Next Article in Journal
TomatoPoseNet: An Efficient Keypoint-Based 6D Pose Estimation Model for Non-Destructive Tomato Harvesting
Next Article in Special Issue
Ground Beetle Responses to Heavy Metal in Soils: Carabus coriaceus as an Ecological Indicator
Previous Article in Journal
Advances in Sorghum Improvement for Climate Resilience in the Global Arid and Semi-Arid Tropics: A Review
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Nickel-Induced Differential Expression of Metallothioneins and Phytochelatin Synthase 1 in Arabidopsis thaliana: Organ-Specific Responses

1
GreenUPorto—Centro de Investigação em Produção Agroalimentar Sustentável—Inov4Agro & Departamento de Biologia, Faculdade de Ciências, Universidade do Porto, 4169-007 Porto, Portugal
2
Departamento de Química e Bioquímica, Faculdade de Ciências, Universidade do Porto, Rua do Campo Alegre s/n, 4169-007 Porto, Portugal
3
CIQ-UP—Research Center in Chemistry, Departamento de Química e Bioquímica, Faculdade de Ciências, Universidade do Porto, Rua do Campo Alegre s/n, 4169-007 Porto, Portugal
*
Author to whom correspondence should be addressed.
Agronomy 2024, 14(12), 3026; https://doi.org/10.3390/agronomy14123026
Submission received: 31 October 2024 / Revised: 16 December 2024 / Accepted: 17 December 2024 / Published: 19 December 2024

Abstract

Metallothioneins (MTs) and phytochelatins (PCs) are small Cys-rich proteins with low molecular mass responsible for detoxifying heavy metals in cells. Arabidopsis thaliana expresses eight metallothionein genes and two types of PCS; however, there is still a need to acquire more knowledge regarding their individual responses to some heavy metals. Thus, it was intended to study the expression of AtMT- and AtPCS1-encoding genes in response to high levels of nickel in wild-type A. thaliana. Seeds of A. thaliana were placed in MS medium supplemented with increasing concentrations of Ni—0 mg L−1, 2.5 mg L−1, 5 mg L−1, 7.5 mg L−1, and 10 mg L−1. After 21 days of exposure, the expression of the AtMTs (1A, 1B, 1C, 2A, 2B, and 3) and AtPCS1 was analysed through RT-qPCR in different plant organs: roots, young leaves, and mature leaves. The concentrations of photosynthetic pigments, hydrogen peroxide, and reduced glutathione were also evaluated, but no significant changes were observed. The gene expression analysis showed that the seven genes reacted differentially to the varying concentrations of Ni and in an organ-specific way. It was noted that in roots, the expression of AtMT1A, AtMT1C, and AtMT3 increased starting with the 2.5 mg L−1 treatment. At the same time, the response in the leaves fluctuated more as AtMT1B and AtMT1C increased in young leaves with concentrations higher than 7.5 and 2.5 mg L−1, respectively, with the remaining genes analysed having their expressions decreased starting with 7.5 mg L−1 of Ni. In mature leaves, AtMT1A increased, while AtMT2A, AtMT2B, and AtPCS1 decreased with Ni concentrations starting from 7.5 mg L−1. These results strongly suggest that the increase in the expression of AtMT1B, AtMT1C, and AtMT3 in the roots significantly reduced Ni toxicity, contributing to its local accumulation and buffering its translocation to the shoots. The overall reduction in the expression of MTs and PCS1 in leaves may be linked to the active participation of MT1A in mature leaves, while young leaves depended on the increased production of MT1B and MT1C to deal with the high amount of Ni present therein. These results contribute further knowledge to the understanding of the defence mechanisms of plants against high levels of Ni regarding the participation of MTs and PCS1.

1. Introduction

The increase in world population, industrialisation, and urbanisation led to an increased accumulation of pollutants in the environment [1,2]. Environmental pollutants are toxic substances that can vary from metals, such as mercury (Hg), arsenic (As), cadmium (Cd), aluminium (Al), lead (Pb), and many others, to chemical substances, including pesticides, fungicides, and insecticides [3]. Soil pollution by heavy metals (HMs) is a significant issue due to their toxicity and persistence in ecosystems, as they are not degradable, accounting for a considerable portion of soil pollutants [4,5]. HM contamination has severely impacted agricultural lands, becoming an alarming environmental issue [1,2,4].
HMs are a heterogeneous group of elements with various chemical properties and are characterised by weighing more than 5 g mL−1. HMs are naturally present in the Earth’s crust; however, anthropogenic activities, for instance, mining, sewage, landfills, animal manure, and many others, are the main motive behind HM contamination in the ecosystems [6].
Despite some HMs being essential for most species, such as copper (Cu), nickel (Ni), iron (Fe), and zinc (Zn), since they are needed for catalytic and structural properties of many proteins, when present in a higher concentration than the required, they can become toxic and inhibit plant development. Once HMs are incorporated into plant systems, they contaminate the food chain, posing a significant risk to food quality and human health safety [4,7].
In plants, once absorbed, HMs can interact directly with several biochemical and physiological processes, such as the photosynthetic apparatus, modulating the donor site of enzymes involved in oxidation–reduction reactions and the enzymes involved in the Calvin cycle [8], but also deteriorate cell organelles and reduce plant growth [9]. HMs can bind, interfere with molecular targets, and compete for binding sites, altering cell metabolism or pathway signalling events [10].
As a pollutant, nickel is a threat to ecosystems and human health. It is a natural component of the soils and aquatic ecosystems in concentrations less than 100 and 0.005 mg kg−1, respectively [11]. It can be introduced into the environment by many anthropogenic activities, such as industries, combustion of fossil fuels, phosphatic fertilisers, sludge water, electroplating industries, and vehicle emissions [12].
Nickel is an essential trace metal for many species, and its deficiency or toxicity can occur when the organism is exposed to insufficient or excessive amounts of Ni, respectively [6]. Due to the increasing emissions of Ni into the ecosystems, its concentration in areas of anthropogenic development may become toxic to plants [13], reducing crop yield. This metal can also disrupt the uptake and metabolism of Fe, causing chlorosis and necrosis, inhibiting chlorophyll production and disrupting chloroplast structure [6]. Ni can affect morphology and inhibit photosynthesis, transpiration, mineral nutrition, and enzyme activity [11].
An essential process to maintain cellular homeostasis in plants is neutralising and sequestration of excessive free metal ions [14]. For that, plants use different types of organic molecules, including low molecular weight proteins and peptides, like metallothioneins (MTs) and phytochelatins (PCs) [15,16], which are responsible for capturing and binding free metal ions, decreasing their reactivity and solubility [14]. In the presence of HMs in the intracellular space, the production of MTs and PCs is induced [17]. MTs compose a gene-encoded protein family; PCs are enzymatically formed from glutathione [18].
MTs are cysteine- (Cys) rich proteins with a low molecular weight (4–14 kDa) [19]. This superfamily of evolutionarily conserved proteins binds HMs via the thiol groups of their Cys residues, and they have a wide range of functional roles [20]. However, the primary role of MTs is regulating cellular metal homeostasis and the ROS detoxification process, providing protection against HM toxicity and oxidative stress [17,19,21]. According to the distribution of the Cys residues in the amino- and carboxy-terminal regions, the MTs can be classified into four types: type I (MT1), type II (MT2), type III (MT3), and type IV (MT4) [22,23,24]. Previous studies have reported that the different MTs are varyingly expressed in plants: type I MTs are predominantly expressed in roots; type II MTs are mainly expressed in leaves; type III are expressed in leaves and ripening fruits; and type IV MTs were detected only in seeds [25].
Phytochelatins are small HM-binding peptides of different sizes synthesised by Phytochelatin Synthase (PCS; EC 2.3.2.15) from peptides originating from reduced glutathione (GSH) in a transpeptidation reaction [26]. Some authors state that PCS is constitutively expressed, with its activity depending on the presence of HMs [27]. Fan, Guo [28] overexpressed two Morus notabilis PCS genes in A. thaliana and tobacco and observed an increase in the tolerance to Zn or Cd stress.
One of the first consequences caused by HM toxicity is oxidative stress, which is triggered by the increased accumulation of ROS, such as hydrogen peroxide (H2O2), hydroxyl radical (•OH), and superoxide anion (•O2¯) [29,30]. Depending on the level of toxicity of the HM, the balance of ROS and cellular scavenging activities will vary since the metal ions trigger different reactions; for example, the Fenton reaction uses H2O2 in a Fe2+- and Cu+-catalysed reaction; the Haber–Weiss reaction induces the conversion of H2O2 and •O2 to •OH [31]. Plants have developed defence mechanisms to avoid oxidative stress, removing ROS and maintaining antioxidant defence compounds. Non-enzymatic antioxidants, including GSH and carotenoids, and enzymatic antioxidants, such as catalase and glutathione peroxidase, scavenge ROS to protect plants from oxidative damage [32,33].
Carotenoids are present in high quantities in chloroplasts and chromoplasts. These pigments are effective antioxidants that depend on their interaction with other co-antioxidants [34,35]. GSH is a critical intracellular defence mechanism against ROS-induced oxidative damage in plants. Its reduced form is present in plant tissues and can be localised in various cell compartments and the apoplast. This metabolite has an essential role in various physiological pathways, for example, regulation of sulphate transport, signal transduction, detoxification of xenobiotics, and the expression of stress-responsive genes [29,36].
A. thaliana is a eudicot species from the Brassicaceae family, along with mustard and cabbages, and it has become the most used model organism for studying plants’ physiological and molecular aspects [37]. The genome sequencing of A. thaliana allowed the identification and annotation of eight different and active MT-encoding genes (AtMTs) representing the four types. These are three genes for type I—MT1A (AT1G07600), MT1B (AT5G56795), and MT1C (AT1G07610) and two for type II—MT2A (AT3G09390) and MT2B (AT5G02380); only one MT has been identified as type II—MT3 (AT3G15353); and two sequences have the characteristics of type IV MTs—MT4A (AT2G42000) and MT4B (AT2G23240) [38,39,40].
In A. thaliana are known two genes encoding PCS, AtPCS1 (AT5G44070) [41] and AtPCS2 (AT1G03980), which are induced when the plant is exposed to HM’s stress, such as Cd, Ni, Cu, Zn, among others [42]. Both forms have a great homology to each other, but AtPCS1 is the most predominant and has higher activity [43].
The impact of high quantities of HM in the soil on plants has been studied using A. thaliana as a model organism, revealing an active participation of MTs in response to such stress conditions. Still, unfortunately, they were performed with small exposure periods to such stresses, such as 5–7 days, which do not reflect a natural situation: if the plants were to grow throughout their whole life cycle exposed to high levels of HMs.
Specifically, regarding MTs and PCs’ roles in plants’ (and, in particular, A. thaliana’s) physiology and HM distribution, homeostasis, and tolerance, it is possible to realise that many gaps in this knowledge need further investigation, especially in an organ-specific approach. These include the organ-specific response of the MT gene family to prolonged exposure to HMs, the lack of knowledge regarding their redundancy, and if (and/or which) MTs are transported within the plant body.
This study aimed to understand the effect of Ni in the development of A. thaliana, in its physiology, and in the organ-specific expression of AtPCS1 and the individual MT gene family members from types I, II, and III. The expression of six MT- and PCS1-encoding genes was analysed through RT-qPCR in different wild-type A. thaliana organs, roots, young leaves, and mature leaves, to understand the differences between the expression of these genes in various parts of the plants and the response to the long-term exposure to increasing concentrations of Ni. Some parameters regarding the oxidative stress of the plants in response to the increasing concentrations of Ni were also pursued, including photosynthetic pigments, H2O2, and GSH, to determine the degree of the imposed stress and to learn more about the plants’ responses to this situation.

