knot nematodes (Meloidogyne spp.) in Hungary. OEPP EPPO Bull. 1994, 24, 417–422. [Google Scholar] [CrossRef]
- Širca, S.; Urek, G.; Karssen, G. First report of the root-knot nematode Meloidogyne ethiopica on tomato in Slovenia. Plant Dis. 2004, 88, 680. [Google Scholar] [CrossRef] [PubMed]
- Conceição, I.L.; Tzortzakakis, E.A.; Gomes, P.; Abrantes, I.; Da Cunha, M.J. Detection of the root-knot nematode Meloidogyne ethiopica in Greece. Eur. J. Plant Pathol. 2012, 134, 451–457. [Google Scholar] [CrossRef]
- Maleita, C.M.; Simões, M.J.; Egas, C.; Curtis, R.H.C.; Abrantes, I.M.d.O. Biometrical, biochemical, and molecular diagnosis of Portuguese Meloidogyne hispanica isolates. Plant Dis. 2012, 96, 865–874. [Google Scholar] [CrossRef]
- Aydınlı, G.; Mennan, S.; Devran, Z.; Širca, S.; Urek, G. First report of the root-knot nematode Meloidogyne ethiopica on tomato and cucumber in Turkey. Plant Dis. 2013, 97, 1262. [Google Scholar] [CrossRef] [PubMed]
- Carneiro, R.M.; Correa, V.R.; Almeida, M.R.A.; Gomes, A.C.M.; Demi, A.M.; Castagnone-Sereno, P.; Karssen, G. Meloidogyne luci n. sp. (Nematoda: Meloidogynidae), a root-knot nematode parasitising different crops in Brazil, Chile and Iran. Nematology 2014, 16, 289–301. [Google Scholar] [CrossRef]
- Janssen, T.; Karssen, G.; Verhaeven, M.; Coyne, D.; Bert, W. Mitochondrial coding genome analysis of tropical root-knot nematodes (Meloidogyne) supports haplotype-based diagnostics and reveals evidence of recent reticulate evolution. Sci. Rep. 2016, 6, 22591. [Google Scholar] [CrossRef] [PubMed]
- Gerič Stare, B.; Strajnar, P.; Sušić, N.; Urek, G.; Širca, S. Reported populations of Meloidogyne ethiopica in Europe identified as Meloidogyne luci. Plant Dis. 2017, 101, 1627–1632. [Google Scholar] [CrossRef] [PubMed]
- Maleita, C.; Esteves, I.; Cardoso, J.M.S.; Cunha, M.J.; Carneiro, M.D.G.; Abrantes, I. Meloidogyne luci, a new root-knot nematode parasitizing potato in Portugal. Plant Pathol. 2018, 67, 366–376. [Google Scholar] [CrossRef]
- Rusinque, L.; Nobrega, F.; Cordeiro, L.; Serra, C.; Inácio, M.L. First detection of Meloidogyne luci (Nematoda: Meloidogynidae) parasitizing potato in the Azores, Portugal. Plants 2021, 10, 99. [Google Scholar] [CrossRef]
- Širca, S.; Gerič Stare, B.; Strajnar, P.; Knapič, M.; Žibrat, U.; Folcher, L.; Ollivier, F.; Buisson, A.; Chappe, A.M.; Inacio, M.L.; et al. Global Warming and Distribution of Root-Knot Nematode Species of the Tropical Group (MeloTrop). Available online: https://drop.euphresco.net/data/bdc46db0-344b-4b5e-bcd4-e25888588ec3 (accessed on 8 January 2025).
- Rusinque, L.; Camacho, M.J.; Serra, C.; Nobrega, F.; Inacio, M.L. Root-knot nematode assessment: Species identification, distribution, and new host records in Portugal. Front Plant Sci. 2023, 14, 1230968. [Google Scholar] [CrossRef]
- Strajnar, P.; Širca, S.; Knapič, M.; Urek, G. Effect of Slovenian climatic conditions on the development and survival of the root-knot nematode Meloidogyne ethiopica. Eur. J. Plant. Pathol. 2010, 129, 81–88. [Google Scholar] [CrossRef]
- Anonymous; NEM-EMERGE. An Integrated Set of Novel Approaches to Counter the Emergence and Proliferation of Invasive and Virulent Soil Borne Nematodes. Available online: https://nem-emerge.eu/project/work-packages/ (accessed on 8 January 2025).