2. Materials and Methods

2.1. Plant Material, Growth Conditions, and Stress Treatment

Wild-type (WT) Arabidopsis thaliana (Col-0 ecotype) was germinated in full-strength Murashige & Skoog (MS) medium, containing 0.1% 2-(N-Morpholino) ethanesulfonic acid (MES), 1% (w/v) sucrose, and 1.8% (w/v) agar (pH = 5.8). For the stress treatments, increasing concentrations of Ni (0 mg L−1; 2.5 mg L−1; 5 mg L−1; 7.5 mg L−1; 10 mg L−1) were added directly to the medium before autoclaving as NiSO4.6H2O. The seeds were disinfected by incubating in 1 mL of 70% ethanol for 5 min before being evenly placed in the MS medium. The plates were placed in the dark at 4 °C for 48 h to break the seed dormancy and to synchronise the germination and then transferred to a growth chamber with a long day photoperiod (16 h light and 8 h dark) at 21 °C with 50–60% relative humidity and light intensity at 180 μmol m−2 s−1.
The biological samples of roots (Rs) and young (YL) and mature leaves (ML) were retrieved 21 days after germination and maintained at −80 °C until needed. Shoot and root samples were dried at 65 °C for future Ni quantification.

2.2. RNA Isolation and cDNA Synthesis

For the RNA extraction, the “TripleXtractor” reagent (GRiSP, Research Solutions, Portugal) was used following the protocol provided by the manufacturer. The RNA was dissolved in sterile deionised H2O, kept on ice until quantified, and stored at −80 °C.
To quantify and determine the purity of the RNA extracted, the DS-11+Spectrophotometer (DeNovix) was used. To verify the integrity of the RNA extracted, the presence of the 25S and 18S rRNA bands was evaluated in a 0.8% (w/v) agarose gel in 1x SB buffer.
The Xpert cDNA Synthesis Supermix (Grisp Research Solutions, Research Solutions, Portugal) was used for cDNA synthesis according to the manufacturer’s instructions and using 1 µg of total RNA. The cDNAs were placed at −20 °C and thawed over ice when needed.

2.3. Primer Design and Selection for qPCR Analysis

Specific primer pairs were designed for each gene to study the expression of the 6 different MTs of types I, II, and III. Type IV MTs were excluded because these are only found in seeds. For this, an initial aligning of the sequences of all mRNAs was done using Clustal Omega; the results were obtained in the format Pearson/FASTA [44]. With this outcome and using the PrimerIdent online tool, the primers with the strongest complementarity to the sequence of interest and the weakest complementarity to the other sequences were chosen [45]. The following settings were considered: primer size, minimum 18 bp and maximum 24 bp; primer Tm, minimum of 50 °C and maximum of 60 °C; primer GC%, minimum of 45 and maximum of 55; no CG clamp; Max Complementarity, self: 5.00, 3′selft: 3.00. With the output of PrimerIdent, the selected primers were tested in Primer3, where the settings used were the default, except “50–150” for the product size range was included. The primers were manufactured by STAB VIDA, LDA (Portugal) and are depicted in Table 1.

2.4. RT-qPCR Analysis

The Master Mixes used for the RT-qPCR assays were “iTaq Universal SYBR Green Supermix” (Bio-Rad, Algés, Portugal) for the YL and Rs and the “GreenHot Master Mix” (BIORON, Romemberg, Germany) for the ML. For the study of the gene expression of each MT- and PCS1-encoding gene, 3 biological replicates were made, and for each biological replicate, 3 technical replicates were performed, including the NTCs (No Template Controls). For each reaction, in a 10 µL final volume, 4 µL of 1:10 diluted cDNA, and 6 µL of a mixture containing 5 µL of the 2x Master Mix, 0.3 µL of each 10 µM primer, and 0.4 µL of sterile and deionised H2O were mixed.
The plate was placed in a Bio-Rad CFX96 thermocycler, and the protocol used was the one recommended by the respective manufacturer: for YL and Rs, 30 s at 95 °C; 40 cycles of 5 min at 95 °C, 30 min at 60 °C; and for the ML, 93 °C for 3 min, 40 cycles of 95 °C for 10 s, Ta for 10 s and 72 °C for 45 s. To determine the melting curve, a cycle of 5 s at 65 °C and increased temperature until 95 °C, increasing 0.5 °C every 5 s was added to the end of the reaction.
The reference genes (Table 1) used for YL and ML were the SAND family (SAND-AT2G28390), actin 2 (ACT2-AT3G18780), and the yellow-leaf-specific gene 8 (YLS8-AT5G08290); for the Rs, the last two were used.

2.5. Biochemical Parameters

2.5.1. Quantification of H2O2

The H2O2 was quantified according to Alves, Ribeiro [51]. Two hundred mg of the aerial part (AP) and Rs was collected. The samples were homogenised with 1.2 mL of phosphate buffer 50 mM pH 6.5, with the help of quartz sand over ice. The extract was transferred to a 2 mL tube and centrifuged at 6500× g for 20 min at 6 °C. Afterwards, 500 µL of the supernatant was later transferred to a new 2 mL tube, to which was added 500 µL of titanium sulphate 0.1% (w/v) in sulphuric acid 20% (w/v) to obtain a 1:1 mix with a final volume of 1 mL. This was later centrifuged at 6000× g for 15 min at 6 °C, and the supernatant was saved for the Abs readings at 410 nm, using a glass cuvette in the DS-C Cuvette Spectrophotometer (DeNovix, Wilmington, DE, USA). The readings were done over a blank of 1:1 phosphate buffer and titanium sulphate. The H2O2 quantity was expressed in nmol g−1 of fresh weight (FW) using a molar extinction coefficient of 0.28 mM−1 cm−1 [51].

2.5.2. Extraction and Quantification of Photosynthetic Pigments

YL and ML were used for this, and 50 mg of biological material was homogenised with 80% acetone in a final volume of 5 mL (2 mL + 2 mL + 1 mL) with the help of quartz sand. Between each homogenisation step, the sample was transferred to a 15 mL tube and protected from light. Then, the tubes were centrifuged at 1000× g for 10 min, from which the supernatant was transferred to a new 15 mL tube. The final volume was adjusted to 10 mL with 80% acetone and mixed by inversion. In the DS-C Cuvette Spectrophotometer (DeNovix) and using a glass cuvette, the Abs was obtained for the following wavelengths: 480 nm, 495 nm, 645 nm, and 655 nm.
Equations (1) and (2) were used to correct the influence of the chlorophylls and other pigments in the samples on the 480 nm and 495 nm wavelengths. In these equations, Abs° (480 nm) and Abs° (495 nm) represent the values obtained from measuring the samples:
A b s 480 n m   c o r r e c t e d = A b s °   ( 480   n m ) 0.566 × A b s   ( 645   n m ) + 0.121 × A b s   ( 655   n m ) ;
A b s 495 n m   c o r r e c t e d = A b s °   ( 495   n m ) 0.112 × A b s   ( 645   n m ) 0.0036 × A b s   ( 655   n m ) .
The contents of the different photosynthetic pigments were expressed in mg L−1: chlorophyll A (Chla) (3), chlorophyll B (Chlb) (4), ß-carotene (ß-car) (5), and e lutein (Lut) (6):
[ C h l a ]   ( m g / L ) = 19.00 × A b s   ( 655   n m ) 7.61 × A b s   ( 645   n m ) ;
[ C h l b ]   ( m g / L ) = 21.45 × A b s   ( 645   n m ) 5.92 × A b s   ( 655   n m ) ;
[ ß c a r ]   ( m g / L ) = 17.16 × A b s   ( 495   n m ) 3.96 × A b s   ( 480   n m ) ;
[ L u t ]   ( m g / L ) = 11.51 × A b s   ( 480   n m ) 20.61 × A b s   ( 495   n m )
The final calculations for each pigment were determined and expressed in mg g−1 FW [52].

2.5.3. Quantification of Reduced Glutathione (GSH)

The biological material, AP and Rs, was homogenised using quartz sand and 1 mL of 3% sulfosalicylic acid (w/v) for each 100 mg of tissue. The extract was transferred to a 2 mL tube and incubated in ice for 10 min. Afterwards, it was centrifuged at 10,000× g for 10 min at 6 °C, and the supernatant was transferred to a new tube and kept in ice. The GSH standards were prepared for a final volume of 100 µL from a concentrated solution of 1 mM of GSH in 3% sulfosalicylic acid (w/v) through its dilution to 0, 40, 60, 80, and 100 µM. Seven hundred and fifty µL of the working solution, which consisted of 14 mL of 1 mM ethylenediaminetetraacetic acid (EDTA) in 100 mM phosphate buffer (pH 7.0), was mixed with 400 µL of 1.5 mg mL−1 Ellman’s Reagent (5,5-dithiol-bis-(2-nitrobenzoic acid) (DTNB)) in DMSO, 200 µL of H2O, and 50 µL of the sample’s supernatant or the GSH standard. These solutions were mixed by inversion and placed in obscurity for 10 min at RT; then, the readings were done at 412 nm. A standard curve was obtained from the standard solutions, which made it possible to calculate the GSH concentrations in nmol g−1 of FW [53].

2.6. Quantification of Ni Accumulated

In a microwave digestor, 0.25 g of the ground dried sample, 4 mL of concentrated nitric acid (HNO3), and 2 mL of 30% H2O2 were used for tissue solubilisation. The program used was 2 min at 400 W, 2 min at 600 W, and 700 W for 20 min, and then cooling for 10 min. The resulting solution was transferred to a 20 mL volumetric flask and completed with ultrapure water. Electrothermal atomic absorption spectroscopy was used to determine the total content of Ni. The pyrolysis and atomisation temperatures used were 1500 °C and 2300 °C. Total Ni values were expressed as mg g−1 dry weight in tissues.

2.7. Biometric Parameters

MS culture medium was prepared, with and without the different concentrations of Ni previously mentioned, and poured into a square petri dish. The surface-disinfected seeds were placed in two horizontal lines and evenly spread. The plates were placed for 48 h at 4 °C before being transferred to the growth chamber. The plates were kept at a 70° angle in the growth chamber so the roots could grow vertically.
Pictures of the plates were captured weekly, and 21 days post-germination, the leaf area of ML and YL and the R length were measured. Photos of the leaves were captured using a magnifying glass and the program Motic Image Plus 2.0 (https://www.motic.com/Eur_EuropeDownload/). The final images of the leaves and those of the Rs were analysed using Image J [54].

2.8. Statistical Analysis

A minimum of 3 biological replicates (n ≥ 3) were used for all assays, with 3 technical replicates each. The results were expressed as mean ± standard deviation (SD). Significant differences were monitored through a one-way ANOVA followed by Dunnett’s multiple comparison tests with C as the control group using the program GraphPad Prism 8.0 (GraphPad Software Inc., Chicago, IL, USA). The statistical outcomes and the ANOVA tables are provided in the Supplementary Material. The RT-qPCR results were first analysed in the Bio-Rad CFX Maestro 2.0 program before being analysed by GraphPad Prism 8.0 software.

3. Results

3.1. RT-qPCR

Gene Expression Study of the MTs and PCS1

As depicted in Figure 1, which refers to YL, AtMT1A showed a significant decrease in its expression with increases in Ni concentration of 22.04%, 46.1%, 71.34%, and 79.13%, respectively (Figure 1A). AtMT1B (Figure 1B) and AtMT1C (Figure 1C) displayed an increase in their expression with high Ni levels, with AtMT1B having significant increases in plants exposed to 7.5 mg L−1 and 10 mg L−1 of Ni by 117.4% and 84.62%, respectively; AtMT1C had significant increases in expression in plants exposed to 2.5 mg L−1 Ni, of 169.6%, and 10 mg L−1 Ni, of 173.4%. Both type II MTs showed a significant decrease in their expression in the two highest concentrations, but only AtMT2A (Figure 1D) displayed the same significant result at 5 mg L−1. The reductions in the AtMT2A were 43.85%, 59.19%, and 52.12% in 5 mg L−1 to 10 mg L−1 of Ni, respectively. The second type II MT, AtMT2B (Figure 1E), showed a significant decrease in both situations: 49.25% and 44.91%, respectively. MT3 (Figure 1F) had a similar response as AtMT2B, in which they both had a significant reduction in expression in the two highest concentrations. However, the type III MT decrease was 29.30% in 7.5 mg L−1 and 50.08% in 10 mg L−1. Ultimately, AtPCS1 (Figure 1G demonstrated significant decreases of 71.9% and 88.8% in 7.5 and 10 mg L−1, respectively.
Overall, in ML, the expression of the different MT- and PCS1-encoding genes decreased with the highest concentrations (Figure 2), especially the types I, II, and III. Regarding type I, only AtMT1A (Figure 2A) showed a significant reduction in its expression in the two highest concentrations of 75.28% and 71.77%, respectively. On the other hand, both AtMT2A (Figure 2D) and AtMT2B (Figure 2E) had a decrease in their expression in plants exposed to 7.5 mg L−1, 82.81% and 81.26%, respectively, but only AtMT2A had a reduction in the highest concentration of Ni of 65.29%. There was a reduction in the gene expression in AtMT3 with the increasing Ni concentrations used, but it was not considered significant. AtPCS1 expression (Figure 2G in ML of plants exposed to concentrations of 7.5 and 10 mg L−1 Ni decreased by 79.5% and 90.9%, respectively.
Within the type I MTs, only AtMT1A and AtMT1C showed significant increases in their expression in roots exposed to the different concentrations of Ni. The expression of the AtMT1A (Figure 3A) gene seems to be almost linear with the increase of the Ni concentration, but in 5 mg L−1 of Ni, there was a slight decrease compared to the previous concentration. Nevertheless, this gene showed significant increases in expression of 264.3%, 206.9%, 378.2%, and 421.4%, from the lowest to the highest concentration of Ni. The increase in expression of the AtMT1C (Figure 3C) gene was significant in every concentration of Ni, and a pattern was visible in which the increases in expression in the concentrations of 2.5 and 7.5 mg L−1 of Ni were followed by slight decreases in the concentrations of 5 and 10 mg L−1, respectively. This gene also had the highest increase in expression in all concentrations when compared to the rest of the MTs in this part of the plant, of 673%, 419.7%, 700.4%, and 342.5%, respectively. Interestingly, the type II MTs did not suffer any significant alterations in the roots, even though they seemed to have an increase in expression. On the other hand, AtMT3 (Figure 3F) only had a significant increase in the lowest concentration of Ni, 2.5 mg L−1. AtPCS1 (Figure 3G did not show any significant change, although there appears to be an increase in expression in the concentration of 10 mg L−1 of Ni.

3.2. Effect of the Increasing Concentrations of Ni in the Accumulation of This HM

The levels of Ni were determined in the AP and Rs in plants exposed to the highest concentration of this HM, 10 mg L−1 of Ni. The results revealed significant increases in Ni levels in roots and shoots by 84.7- and 87.2-fold, respectively (Figure 4). The translocation factor for Ni also increased with the increased Ni concentration, from 1.28 in the control situation to 1.32 in the Ni treatment.

3.3. Biochemical Parameters

3.3.1. Effect of the Increasing Concentrations of Ni in the H2O2 Levels

The levels of H2O2 were measured in the AP and the Rs (Figure 5).
The results were not considered significant, but a tendency for the AP’s H2O2 levels to decrease and the R’s to increase with the increasing Ni concentration was noticeable (Figure 5A and B, respectively).

3.3.2. Effect of the Increasing Concentrations of Ni in the Photosynthetic Pigment’s Levels

The levels of the photosynthetic pigments were analysed for YL and ML, and the results obtained are displayed in Figure 6.
In YL, the variations in chlorophyll a and b, β-carotene, and lutein levels were not considered significant. Similar results were obtained for ML.

3.3.3. Effect of the Increasing Concentrations of Ni on the GSH Levels

The concentration of GSH was measured in the AP and Rs. The results revealed no significant changes with the plants exposed to the different Ni concentrations. However, it was possible to visualise a similar pattern to that of the concentration of H2O2—with the increase in Ni concentration, the GSH quantity decreased in the AP and increased in Rs (Figure 7).

3.4. Effect of the Increasing Concentrations of Ni in Biometric Parameters

No significant alterations in the biometrical parameters were obtained, especially in the YL’s area (Figure 8). Still, a tendency for the ML’s area to increase with the increasing Ni concentrations could be noticed.
Similarly to the foliar area, the root length did not suffer significant alterations (Figure 9).