- Hunt, D.J.; Handoo, Z.A. Taxonomy Identification and Principal Species. In Root-Knot Nematodes; Perry, R.N., Moens, M., Starr, J.L., Eds.; Oxon (CABI): Wallingford, UK, 2009; pp. 55–97. [Google Scholar] [CrossRef]
- Sušič, N.; Žibrat, V.; Sinkovič, L.; Vončina, A.; Razinger, J.; Knapič, M.; Sedlar, A.; Širca, S.; Gerič Stare, B. From Genome to Field-Observation of the Multimodal Nematicidal and Plant Growth-Promoting Effects of Bacillus firmus I-1582 on Tomatoes using Hyperspectral Remote Sensing. Plants 2020, 9, 592. [Google Scholar] [CrossRef] [PubMed]
- Abd-Elgawad, M.M.M. Understanding molecular plant-nematode interactions to develop alternative approaches for nematode control. Plants 2022, 11, 2141. [Google Scholar] [CrossRef]
- Širca, S.; Sušič, N.; Theuerechuh, M.; Gerič Stare, B. Successful Eradication the Root-Knot Nematode Meloidogyne luci. In Proceedings of the 16th Slovenian Conference on Plant Protection with International Participation, Bohinjska Bistrica, Slovenia, 5–6 March 2024; pp. 127–128. [Google Scholar]
Species | References |
---|---|
M. hapla | [10,13,14,17,18] |
M. arenaria | [10,11,13,16,19] |
M. naasi | [10,11,12] |
M. incognita | [11,13,14,15,17] |
M. incognita acrita | [11,13] |
M. javanica | [11,13] |
M. luci | [20] |
Cultivation Conditions | 2021 | 2022 | 2023 |
---|---|---|---|
Greenhouse | 28 | 48 | 30 |
Field | 55 | 29 | 51 |
Total per year | 83 | 77 | 81 |
Primer Name | Primer Sequences (5′-3′) | Target Species/Group of Species | Expected Fragment Length (bp) |
---|---|---|---|
194 | TTAACTTGCCAGATCGGACG | Meloidogyne spp. | 700—M. hapla 720—M. arenaria, M. incognita, M. javanica 780—M. mayaguensis 1600–1700—M. chitwoodi and M. fallax |
195 | TCTAATGAGCCGTACGC | ||
C2F3 | GGTCAATGTTCAGAAATTTGTGG | tropical root-knot nematode group | 621 |
Mt575 | AGAACTTAAACTCTAAATAAC | ||
Me309 | CTAATTTGGGTGAATTT | M. ethiopica group | 241 |
Me549R | AATCAAAATCTTCTCCT | ||
Mlf | ACTCCTGCGACCTCATGGCATTTA | M. luci | 770 |
Mlr | ACTCCTGCGAACACAACATTTACT | ||
Far | TCGGCGATAGAGGTAAATGAC | M. arenaria | 420 |
Rar | TCGGCGATAGACACTACAAACT | ||
Fjav | GGTGCGCGATTGAACTGACG | M. javanica | 720 |
Rjav | CAGGCCCTTCAGTGGAACTATAC | ||
MI-F | GTGAGGATTCAGCTCCCCCAG | M. incognita | 999 |
MI-R | ACGAGGAACATACTTCTCCGTCC | ||
JMV1 | GGATGGCGTGCTTTCAAC | M. hapla; M. chitwoodi; M. fallax and M. incognita | 540 |
JMV2 | TTTCCCCTTATGATGTTTACCC | 670 | |
JMV hapla | AAAAATCCCCTCGAAAAATCCACC | 440 | |
JMV tropical | GCKGGTAATTAAGCTGTCA | 615 |
Total Survey Area | Northern Serbia | Central Serbia | |
---|---|---|---|
Detection and identification (no. of samples) | 241 | 121 | 120 |
Meloidogyne spp. detected | 57 | 34 | 23 |
Meloidogyne spp. not detected | 184 | 87 | 97 |
M. arenaria | 3 | 2 | 1 |
M. incognita | 39 | 22 | 17 |
M. luci | 5 | 4 | 1 |
M. hapla | 8 | 6 | 2 |
M. hapla and M. javanica | 1 | 1 | 0 |
M. hapla and M. incognita | 1 | 0 | 1 |
Occurrence (%) | |||
Meloidogyne spp. detected | 23.7% | 28.1% | 19.2% |
Meloidogyne spp. not detected | 76.3% | 71.9% | 80.8% |
M. arenaria | 1.4% | 1.7% | 0.8% |
M. incognita | 16.2% | 18.2% | 14.1% |
M. luci | 2.1% | 1.7% | 0.8% |
M. hapla | 3.3% | 5.0% | 1.7% |
M. hapla and M. javanica | 0.4% | 0.8% | 0.8% |
M. hapla and M. incognita | 0.4% | 0.8% | 0.8% |
Absolute frequency (%) | |||
M. arenaria | 5.3% | 5.9% | 4.3% |
M. incognita | 68.4% | 64.7% | 73.9% |
M. luci | 8.8% | 11.8% | 4.3% |
M. hapla | 14.0% | 17.6% | 8.7% |
Relative frequency (%) | |||
M. arenaria | 5.5% | 5.9% | 4.8% |
M. incognita | 70.9% | 64.7% | 81.0% |
M. luci | 9.1% | 11.8% | 4.8% |
M. hapla | 14.5% | 17.6% | 9.5% |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Bačić, J.; Lalićević, I.; Širca, S.; Theuerschuh, M.; Susič, N.; Gerič Stare, B. Occurrence and Distribution of Root-Knot Nematodes Meloidogyne spp. in Serbia. Agronomy 2025, 15, 372. https://doi.org/10.3390/agronomy15020372
Bačić J, Lalićević I, Širca S, Theuerschuh M, Susič N, Gerič Stare B. Occurrence and Distribution of Root-Knot Nematodes Meloidogyne spp. in Serbia. Agronomy. 2025; 15(2):372. https://doi.org/10.3390/agronomy15020372
Chicago/Turabian StyleBačić, Jasmina, Ivana Lalićević, Saša Širca, Melita Theuerschuh, Nik Susič, and Barbara Gerič Stare. 2025. "Occurrence and Distribution of Root-Knot Nematodes Meloidogyne spp. in Serbia" Agronomy 15, no. 2: 372. https://doi.org/10.3390/agronomy15020372
APA StyleBačić, J., Lalićević, I., Širca, S., Theuerschuh, M., Susič, N., & Gerič Stare, B. (2025). Occurrence and Distribution of Root-Knot Nematodes Meloidogyne spp. in Serbia. Agronomy, 15(2), 372. https://doi.org/10.3390/agronomy15020372