4. Discussion

Nickel is an essential micronutrient that, in high quantities, becomes toxic to plants. Therefore, the need to understand how Ni toxicity affects living organisms has increased throughout the years.
So far, most of the research on the impact of Ni in plants has focused on the oxidative response [33]. However, one of the defence mechanisms against HMs has been overlooked, MTs and PCs, and so, in this study, the understanding of how Ni influences the expression of the PCS1- and MT-encoding genes in a dosage- and organ-specific way was pursued.
In this work, the seedlings were grown in contact with increasing concentrations of Ni to mimic the conditions plants would be exposed to if grown in a Ni-contaminated environment, as plants would be exposed to such environmental conditions since seed germination. A study by Renella, Chaudri, and Brookes [55], regarding the effects of HMs on the soil microbial biomass, confirmed that short-term exposure to HMs cannot be used to predict the impact of long-term field exposure. Therefore, the use of the results of the short-term assays might be unpredictable and have low similarity to the long-term effects observed in the field [56], but also, the acclimation time in the short-term experiments may not be representative of the interactions in long-term events [57]. These reports led to the decision to grow plants longer; the plants were exposed to Ni from seed germination until 21 days post-germination.
According to the RT-qPCR, using cDNA from YL of plants exposed to increasing concentrations of Ni, a decrease in the expression of AtMT1A, AtMT2A, AtMT2B, AtMT3, and AtPCS1 was detected, and AtMT1B and AtMT1C showed an increase in their expression. AtMT1A was the only gene to be impacted significantly by the four higher concentrations of Ni, revealing itself to be down-regulated by this HM. AtMT2A was down-regulated by the three highest concentrations, and the expression of AtMT2B, AtMT3, and AtPCS1 was impacted by 7.5 and 10 mg L−1 Ni. These results indicate that these genes are differentially regulated by the Ni dosage in YL, with the highest concentrations exerting a negative effect on most genes, except for AtMT1B and AtMT1C, whose gene expression increased, as their corresponding products may be necessary for controlling the high Ni levels reaching the YL.
When using the cDNA from ML, AtMT2A, AtMT2B, and AtPCS1 showed a reduction in expression, while AtMT1A expression increased in plants exposed to concentrations equal to and higher than 7.5 mg L−1 Ni. These results show that ML and YL behaved differently when responding to high Ni levels, as ML suffered fewer changes in MT gene expression than YL. This may be because these leaves would be on the onset of the senescence period, and the organ would not need to spend resources protecting it from such Ni levels. Nevertheless, the down-regulated genes, the same as in YL, were AtMT2A, AtMT2B, and AtPCS1, revealing a shared down-regulation pattern of Ni in leaves for these genes.
Contrary to what happened in the leaves, in the Rs, the expression of AtMT1A, AtMT1C, and AtMT3 significantly increased when exposed to Ni, thus indicating their responsiveness and participation in Ni chelation and homeostasis in Rs. While the type I MTs were impacted by the four concentrations of Ni, the type III MTs had a more significant reaction in the lowest concentration, 2.5 mg L−1 Ni. This reinforces the importance of type I MTs in controlling the high Ni levels in a concentration-independent way. In contrast, type III may be more predominant at lower concentrations. No variations in type II MTs and AtPCS1 gene expression were detected in any situation, suggesting that these gene members do not play a significant role in Ni homeostasis in Rs, similar to what happened in leaves. Thus, this MT sub-family and PCS1 do not participate in Ni homeostasis at the whole plant level.
When studying the expression of AtMTs and AtPCS1, most studies do not differentiate between the leaves’ developmental stages since the plant is usually used as a whole [17,46]. Still, sometimes, a separation between shoots and Rs is done [19,58]. The present study is, therefore, a pioneer as it dissects the aboveground organs into YL and ML and studies their specific responses to high Ni levels. Also, it acts as an alert for other studies (already or to be performed) that their corresponding conclusions may be dubious, as they do not explore which part of the shoot accounts more for such results.
Unfortunately, little research has been done regarding the impact of Ni in plants and the expression of the MT gene family and PCS1. Kim and Kang [46] stated that when exposing 2-week-old A. thaliana to 100 μM Ni for 24 h, MT1A, MT1C, MT2A, MT2B, and MT3 showed a reduction in their transcript levels, although no alterations were noted in MT4A and MT4B. Since the authors did not differentiate the tissues and used the whole plant, and due to the weight of the different organs, the ratio between the quantity of shoots and roots was uneven, resulting in a higher concentration of RNA from leaves. Contrarily, Jaskulak, Rorat [59] stated that in the shoots of Lupinus luteus exposed to 360 and 720 mg kg−1 of Ni, there was an increase in the expression of MTs. Even though the plants used in both studies are different, these contradictory results further suggest the need to study the effect Ni has on plants and the expression of these genes in an organ-specific way. In the case of PCS1 expression, according to our research, at the time of publishing, there is no information about its expression when the plant is under Ni stress, and further studies are needed to understand this response better.
Because the root is the first organ to contact the HM stress, the increase in MT gene expression was due to the need for these organs to protect themselves from such high HM doses. However, their response to the different concentrations is yet to be understood since, in most studies, with the increase in concentration of the HM, the MT’s and the PCS1 gene expression would progressively either increase or decrease. The decrease in the MTs and PCS1 observed in this study in the leaves could potentially be related to their translocation within the plant from Rs to shoots, particularly of MT1A, MT1C, and MT3, which have their expression enhanced in Rs in response to Ni and may be transporting it to the shoots as a mechanism to lower the Ni content in Rs.
After the HM is accumulated in the plant, its toxicity can be deduced depending on whether the HM can be redox active or redox inactive. Ni is a redox inactive metal that causes indirect oxidative stress mechanisms by interacting with the antioxidant defence system, disrupting electron transport chains, and inducing lipid peroxidation [8].
When the concentration of Ni in shoots and roots was analysed in plants exposed to the highest concentration of Ni, an exponential increase in the accumulation of this HM was noted. These results could be linked to the increase in expression of AtMT1A and AtMT1C in the Rs of A. thaliana exposed to 10 mg L−1 of Ni since these proteins bind HM, preventing its impacts. The increase in accumulation in the shoots could justify the increase in expression of AtMT1A in the ML and AtMT1B and AtMT1C in the YL. Such results highlight the importance of the type I MTs in response to Ni in A. thaliana.
The quantification of H2O2 showed that when A. thaliana was exposed to different concentrations of Ni, it tended to decrease in the shoots and increase in the Rs, although with no statistical significance. Similarly, Boominathan and Doran [60] noted that H2O2 levels in Alyssum bertolonii and Nicotiana tabacum’s Rs increased when exposed to Ni. However, when growing Oryza sativa exposed to different concentrations of Ni, Maheshwari and Dubey [61] noticed that the H2O2 levels in the shoots suffered a higher increase than in the Rs. Previous studies have shown that this ROS molecule is involved in stress signalling pathways, which can activate several defence response mechanisms [29,30]. So, the increased quantities of H2O2 in the Rs result from Ni accumulated in this organ. However, they were not significant due to Ni chelation by MT1A, MT1C, and MT3.
Because the variations in the concentration of H2O2 were not significant in this study, it may also suggest an active participation of the antioxidant defence mechanism. Resembling the H2O2 levels, the quantification of GSH showed that with the increase in the provided Ni, the quantity of GSH decreased in the shoots and increased in the Rs. GSH is an essential metabolite in plants since it is considered a crucial intracellular defence against ROS-induced oxidative damage and plays an essential role in the antioxidant defence mechanism [29,62]. Since the R is the first organ to contact the HM stress, this could explain the observed tendency for the GSH levels to increase. The patterns for H2O2 and GSH levels obtained in this study were expected, as the first molecule is responsible for signalling oxidative stress, and the latter is one of the main antioxidant defence mechanisms [29]. When studying Cd tolerance of two populations of Sedum alfredii, Sun, Ye [62] noted an increase in GSH in the leaves and stems of the plant, and Rs. Kukkola, Rautio, and Huttunen [63] noticed that Ni caused more oxidative stress than Cu to Pinus sylvestris seedlings as the GSH levels were higher in plants treated with Ni. In the Ni hyperaccumulator Thlaspi goesingense, it has been reported that elevated quantities of GSH provide tolerance to Ni-induced oxidative stress [64].
The concentration of the analysed photosynthetic pigments did not vary significantly in either YL or ML of the plants exposed to the increasing concentrations of Ni. Lutein was negatively impacted by 2.5 and 5 mg L−1 of Ni in ML and YL, respectively. Chlorophylls and carotenoids play an essential role in photosynthesis. HM can affect their biosynthesis; therefore, chlorosis and the reduction in the accumulation of the different photosynthetic pigments are frequently associated with HM-induced stresses [65]. The research regarding the impact of Ni in A. thaliana is in an early stage, so there are few results to compare. Similarly to the present results, after exposing Psidium guajava to rising concentrations of Ni, total chlorophyll content in fully expanded leaves did not differ between treated and control plants. Still, the concentrations of carotenoids in leaves increased with increasing Ni2+ concentrations [66]. It would be interesting to evaluate these pigments’ biosynthetic pathways to understand their content in response to the growing concentrations of Ni supplied.
Since it has been shown that HMs can affect the growth and development of plants, the foliar area and the R length were measured. Even though no significant alterations were noted, because Ni tends to accumulate in the Rs, the growth of this organ is usually more affected by the HM than the AP [10]. Shukla and Gopal [67] exposed Solanum tuberosum to increasing concentrations of Ni (0.05, 0.1, 0.2, 0.3, 0.4, and 0.5 mM) and reported a reduction in the biomass and the growth of APs and Rs. Overall, when most plants are exposed to Ni, the biomass tends to decrease [65,66,68]. However, the opposite of what was expected in plants exposed to Ni happened in this study, as no changes were observed, suggesting that Arabidopsis plants could protect themselves from the high Ni levels to which they were exposed.
It is known that in addition to their role as HM chelators, MTs can also act as antioxidants [20]. So, it is very likely that MTs played a crucial role in protecting Arabidopsis from the toxic effects that may result from exposure to high levels of Ni. First, by chelating its excess, they prevent it from interacting with other biomolecules, decreasing the chances of ROS being overproduced; second, by acting as antioxidants, they contribute to the cell survival by controlling the surplus of ROS that may be produced by the interactions of the non-chelated Ni with other biomolecules. Therefore, because no changes were observed in the analysed parameters (biometry and H2O2, GSH, and pigment levels), this suggests that the specific participation of some types of MTs was fundamental to avoid (oxidative) stress resulting from excess free Ni in the cell. Other HM defence mechanisms not analysed in this study may also be involved in Ni tolerance, such as citric acid, since it has been previously described as an essential chelator for Ni transport in several hyperaccumulating plant species [69,70,71].

5. Conclusions

This study helped us to understand how the increasing concentrations of Ni, 2.5 mg L−1, 5 mg L−1, 7.5 mg L−1, and 10 mg L−1, influenced the defence mechanisms of A. thaliana, with a particular focus on the gene expression of MTs and PCS1, plus the oxidative stress-related endpoints, H2O2, photosynthetic pigments, and GSH levels in WT plants.
Regarding the gene expression of AtMTs and AtPCS1, the seven genes reacted differentially to the increasing concentrations of Ni. Some genes’ expression increased in the Rs: AtMT1A, AtMT1C, and AtMT3, while the others remained unchanged; the response in the leaves was more fluctuating, as in YL, some increased, AtMT1B and AtMT1C in YL, and others decreased, AtMT1A, AtMT2A, AtMT2B, AtMT3, and AtPCS1, while in ML, AtMT1A and AtMT1A increased, while AtMT2A, AtMT2B, and AtPCS1 decreased. This shows that the effect of the different concentrations of Ni varied for each gene and depended on the Ni concentration and the organ.
Exposing the seedlings to the HM stress from germination until 21 days allowed us to study the plants’ reactions as if grown in a polluted environment, making the retrieved data more relevant to what happens in a natural situation.
As the main conclusion, the increase in the expression of AtMT1A, AtMT1C, and AtMT3 in the Rs, of AtMT1A in ML, and of AtMT1B and AtMT1C in YL reduced Ni toxicity, resulting in no damage to the plants. AtPCS1 expression was down-regulated by Ni in leaves, suggesting a lesser relevance in these organs’ response. This data can be used in future plant improvements to produce more tolerant crops to HMs, for biofortification purposes, or to increase phytoremediation capacities in several species of interest.
Since the research regarding the impact of Ni in A. thaliana is at an early stage, further research, coupled with the results obtained in this study, could be beneficial for understanding the plants’ defence mechanisms against this HM.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/agronomy14123026/s1, Table S1: Relative normalized expression values and respective p-value for AtMT1A, AtMT1B, AtMT1C, AtMT2A, AtMT2B, AtMT3, and AtPCS1 in young leaves, mature leaves and roots of plants exposed to increasing supplementing concentrations of Ni—2.5, 5, 7.5, 10 mg L−1. The p-values correspond to the difference between each value obtained for each treatment and the control (0 mg/L), through a one-way ANOVA followed by Dunnett’s multiple comparison test. Table S2: Ni levels, in mg/g DW, and respective p-value in aerial part and roots of plants exposed to a Ni concentration of 10 mg L−1. The p-values correspond to the difference between each value obtained for each treatment and the control (0 mg/L), through a one-way ANOVA followed by Dunnett’s multiple comparison test. Table S3: H2O2 and GSH levels, in nmol/g FW, and respective p-value in aerial part and roots of plants exposed to increasing supplementing concentrations of Ni—2.5, 5, 7.5, 10 mg L−1. The p-values correspond to the difference between each value obtained for each treatment and the control (0 mg/L), through a one-way ANOVA followed by Dunnett’s multiple comparison test. Table S4: Photosynthetic pigment’s levels—chlorophyll a, chlorophyll b, lutein and β-Carotenes—in nmol/g FW, and respective p-value in young and mature leaves of plants exposed to increasing supplementing concentrations of Ni—2.5, 5, 7.5, 10 mg L−1. The p-values correspond to the difference between each value obtained for each treatment and the control (0 mg/L), through a one-way ANOVA followed by Dunnett’s multiple comparison test. Table S5: Total leaf area, in pixel, in young and mature leaves and root length, in cm, of plants exposed to increasing supplementing concentrations of Ni—2.5, 5, 7.5, 10 mg L−1. The p-values correspond to the difference between each value obtained for each treatment and the control (0 mg/L), through a one-way ANOVA followed by Dunnett’s multiple comparison test. Table S6: ANOVA table depicting the results for testing the empirical distribution’s conformity with the normal distribution before Dunnett’s multiple comparison tests with C as the control group. YL—Young leaves; ML—Mature leaves; R—roots.

Author Contributions

Conceptualization, J.T.; methodology, A.A. and I.M.; formal analysis, A.A. and I.M.; investigation, G.V., L.S., M.F. and M.A.; resources, J.T.; writing—original draft preparation, A.A. and I.M.; writing—review and editing, J.T.; supervision, J.T. All authors have read and agreed to the published version of the manuscript.

Funding

This research was partially supported through national funds by the Foundation for Science and Technology (FCT), within the scope of UIDB/05748/2020 and UIDP/05748/2020 (GreenUPorto), of UIDB/00081/2020 and UIDP/00081/2020 (CIQUP) and to IMS (LA/P/0056/2020).

Data Availability Statement

Data are available on request due to privacy restrictions. The data presented in this study are available on request from the corresponding author. The data are not publicly available due to unpublished results being prepared.

Acknowledgments

GreenUPorto and CIQUP are recognised for equipment support. All individuals included in this section have consented to the data presented in this report.

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. Ghous, M.; Iqbal, S.; Bakhtavar, M.A.; Nawaz, F.; Haq, T.u.; Khan, S. Halophyte quinoa: A potential hyperaccumulator of heavy metals for phytoremediation. Asian. J. Agric. Biol. 2022, 4, 1–9. [Google Scholar] [CrossRef]
  2. Sall, M.L.; Diaw, A.K.D.; Gningue-Sall, D.; Efremova Aaron, S.; Aaron, J.J. Toxic heavy metals: Impact on the environment and human health, and treatment with conducting organic polymers, a review. Environ. Sci. Pollut. Res. Int. 2020, 27, 29927–29942. [Google Scholar] [CrossRef]
  3. Alengebawy, A.; Abdelkhalek, S.T.; Qureshi, S.R.; Wang, M.Q. Heavy Metals and Pesticides Toxicity in Agricultural Soil and Plants: Ecological Risks and Human Health Implications. Toxics 2021, 9, 42. [Google Scholar] [CrossRef] [PubMed]
  4. Ahmed, T.; Noman, M.; Ijaz, M.; Ali, S.; Rizwan, M.; Ijaz, U.; Hameed, A.; Ahmad, U.; Wang, Y.; Sun, G.; et al. Current trends and future prospective in nanoremediation of heavy metals contaminated soils: A way forward towards sustainable agriculture. Ecotoxicol. Environ. Saf. 2021, 227, 112888. [Google Scholar] [CrossRef]
  5. Tumanyan, A.F.; Seliverstova, A.P.; Zaitseva, N.A. Effect of Heavy Metals on Ecosystems. Chem. Technol. Fuels Oils 2020, 56, 390–394. [Google Scholar] [CrossRef]
  6. Kiran; Bharti, R.; Sharma, R. Effect of heavy metals: An overview. Mater. Today: Proc. 2022, 51, 880–885. [Google Scholar] [CrossRef]
  7. Radocaj, D.; Velić, N.; Jurišić, M.; Merdic, E. The remediation of agricultural land contaminated by heavy metals. Poljoprivreda 2020, 26, 30–42. [Google Scholar] [CrossRef]
  8. Rai, R.; Agrawal, M.; Agrawal, S.B. Impact of Heavy Metals on Physiological Processes of Plants: With Special Reference to Photosynthetic System. In Plant Responses to Xenobiotics; Singh, A., Prasad, S.M., Singh, R.P., Eds.; Springer: Singapore, 2016; pp. 127–140. [Google Scholar] [CrossRef]
  9. Sandeep, G.; Vijayalatha, K.R.; Anitha, T. Heavy metals and its impact in vegetable crops. Int. J. Chem. Stud. 2018, 7, 1612–1621. [Google Scholar]
  10. Chen, Y.-G.; He, X.-L.-S.; Huang, J.-H.; Luo, R.; Ge, H.-Z.; Wołowicz, A.; Wawrzkiewicz, M.; Gładysz-Płaska, A.; Li, B.; Yu, Q.-X.; et al. Impacts of heavy metals and medicinal crops on ecological systems, environmental pollution, cultivation, and production processes in China. Ecotoxicol. Environ. Saf. 2021, 219, 112336. [Google Scholar] [CrossRef]
  11. Hassan, M.U.; Chattha, M.U.; Khan, I.; Chattha, M.B.; Aamer, M.; Nawaz, M.; Ali, A.; Khan, M.A.U.; Khan, T.A. Nickel toxicity in plants: Reasons, toxic effects, tolerance mechanisms, and remediation possibilities—A review. Environ. Sci. Pollut. Res. Int. 2019, 26, 12673–12688. [Google Scholar] [CrossRef]
  12. Nowicka, B. Heavy metal–induced stress in eukaryotic algae—Mechanisms of heavy metal toxicity and tolerance with particular emphasis on oxidative stress in exposed cells and the role of antioxidant response. Environ. Sci. Pollut. Res. Int. 2022, 29, 16860–16911. [Google Scholar] [CrossRef] [PubMed]
  13. Buxton, S.; Garman, E.; Heim, K.E.; Lyons-Darden, T.; Schlekat, C.E.; Taylor, M.D.; Oller, A.R. Concise Review of Nickel Human Health Toxicology and Ecotoxicology. Inorganics 2019, 7, 89. [Google Scholar] [CrossRef]
  14. Nualla-Ong, A.; Phongdara, A.; Buapet, P. Copper and zinc differentially affect root glutathione accumulation and phytochelatin synthase gene expression of Rhizophora mucronata seedlings: Implications for mechanisms underlying trace metal tolerance. Ecotoxicol. Environ. Saf. 2020, 205, 111175. [Google Scholar] [CrossRef] [PubMed]
  15. Filiz, E.; Saracoglu, I.; Ozyigit, I.; Yalcin, B. Comparative analyses of phytochelatin synthase (PCS) genes in higher plants. Biotechnol. Biotechnol. Equip. 2019, 33, 178–194. [Google Scholar] [CrossRef]
  16. Peterson, A.G.; Oliver, D.J. Leaf-targeted phytochelatin synthase in Arabidopsis thaliana. Plant Physiol. Biochem. 2006, 44, 885–892. [Google Scholar] [CrossRef] [PubMed]
  17. Dubey, A.K.; Kumar, A.; Kumar, N.; Kumar, S.; Meenakshi; Gautam, A.; Ansari, M.A.; Manika, N.; Lal, S.; Behera, S.K.; et al. Over-expression of chickpea metallothionein 1 gene confers tolerance against major toxic heavy metal stress in Arabidopsis. Physiol. Mol. Biol. Plants 2021, 27, 2665–2678. [Google Scholar] [CrossRef] [PubMed]
  18. Zhigang, A.; Cuijie, L.; Yuangang, Z.; Yejie, D.; Wachter, A.; Gromes, R.; Rausch, T. Expression of BjMT2, a metallothionein 2 from Brassica juncea, increases copper and cadmium tolerance in Escherichia coli and Arabidopsis thaliana, but inhibits root elongation in Arabidopsis thaliana seedlings. J. Exp. Bot. 2006, 57, 3575–3582. [Google Scholar] [CrossRef] [PubMed]
  19. Xiong, W.; Wang, P.; Yan, T.; Cao, B.; Xu, J.; Liu, D.; Luo, M. The rice “fruit-weight 2.2-like” gene family member OsFWL4 is involved in the translocation of cadmium from roots to shoots. Planta 2018, 247, 1247–1260. [Google Scholar] [CrossRef] [PubMed]
  20. Zhu, W.; Zhao, D.-X.; Miao, Q.; Xue, T.-T.; Li, X.-Z.; Zheng, C.-C. Arabidopsis thaliana Metallothionein, AtMT2a, Mediates ROS Balance during Oxidative Stress. J. Plant. Biol. 2009, 52, 585–592. [Google Scholar] [CrossRef]
  21. Jin, S.; Sun, D.; Wang, J.; Li, Y.; Wang, X.; Liu, S. Expression of the rgMT gene, encoding for a rice metallothionein-like protein in Saccharomyces cerevisiae and Arabidopsis thaliana. J. Genet. 2014, 93, 709–718. [Google Scholar] [CrossRef]
  22. Guo, W.J.; Meetam, M.; Goldsbrough, P.B. Examining the specific contributions of individual Arabidopsis metallothioneins to copper distribution and metal tolerance. Plant Physiol. 2008, 146, 1697–1706. [Google Scholar] [CrossRef]
  23. Sekhar, K.; Priyanka, B.; Reddy, V.D.; Rao, K.V. Metallothionein 1 (CcMT1) of pigeonpea (Cajanus cajan, L.) confers enhanced tolerance to copper and cadmium in Escherichia coli and Arabidopsis thaliana. Environ. Exp. Bot. 2011, 72, 131–139. [Google Scholar] [CrossRef]
  24. Gu, C.S.; Liu, L.Q.; Deng, Y.M.; Zhu, X.D.; Huang, S.Z.; Lu, X.Q. The heterologous expression of the Iris lactea var. chinensis type 2 metallothionein IlMT2b gene enhances copper tolerance in Arabidopsis thaliana. Bull. Environ. Contam. Toxicol. 2015, 94, 247–253. [Google Scholar] [CrossRef]
  25. Guo, W.-J.; Bundithya, W.; Goldsbrough, P.B. Characterization of the Arabidopsis metallothionein gene family: Tissue-specific expression and induction during senescence and in response to copper. New Phytol. 2003, 159, 369–381. [Google Scholar] [CrossRef] [PubMed]
  26. Cazalé, A.C.; Clemens, S. Arabidopsis thaliana expresses a second functional phytochelatin synthase. FEBS Lett. 2001, 507, 215–219. [Google Scholar] [CrossRef] [PubMed]
  27. Vatamaniuk, O.K.; Mari, S.; Lang, A.; Chalasani, S.; Demkiv, L.O.; Rea, P.A. Phytochelatin synthase, a dipeptidyltransferase that undergoes multisite acylation with gamma-glutamylcysteine during catalysis: Stoichiometric and site-directed mutagenic analysis of Arabidopsis thaliana PCS1-catalyzed phytochelatin synthesis. J. Biol. Chem. 2004, 279, 22449–22460. [Google Scholar] [CrossRef]
  28. Fan, W.; Guo, Q.; Liu, C.; Liu, X.; Zhang, M.; Long, D.; Xiang, Z.; Zhao, A. Two mulberry phytochelatin synthase genes confer zinc/cadmium tolerance and accumulation in transgenic Arabidopsis and tobacco. Gene 2018, 645, 95–104. [Google Scholar] [CrossRef]
  29. Gill, S.S.; Tuteja, N. Reactive oxygen species and antioxidant machinery in abiotic stress tolerance in crop plants. Plant Physiol. Biochem. 2010, 48, 909–930. [Google Scholar] [CrossRef] [PubMed]
  30. Noor, I.; Sohail, H.; Sun, J.; Nawaz, M.A.; Li, G.; Hasanuzzaman, M.; Liu, J. Heavy metal and metalloid toxicity in horticultural plants: Tolerance mechanism and remediation strategies. Chemosphere 2022, 303, 135196. [Google Scholar] [CrossRef] [PubMed]
  31. Thakur, M.; Praveen, S.; Divte, P.R.; Mitra, R.; Kumar, M.; Gupta, C.K.; Kalidindi, U.; Bansal, R.; Roy, S.; Anand, A.; et al. Metal tolerance in plants: Molecular and physicochemical interface determines the “not so heavy effect” of heavy metals. Chemosphere 2022, 287, 131957. [Google Scholar] [CrossRef]
  32. Hasanuzzaman, M.; Fujita, M. Plant Oxidative Stress: Biology, Physiology and Mitigation. Plants 2022, 11, 1185. [Google Scholar] [CrossRef] [PubMed]
  33. Helaoui, S.; Hattab, S.; Mkhinini, M.; Boughattas, I.; Majdoub, A.; Banni, M. The Effect of Nickel Exposure on Oxidative Stress of Vicia faba Plants. Bull. Environ. Contam. Toxicol. 2022, 108, 1074–1080. [Google Scholar] [CrossRef] [PubMed]
  34. Nisar, N.; Li, L.; Lu, S.; Khin, N.C.; Pogson, B.J. Carotenoid Metabolism in Plants. Mol. Plant 2015, 8, 68–82. [Google Scholar] [CrossRef] [PubMed]
  35. Roukas, T. The role of oxidative stress on carotene production by Blakeslea trispora in submerged fermentation. Crit. Rev. Biotechnol. 2016, 36, 424–433. [Google Scholar] [CrossRef] [PubMed]
  36. Hasanuzzaman, M.; Bhuyan, M.; Anee, T.I.; Parvin, K.; Nahar, K.; Mahmud, J.A.; Fujita, M. Regulation of Ascorbate-Glutathione Pathway in Mitigating Oxidative Damage in Plants under Abiotic Stress. Antioxidants 2019, 8, 384. [Google Scholar] [CrossRef]
  37. Woodward, A.W.; Bartel, B. Biology in Bloom: A Primer on the Arabidopsis thaliana Model System. Genetics 2018, 208, 1337–1349. [Google Scholar] [CrossRef]
  38. Cobbett, C.; Goldsbrough, P. Phytochelatins and metallothioneins: Roles in heavy metal detoxification and homeostasis. Annu. Rev. Plant Biol. 2002, 53, 159–182. [Google Scholar] [CrossRef] [PubMed]
  39. Zhou, J.; Goldsbrough, P.B. Functional homologs of fungal metallothionein genes from Arabidopsis. Plant Cell 1994, 6, 875–884. [Google Scholar] [CrossRef]
  40. Zhou, J.; Goldsbrough, P.B. Structure, organization and expression of the metallothionein gene family in Arabidopsis. Mol. Genet. Genom 1995, 248, 318–328. [Google Scholar] [CrossRef] [PubMed]
  41. Clemens, S.; Kim, E.J.; Neumann, D.; Schroeder, J.I. Tolerance to toxic metals by a gene family of phytochelatin synthases from plants and yeast. EMBO J. 1999, 18, 3325–3333. [Google Scholar] [CrossRef] [PubMed]
  42. Zheng, T.; Wu, G.; Tao, X.; He, B. Arabidopsis SUMO E3 ligase SIZ1 enhances cadmium tolerance via the glutathione-dependent phytochelatin synthesis pathway. Plant Sci. 2022, 322, 111357. [Google Scholar] [CrossRef] [PubMed]
  43. Kim, Y.O.; Kang, H.; Ahn, S.J. Overexpression of phytochelatin synthase AtPCS2 enhances salt tolerance in Arabidopsis thaliana. J. Plant Physiol. 2019, 240, 153011. [Google Scholar] [CrossRef] [PubMed]
  44. Sievers, F.; Wilm, A.; Dineen, D.; Gibson, T.J.; Karplus, K.; Li, W.; Lopez, R.; McWilliam, H.; Remmert, M.; Söding, J.; et al. Fast, scalable generation of high-quality protein multiple sequence alignments using Clustal Omega. Mol. Syst. Biol. 2011, 7, 539. [Google Scholar] [CrossRef] [PubMed]
  45. Pessoa, A.M.; Pereira, S.; Teixeira, J. PrimerIdent: A web based tool for conserved primer design. Bioinformation 2010, 5, 52–54. [Google Scholar] [CrossRef]
  46. Kim, Y.O.; Kang, H. Comparative expression analysis of genes encoding metallothioneins in response to heavy metals and abiotic stresses in rice (Oryza sativa) and Arabidopsis thaliana. Biosci. Biotechnol. Biochem. 2018, 82, 1656–1665. [Google Scholar] [CrossRef] [PubMed]
  47. Brunetti, P.; Zanella, L.; Proia, A.; De Paolis, A.; Falasca, G.; Altamura, M.M.; Sanità di Toppi, L.; Costantino, P.; Cardarelli, M. Cadmium tolerance and phytochelatin content of Arabidopsis seedlings over-expressing the phytochelatin synthase gene AtPCS1. J. Exp. Bot. 2011, 62, 5509–5519. [Google Scholar] [CrossRef] [PubMed]
  48. Takeuchi, H.; Higashiyama, T. A species-specific cluster of defensin-like genes encodes diffusible pollen tube attractants in Arabidopsis. PLoS Biol. 2012, 10, e1001449. [Google Scholar] [CrossRef]
  49. Ferreira, M.J.; Silva, J.; Pinto, S.C.; Coimbra, S. I Choose You: Selecting Accurate Reference Genes for qPCR Expression Analysis in Reproductive Tissues in Arabidopsis thaliana. Biomolecules 2023, 13, 463. [Google Scholar] [CrossRef]
  50. Remans, T.; Smeets, K.; Opdenakker, K.; Mathijsen, D.; Vangronsveld, J.; Cuypers, A. Normalisation of real-time RT-PCR gene expression measurements in Arabidopsis thaliana exposed to increased metal concentrations. Planta 2008, 227, 1343–1349. [Google Scholar] [CrossRef] [PubMed]
  51. Alves, A.; Ribeiro, R.; Azenha, M.; Cunha, M.; Teixeira, J. Effects of Exogenously Applied Copper in Tomato Plants’ Oxidative and Nitrogen Metabolisms under Organic Farming Conditions. Horticulturae 2023, 9, 323. [Google Scholar] [CrossRef]
  52. Tosin, R.; Pôças, I.; Novo, H.; Teixeira, J.; Fontes, N.; Graça, A.; Cunha, M. Assessing predawn leaf water potential based on hyperspectral data and pigment’s concentration of Vitis vinifera L. in the Douro Wine Region. Sci. Hortic. 2021, 278, 109860. [Google Scholar] [CrossRef]
  53. Martins, M.; Lopes, J.; Sousa, B.; Soares, C.; Valente, I.M.; Rodrigues, J.A.; Fidalgo, F.; Teixeira, J. Cr (VI)-induced oxidative damage impairs ammonia assimilation into organic forms in Solanum lycopersicum L. Plant Stress 2021, 2, 100034. [Google Scholar] [CrossRef]
  54. Schneider, C.A.; Rasband, W.S.; Eliceiri, K.W. NIH Image to ImageJ: 25 years of image analysis. Nat. Methods 2012, 9, 671–675. [Google Scholar] [CrossRef] [PubMed]
  55. Renella, G.; Chaudri, A.M.; Brookes, P.C. Fresh additions of heavy metals do not model long-term effects on microbial biomass and activity. Soil. Biol. Biochem. 2002, 34, 121–124. [Google Scholar] [CrossRef]
  56. Giller, K.E.; Witter, E.; McGrath, S.P. Heavy metals and soil microbes. Soil. Biol. Biochem. 2009, 41, 2031–2037. [Google Scholar] [CrossRef]
  57. Smolders, E.; McGrath, S.P.; Lombi, E.; Karman, C.C.; Bernhard, R.; Cools, D.; Van den Brande, K.; van Os, B.; Walrave, N. Comparison of toxicity of zinc for soil microbial processes between laboratory-contamined and polluted field soils. Environ. Toxicol. Chem. 2003, 22, 2592–2598. [Google Scholar] [CrossRef]
  58. Khandekar, S.; Leisner, S. Soluble silicon modulates expression of Arabidopsis thaliana genes involved in copper stress. J. Plant Physiol. 2011, 168, 699–705. [Google Scholar] [CrossRef]
  59. Jaskulak, M.; Rorat, A.; Grobelak, A.; Chaabene, Z.; Kacprzak, M.; Vandenbulcke, F. Bioaccumulation, antioxidative response, and metallothionein expression in Lupinus luteus L. exposed to heavy metals and silver nanoparticles. Environ. Sci. Pollut. Res. Int. 2019, 26, 16040–16052. [Google Scholar] [CrossRef] [PubMed]
  60. Boominathan, R.; Doran, P.M. Ni-induced oxidative stress in roots of the Ni hyperaccumulator, Alyssum bertolonii. New Phytol. 2002, 156, 205–215. [Google Scholar] [CrossRef]
  61. Maheshwari, R.; Dubey, R.S. Nickel-induced oxidative stress and the role of antioxidant defence in rice seedlings. Plant Growth Regul. 2009, 59, 37–49. [Google Scholar] [CrossRef]
  62. Sun, Q.; Ye, Z.H.; Wang, X.R.; Wong, M.H. Cadmium hyperaccumulation leads to an increase of glutathione rather than phytochelatins in the cadmium hyperaccumulator Sedum alfredii. J. Plant Physiol. 2007, 164, 1489–1498. [Google Scholar] [CrossRef]
  63. Kukkola, E.; Rautio, P.; Huttunen, S. Stress indications in copper- and nickel-exposed Scots pine seedlings. Environ. Exp. Bot. 2000, 43, 197–210. [Google Scholar] [CrossRef]
  64. Freeman, J.L.; Persans, M.W.; Nieman, K.; Albrecht, C.; Peer, W.; Pickering, I.J.; Salt, D.E. Increased glutathione biosynthesis plays a role in nickel tolerance in thlaspi nickel hyperaccumulators. Plant Cell 2004, 16, 2176–2191. [Google Scholar] [CrossRef] [PubMed]
  65. Gajewska, E.; Skłodowska, M. Effect of nickel on ROS content and antioxidative enzyme activities in wheat leaves. Biometals 2007, 20, 27–36. [Google Scholar] [CrossRef] [PubMed]
  66. Bazihizina, N.; Redwan, M.; Taiti, C.; Giordano, C.; Monetti, E.; Masi, E.; Azzarello, E.; Mancuso, S. Root based responses account for Psidium guajava survival at high nickel concentration. J. Plant Physiol. 2015, 174, 137–146. [Google Scholar] [CrossRef]
  67. Shukla, R.; Gopal, R. Excess Nickel Alters Growth, Metabolism, and Translocation of Certain Nutrients in Potato. J. Plant Nutr. 2009, 32, 1005–1014. [Google Scholar] [CrossRef]
  68. Pandey, N.; Sharma, C.P. Effect of heavy metals Co2+, Ni2+ and Cd2+ on growth and metabolism of cabbage. Plant Sci. 2002, 163, 753–758. [Google Scholar] [CrossRef]
  69. Kersten, W.J.; Brooks, R.R.; Reeves, R.D.; Jaffré, A. Nature of nickel complexes in Psychotria douarrei and other nickel-accumulating plants. Phytochemistry 1980, 19, 1963–1965. [Google Scholar] [CrossRef]
  70. Lee, J.; Reeves, R.D.; Brooks, R.R.; Jaffré, T. Isolation and identification of a citrato-complex of nickel from nickel-accumulating plants. Phytochemistry 1977, 16, 1503–1505. [Google Scholar] [CrossRef]
  71. Montargès-Pelletier, E.; Chardot, V.; Echevarria, G.; Michot, L.J.; Bauer, A.; Morel, J.L. Identification of nickel chelators in three hyperaccumulating plants: An X-ray spectroscopic study. Phytochemistry 2008, 69, 1695–1709. [Google Scholar] [CrossRef]
Figure 1. Relative normalised expression of AtMT1A (A), AtMT1B (B), AtMT1C (C), AtMT2A (D), AtMT2B (E), AtMT3 (F), and AtPCS1 (G) in young leaves (YL) of plants exposed to increasing supplementing concentrations of Ni—2.5, 5, 7.5, and 10 mg L−1. Asterisks represent significant differences between the control and treatments at p-values as follows: * p  ≤  0.05, ** p  ≤  0.01, *** p  ≤  0.001, and **** p ≤ 0.0001 (Dunnett’s test).
Figure 1. Relative normalised expression of AtMT1A (A), AtMT1B (B), AtMT1C (C), AtMT2A (D), AtMT2B (E), AtMT3 (F), and AtPCS1 (G) in young leaves (YL) of plants exposed to increasing supplementing concentrations of Ni—2.5, 5, 7.5, and 10 mg L−1. Asterisks represent significant differences between the control and treatments at p-values as follows: * p  ≤  0.05, ** p  ≤  0.01, *** p  ≤  0.001, and **** p ≤ 0.0001 (Dunnett’s test).
Agronomy 14 03026 g001
Figure 2. Relative normalised expression of AtMT1A (A), AtMT1B (B), AtMT1C (C), AtMT2A (D), AtMT2B (E), AtMT3 (F), and AtPCS1 (G) in mature leaves (ML) of plants exposed to increasing supplementing concentrations of Ni—2.5, 5, 7.5, and 10 mg L−1. Asterisks represent significant differences between the control and treatments at p-values as follows: * p  ≤  0.05, ** p  ≤  0.01, and *** p  ≤  0.001 (Dunnett’s test).
Figure 2. Relative normalised expression of AtMT1A (A), AtMT1B (B), AtMT1C (C), AtMT2A (D), AtMT2B (E), AtMT3 (F), and AtPCS1 (G) in mature leaves (ML) of plants exposed to increasing supplementing concentrations of Ni—2.5, 5, 7.5, and 10 mg L−1. Asterisks represent significant differences between the control and treatments at p-values as follows: * p  ≤  0.05, ** p  ≤  0.01, and *** p  ≤  0.001 (Dunnett’s test).
Agronomy 14 03026 g002
Figure 3. Relative normalised expression of AtMT1A (A), AtMT1B (B), AtMT1C (C), AtMT2A (D), AtMT2B (E), AtMT3 (F), and AtPCS1 (G) in roots of plants exposed to increasing supplementing concentrations of Ni—2.5, 5, 7.5, and 10 mg L−1. Asterisks represent significant differences between the control and treatments at p-values as follows: ** p  ≤  0.01, *** p  ≤  0.001, and **** p ≤ 0.0001 (Dunnett’s test).
Figure 3. Relative normalised expression of AtMT1A (A), AtMT1B (B), AtMT1C (C), AtMT2A (D), AtMT2B (E), AtMT3 (F), and AtPCS1 (G) in roots of plants exposed to increasing supplementing concentrations of Ni—2.5, 5, 7.5, and 10 mg L−1. Asterisks represent significant differences between the control and treatments at p-values as follows: ** p  ≤  0.01, *** p  ≤  0.001, and **** p ≤ 0.0001 (Dunnett’s test).
Agronomy 14 03026 g003
Figure 4. Average + SD levels of Ni in shoots and plants’ roots exposed to a supplementation of 0 and 10 mg L−1 concentrations. Asterisks represent significant differences between the control and treatment at p ≤ 0.0001 (Dunnett’s test).
Figure 4. Average + SD levels of Ni in shoots and plants’ roots exposed to a supplementation of 0 and 10 mg L−1 concentrations. Asterisks represent significant differences between the control and treatment at p ≤ 0.0001 (Dunnett’s test).
Agronomy 14 03026 g004
Figure 5. Average + SD levels of H2O2 levels, expressed as nmol g−1 FW in the aerial part (AP) (A) and in the roots (Rs) (B) of plants exposed to increasing supplementing concentrations of Ni—0, 2.5, 5, 7.5, and 10 mg L−1.
Figure 5. Average + SD levels of H2O2 levels, expressed as nmol g−1 FW in the aerial part (AP) (A) and in the roots (Rs) (B) of plants exposed to increasing supplementing concentrations of Ni—0, 2.5, 5, 7.5, and 10 mg L−1.
Agronomy 14 03026 g005
Figure 6. Average + SD levels of chlorophyll a in YL (A) and ML (E); chlorophyll b in YL (B) and ML (F); β-carotenes in YL (C) and ML (G); and lutein in YL (D) and ML (H), expressed as mg/g FW in plants exposed to the different supplementing concentrations of Ni—0, 2.5, 5, 7.5, and 10 mg L−1.
Figure 6. Average + SD levels of chlorophyll a in YL (A) and ML (E); chlorophyll b in YL (B) and ML (F); β-carotenes in YL (C) and ML (G); and lutein in YL (D) and ML (H), expressed as mg/g FW in plants exposed to the different supplementing concentrations of Ni—0, 2.5, 5, 7.5, and 10 mg L−1.
Agronomy 14 03026 g006
Figure 7. Average + SD levels of GSH in the aerial part of the plant (AP) (A) and the roots (Rs) (B) of plants exposed to increasing supplementing concentrations of Ni—0, 2.5, 5, 7.5, and 10 mg L−1.
Figure 7. Average + SD levels of GSH in the aerial part of the plant (AP) (A) and the roots (Rs) (B) of plants exposed to increasing supplementing concentrations of Ni—0, 2.5, 5, 7.5, and 10 mg L−1.
Agronomy 14 03026 g007
Figure 8. Average + SD total leaf area, expressed in pixels, of young and mature leaves of plants exposed to increasing concentrations of Ni—0, 2.5, 5, 7.5, and 10 mg L−1.
Figure 8. Average + SD total leaf area, expressed in pixels, of young and mature leaves of plants exposed to increasing concentrations of Ni—0, 2.5, 5, 7.5, and 10 mg L−1.
Agronomy 14 03026 g008
Figure 9. Average + SD root (R) length in cm of plants exposed to increasing supplementing concentrations of Ni—0, 2.5, 5, 7.5, and 10 mg L−1.
Figure 9. Average + SD root (R) length in cm of plants exposed to increasing supplementing concentrations of Ni—0, 2.5, 5, 7.5, and 10 mg L−1.
Agronomy 14 03026 g009
Table 1. Primer pairs used for the RT-qPCR expression analysis of the AtMT- and AtPCS1-encoding genes.
Table 1. Primer pairs used for the RT-qPCR expression analysis of the AtMT- and AtPCS1-encoding genes.
GenePrimerSequenceReferenceE (%)R2SlopeMelting Tm (°C)
MT1AForwardCCTGCAAATGTGGTGACTCT[46]100.10.975−3.32078.5
ReverseACCCACAGCTGCAGTTTGAT
MT1BForwardAGAGATGTGTGTGTTGTTGGThis work109.10.98−3.12178
ReverseTTGGTGAGAGTGGGACTTG
MT1CForwardCCTGCAAATGTGGTGATTCGT[46]105.30.992−3.20079
ReverseACAGTTACAGCTTGACCCGCA
MT2AForwardGGTTGCAAAATGTACCCTGACThis work96.10.998−3.41981
ReverseTCTCAGCGTTGTTACTCTCC
MT2BForwardGTGGAAGCTGTGGTTGTGG[46]105.90.998−3.18883.5
ReverseAACGAAAGTCTCGCCGGAAG
MT3ForwardACAAGACCCAGTGCGTAAAGThis work100.00.999−3.32279
ReverseATGGCCTCCTTGTAGCTCTC
PCS1ForwardTGCGTGATGGGAATGAACAA[47]132.20.998−2.73460
ReverseTTTGCGTCGATGGCACTAAC
ACT2ForwardCTTGCACCAAGCAGCATGAA[48]103.80.999−3.23377
ReverseCCGATCCAGACACTGTACTTCCTT
YLS8ForwardAAGATCAACTGGGCTCTCAAGG[49]90.00.996−3.58782.5
ReverseTGGGAAGCTCGATTAGTAACGG
SANDForwardAACTCTATGCAGCATTTGATCCACT[50]99.50.997−3.33560
ReverseTGATTGCATATCTTTATCGCCATC
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Afonseca, A.; Mota, I.; Vasques, G.; Soares, L.; Flores, M.; Azenha, M.; Teixeira, J. Nickel-Induced Differential Expression of Metallothioneins and Phytochelatin Synthase 1 in Arabidopsis thaliana: Organ-Specific Responses. Agronomy 2024, 14, 3026. https://doi.org/10.3390/agronomy14123026

AMA Style

Afonseca A, Mota I, Vasques G, Soares L, Flores M, Azenha M, Teixeira J. Nickel-Induced Differential Expression of Metallothioneins and Phytochelatin Synthase 1 in Arabidopsis thaliana: Organ-Specific Responses. Agronomy. 2024; 14(12):3026. https://doi.org/10.3390/agronomy14123026

Chicago/Turabian Style

Afonseca, Ana, Inês Mota, Gonçalo Vasques, Leonel Soares, Mafalda Flores, Manuel Azenha, and Jorge Teixeira. 2024. "Nickel-Induced Differential Expression of Metallothioneins and Phytochelatin Synthase 1 in Arabidopsis thaliana: Organ-Specific Responses" Agronomy 14, no. 12: 3026. https://doi.org/10.3390/agronomy14123026

APA Style

Afonseca, A., Mota, I., Vasques, G., Soares, L., Flores, M., Azenha, M., & Teixeira, J. (2024). Nickel-Induced Differential Expression of Metallothioneins and Phytochelatin Synthase 1 in Arabidopsis thaliana: Organ-Specific Responses. Agronomy, 14(12), 3026. https://doi.org/10.3390/agronomy14123026

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop