Next Article in Journal
Biomethane Production from Untreated and Treated Brewery’s Spent Grain: Feasibility of Anaerobic Digestion After Pretreatments According to Biogas Yield and Energy Efficiency
Previous Article in Journal
Poly-Glutamic Acid Regulates Physiological Characteristics, Plant Growth, and the Accumulation of the Main Medical Ingredients in the Root of Salvia miltiorrhiza Under Water Shortage
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Agronomy
Volume 14
Issue 12
10.3390/agronomy14122978
agronomy-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Hemp Cover Cropping and Disease Suppression in Winter Wheat of the Dryland Pacific Northwest

by
Christina H. Hagerty
1,*,†,
Govinda Shrestha
2,†,
Nuan Wen
3,
Duncan R. Kroese
4,
Grayson F. Namdar
1,
Tim Paulitz
3 and
Donald J. Wysocki
1
1
Columbia Basin Agricultural Research Center, Oregon State University, Pendleton, OR 97810, USA
2
Southern Oregon Research and Extension Center, Oregon State University, Central Point, OR 97502, USA
3
Department of Crop and Soil Sciences, Washington State University, Pullman, WA 99164, USA
4
United States Department of Agriculture—Forest Service, Pacific Northwest Research Station, Corvallis, OR 97331, USA
*
Author to whom correspondence should be addressed.
†
These authors contributed equally to this work.
Agronomy 2024, 14(12), 2978; https://doi.org/10.3390/agronomy14122978
Submission received: 17 October 2024 / Revised: 5 December 2024 / Accepted: 10 December 2024 / Published: 13 December 2024
(This article belongs to the Section Pest and Disease Management)
Browse Figures
Versions Notes

Abstract

:
The predominant cropping scheme for dryland wheat production in the Pacific Northwest (PNW) region of the United States includes winter wheat–summer fallow. Lack of crop diversification can deplete the soil organic matter and nutrients, while favoring the build-up of soilborne diseases. Cover crops are becoming more common within a standard rotation, primarily to provide protection against soil erosion, incorporate nutrients, and break soilborne diseases’ cycles. In this study, we investigated the potential of using hemp as a cover crop in a dryland wheat rotation to reduce soilborne diseases, and thus increase farmers’ profitability. While the benefits of barley and yellow mustard cover crops are well understood, the benefits of a hemp cover crop have not been examined in the PNW. We observed Fusarium spp. disease suppression on winter wheat following a hemp cover crop in the greenhouse studies. However, under field conditions, we did not observe a difference in pathogen abundance on winter wheat following hemp cover crop and hemp amendments in the field. Any potential to limit soilborne disease is a profitability opportunity for farmers. Our findings indicate that incorporating a hemp rotation into the PNW dryland wheat production system holds promise as a strategy to reduce soilborne diseases and improve soil health, though further research is necessary to confirm its effectiveness and underlying mechanism.

1. Introduction

Hemp (Cannabis sativa L.) is used for a variety of industrial products, including textile, paper, medicine, human food, animal feed, paint, biofuel, biodegradable plastic, and construction material [1]. Under the 2014 United States Farm Bill [2], hemp containing ≤0.3% concentration of delta-9 tetrahydrocannabinol (THC) on a dry weight basis was allowed to be grown in the United States (USA) at state agricultural departments and selective research institutes. Later, under the 2018 Farm Bill, hemp was legalized as an agricultural commodity [3]. The USA is currently the third-leading country in hemp production worldwide after China and Canada [4]. In 2021, 21.9 thousand hectares of farmland in the USA were planted to hemp with a production value totaling USD 824 million [5].
Following the legalization of hemp in the USA, an excellent opportunity has arisen to integrate various hemp crop types (e.g., grain, fiber, and cannabinoid) into existing agronomic cropping systems throughout the USA, including the Pacific Northwest (PNW). The PNW, which includes Oregon, Washington, and Idaho, produces over 250 agricultural crops, including nationally significant production of potato, grape, berry, apple, and wheat. Wheat is the leading crop in the PNW, contributing nearly USD 1.8 billion annually to the national economy [6]. The PNW has the potential to be a leading industrial hemp production region in the USA due to its suitable environment (e.g., warm growing conditions and productive agricultural soils) [7] and supportive public and private hemp industry stakeholders [8]. Oregon is one of the leading states for hemp production in the USA [9]. Hemp as a rotation crop with dryland wheat offers the opportunity to diversify the production system, which adds inherent value to the cropping system as a whole.
Diversification of the dryland wheat cropping system with hemp has the potential to help suppress major soilborne pathogens [10]. This is primarily because hemp plants are rich in secondary metabolites [11,12]. Plant secondary metabolites (PSMs) play a vital role in plant health, protecting crops against insect feeding damage due to their anti-feeding properties and pathogen damage due to their antibiotic, antifungal, and antiviral properties [13]. Consequently, hemp is more likely to disrupt the life cycle of wheat pathogens than other cereal rotation crops [14]. However, local environmental conditions such as temperature, rainfall, and soil moisture could potentially influence the effectiveness of the cover crop to reduce disease pressure in soil. For example, during prolonged dry conditions in the summer season in the PNW, hemp may not grow fully, which could reduce its disease suppression benefits. Another factor could be how the hemp cover crop interacts with the occurrence of disease in the following crop. Thus, it is necessary to explore the opportunity whether hemp, as a cover crop, has the potential to reduce disease pressure in wheat production systems.
Several soilborne diseases, including Fusarium crown (Fusarium spp.) and Rhizoctonia root rot (Rhizoctonia solani), are prevalent in PNW wheat production systems, and affect root growth and development and grain yield [15,16,17]. Management of these diseases is often challenging, and effective control measures are limited in the region. The use of hemp as a rotation and cover crop may provide options to PNW growers in addition to the available tools for reducing soilborne diseases and improving wheat cash crop yield.
The overarching objective of our research was to understand the potential benefits of an industrial hemp cover crop on soilborne crown and root rot diseases (Fusarium, Pythium, and Rhizoctonia), yield, and quality of winter wheat. Specifically, we determined the following: (1) the effects of cover crop treatments including hemp cannabinoid-type varieties (low and high CBD content), barley, mustard seed meal (positive control), and fallow (negative control) on the severity of soilborne pathogen-induced disease on winter wheat under greenhouse conditions and (2) the effects of cover crop treatments on soilborne pathogen abundance on winter wheat and on grain yield and quality under field conditions.

2. Materials and Methods

2.1. Greenhouse Experiments

Greenhouse experiments were conducted at OSU-Columbia Basin Agricultural Research Center (CBARC) to determine the feasibility of using hemp as a cover crop (2020) or hemp biomass (2021) to suppress Fusarium spp. that cause root and crown disease in winter wheat.

2.2. Cover Crop Assay

The cover crop experiment consisted of four treatments: (1) barley cv. ‘Little Friend’, (2) mustard cv. ‘Caliente Rojo’, (3) hemp cv. ‘X59’, and (4) a fallow control. All treatments were replicated 10 times in a randomized complete block design and 1 run of this experiment was conducted. Black plastic pots (4.5 L) were filled with 4 L of nonsterile field soil collected from the CBARC research farm. In each pot, five 2.5 cm deep holes were made in the potted soil by penetrating a sharpened pencil into the soil surface. One gram of Fusarium millet inoculum [18] (1:1 ratio of F. pseudograminearum and F. culmorum) was placed on the soil surface. Pots were tilted back and forth 2–3 times to distribute the inoculum evenly on the soil surface and into the holes. Inoculum remaining on the soil surface was incorporated slightly below the soil surface. Planting the cover crop included (i) barley (9 seeds per pot at a depth of approximately 2.5 cm), (ii) hemp (9 seeds per pot at a depth of approximately 2.5 cm), (iii) mustard (approximately 15 seeds per pot at a depth of approximately 1.2 cm), and (iv) a fallow treatment, which was not planted. All pots were wetted to capacity and thereafter watered every 2 to 4 days and incubated in the greenhouse under 12 h light at 23 °C daytime and 7 °C nighttime temperatures. Plants emerged after 7–10 days and each pot was thinned to five plants. Eight weeks after planting, cover crops were terminated by cutting plants at the soil surface with scissors. Biomass was collected, weighed, and then cut into approximately 2.5 cm pieces. Cover crop residue was spread evenly over the soil surface of the same pot from which it was collected and returned to the greenhouse. Pots were watered every 2–4 days to speed up the decomposition of the residue. One week after returning the pots to the greenhouse, winter wheat cv. ‘Stephens’, which is susceptible to Fusarium crown and root rot, was seeded (five seeds per pot) at 5 cm depth in all treatments. Wheat plants were grown for eight weeks and then plants were removed from the soil, keeping the crown and roots near the crown intact to the fullest extent as possible. Roots and crowns of wheat plants were washed to remove excess soil. Total number of wheat plants and number of plants showing crown rot symptoms were recorded. Each plant was rated on a scale of 0 (healthy, no presence of disease), 1 (1–25% crown rot), 2 (25–50% crown rot), 3 (50–75% crown rot), or 4 (dead).

2.3. Biomass Assay

The cover crop biomass experiment included five treatments: (1) barley cv. ‘Alba’, (2) pelletized mustard seed meal ‘Pescadero Gold’ (Farm Fuel Inc. Watsonville, CA, USA), (3) low (3%) CBD hemp cv. ‘K1 Midwest’ remnant product, (4) high (13%) CBD hemp cv. ‘Lifter’ remnant product, and (5) a fallow control. All treatments were replicated 10 times in a randomized complete block design and 1 run was conducted. The experiment was conducted in 4.5 L plastic pots, with Black Gold Natural & Organic (SunGro Horticulture, Agawam, MA, USA) growing media. Cover crop residues were applied, at planting, at the following rates: 7845 kg barley residue/ha, 2241 kg mustard meal/ha, 4882 kg low CBD hemp/ha, and 4882 kg high CBD hemp/ha. Fusarium millet inoculum application, winter wheat planting, and data measurement were conducted as previously described with two exceptions: winter wheat cv. ‘Appleby CL+’ (also susceptible to Fusarium crown and root rot) was planted, and each pot was fertilized with three Jobe’s fertilizer spikes (13-4-6 NPK).

2.4. Field Experiments

Field experiments were conducted at the OSU-CBARC farm in 2020 and 2021 and treatments included (1) winter barley cv. ‘Little Friend’, (2) low CBD hemp cv. ‘NWG452’, (3) high CBD hemp cv. ‘NWG2730’, (4) mustard cv. ‘Caliente Rojo’, and (5) a fallow control. All treatments were planted on 13 March 2020 in a randomized complete block design with four replicates. Planting was accomplished with a no-till plot drill at rates of 90 kg/ha for barley, 7 kg/ha for low CBD hemp, 10.6 kg/ha for high CBD hemp, and 11.2 kg/ha for mustard. Differing planting rates of hemp per hectare were based on certified seed germination testing (New West Genetics, Fort Collins, CO, USA). A severe frost in spring 2020 resulted in 100% crop failure of the mustard treatment; however, all other treatments survived. To salvage the mustard treatment, pelletized Pescadero Gold Mustard Meal (FarmFuel Inc., Freedom, CA, USA) was applied at the label rate of 4483.4 kg/ha on 20 August 2020. Pellets were surface applied to the mustard treatment prior to winter wheat planting. On 16 June 2020, hemp plots were terminated prior to pollen shed (in accordance with Oregon Department of Agriculture law) using an Almaco (Nevada, IA, USA) plot swather, and barley treatments were terminated with an application of 2.3 L/ha of glyphosate. Termination technique differed due to plant height; hemp plants were too tall for spray termination. On 1 October 2020, winter wheat cv. ‘Stephens’ was planted into all treatments at a rate of 93 kg/ha and 28 kg/ha of starter fertilizer (16-20-0) was applied with a no-till plot drill. Winter wheat yield was collected in July 2021 with a Zürn 110 (Westernhausen, Germany) plot combine, and protein and test weight of harvested grain were collected by a FOSS (Hilleroed, Denmark) Infratec NIR.
In 2021, treatments were planted on 15 March in the same manner as 2020. Emergence in 2021 occurred during a severe drought (https://www.noaa.gov/news/record-drought-gripped-much-of-us-in-2022, accessed on 18 October 2024). Hemp and mustard treatments failed to establish, and 95% plant mortality was estimated. To salvage the hemp and mustard treatments, plant material was surface applied. Pelletized Pescadero Gold Mustard Meal (FarmFuel Inc., Freedom, CA, USA) was applied at the label rate of 4483.4 kg/ha on 20 August 2020. Pellets were surface applied to the mustard treatments prior to planting. Both low and high CBD hemp remnant products were obtained from a local producer and products were applied at a rate of 4882 kg/ha. The rate was obtained from the average hemp biomass accumulated in 2020 [19]. Winter wheat cv. ‘Helix’ (susceptible to Fusarium crown and root rot) was planted at a rate of 93 kg/ha and 28 kg/ha starter fertilizer (16-20-0) was applied with a no-till plot drill on 3 November 2021. Yield, protein, and test weight of the winter wheat were collected in August 2022 as previously described.

2.5. qPCR Analysis

In spring 2021 and 2022, winter wheat, cv. ‘Stephens’ and cv. ‘Helix’, respectively, were sampled for pathogen quantification. Four winter wheat plants per plot were sampled at Feeks 6. Sampling area was within a 0.5 m × 0.5 m quadrat randomly placed in the plot (avoiding outer rows) in a representative area. DNA was extracted from the crown and the root of each plant using the NDeasy Plant Pro Kit (Qiagen, Germantown, MD, USA) following the manufacturer’s instructions. The resulting DNA was quantified using a NanoDrop 1000 spectrophotometer (Thermo Scientific, Waltham, MA, USA). DNA extracted from the crown was used for qPCR assays to study the abundance of Fusarium, whereas DNA extracted from the root was used for Pythium and Rhizoctonia.
For 2021 samples, we studied the presence or abundance of R. solani AG2-1, R. solani AG8, R. oryzae genotype III, Pythium abappressorium, P. irregulare group IV, P. ultimum, P. rostratifingens, F. culmorum, and F. pseudograminearum. According to the KAPA SYBR FAST qPCR Master Mix manufacturer’s instructions, qPCR was performed in a total volume of 10 µL reaction mixture containing 10 ng of DNA, 2 pmol of each primer, 5 µL of the KAPA SYBR FAST qPCR Master Mix (Roche, Indianapolis, IN, USA), and adding nuclease-free water to 10 µL. The PCR program was 95 °C for 3 min, followed by 45 cycles of 95 °C for 5 s, and 60 °C for 20 s. To evaluate the amplification specificity, a melt curve was generated at the end of each run by heating the reaction mixture to 95 °C for 5 s, cooling down to 65 °C for 1 min, and incremental increases of 0.5 °C to 97 °C with continuous fluorescence signal reading. Previously designed, species-specific qPCR primers were used for each of the above-mentioned pathogen species (Table 1 [20,21,22]). The wheat housekeeping gene GAPDH was used as the reference for normalization. Due to the low variation in Pythium and Rhizoctonia in all 2021 samples, F. culmorum and F. pseudograminearum, which are more widespread pathogens in PNW, were tested in the 2022 study.

2.6. Statistical Analysis

Field and greenhouse methods varied from year to year, due to cultivar availability and extreme, uncommon, environmental conditions present during the study. While the methods differed from year to year, the experiments were designed to address the same aims. Therefore, each experiment (i.e., cover crop assay, biomass assay, field 2020, and field 2021) was analyzed separately. Statistical analysis was performed in R version 2023.03.1+446 [22,23] and included Analysis of Variance (ANOVA) followed by a post-hoc Tukey’s honest significant difference (p < 0.05) with a Bonferroni Correction. In each ANOVA, the main response variable was disease on wheat following the explanatory variable of cover crop treatment. Untreated controls were present in each experiment.

3. Results

3.1. Cover Crop Assay

The hemp cover crop treatment had a significant effect on Fusarium crown and root rot symptoms (df = 3, 36, F = 9.90, p < 0.001). Fusarium crown and root rot symptoms were greatest in the greenhouse assay for the fallow control treatment followed by hemp, barley, and mustard (Figure 1).

3.2. Biomass Assay

Similar to the cover crop experiment, both the low and high CBD hemp cover crop treatment had a significant effect on disease (df = 4, 45, F = 5.38, p = 0.0012) in the greenhouse assay. The fallow control and barley treatments showed the greatest Fusarium crown and root rot symptoms, followed by mustard and both low and high CBD hemp (Figure 2).

3.3. 2021 Field Experiment: qPCR Analysis

We quantified the abundance of R. solani AG2-1, R. solani AG8, R. oryzae genotype III, P. abappressorium, P. irregulare group IV, P. ultimum, P. rostratifingens, F. culmorum, and F. pseudograminearum from the 2021 field samples (Figure 3). The qPCR results revealed no significant difference (p > 0.05) in pathogen abundance across cover crop treatments (Figure 3).

3.4. 2022 Field Experiment: qPCR Analysis

In year 2022, we focused on F. culmorum and F. pseudograminearum, which are more widespread pathogens in the PNW and of primary interest to us and stakeholders. Again, we detected no significant differences (p > 0.05) among the treatments (Figure 4).

3.5. 2021 and 2022 Field Experiments: Agronomic Data

Winter wheat yield, protein, and test weight were not significantly impacted following the cover crop treatments in the field (p > 0.05) (Figure 5). The mean yield ranged from 4750 to 5074 kg/ha, the mean protein ranged from 10 to 11 percent, and the mean test weight ranged from 59 to 61 (lb/bu).

4. Discussion

Cover or rotation crops suppress soilborne pathogens by acting as a nonhost and by producing allelopathic compounds [24,25]. In both cases, hemp is a potential cover or rotation crop candidate [14,26]. This study participates in the early body of work to support research questions for this new crop opportunity in the US and specifically in the PNW. In this study, we performed greenhouse and field experiments to determine the impact of hemp on common soilborne diseases of winter wheat, focusing on Fusarium crown and root rot.
It is widely accepted that hemp cover cropping is not profitable due to seed cost [27]. However, due to Oregon regulations at the time this study was established, male plants needed to be terminated prior to pollen shed. Therefore, this study was established as a cover crop trial. We limit the scope of inference to cover crop effects, but we suspect that the patterns we observed in this study would be amplified by planting hemp as a cash crop, due to the increased time plants would be in the field and additional plant secondary metabolites that would be produced and accumulated.
The industrial hemp plant produces many secondary metabolites including over 120 terpenoids and 100 cannabinoids. These compounds may play a major role in suppressing soilborne diseases and improving soil health by diversifying the overall metabolic profile of the soil. PSMs are small molecules produced by plants during the biosynthetic pathways of primary metabolites [28]. Based on the biosynthetic pathway and chemical structure, PSMs are classified into three major groups, including terpenoid compounds (e.g., plant volatiles, sterols, and saponins), phenolic compounds (e.g., flavonoids, phenolic acids, and lignin) and nitrogen-containing compounds (e.g., alkaloids, glucosinolates, and stilbenes) [29]. Hemp plants produce several PSMs such as at least 104 cannabinoids (terpenophenolic compounds), 120 terpenoids, 24 flavonoids, 19 phenolics, and 10 alkaloids [11]. The pharmacological and therapeutic properties of hemp PSMs have been documented or identified, such as their role in anti-inflammatory [30], anti-cancer [31], epilepsy [32], and liver protection [33]. Although the plant health properties of hemp PSMs, such as the ability to suppress soilborne diseases, remain largely unexplored, the role of hemp in insect pest management has been identified [34,35].
The PSMs of other crops are well understood and serve as the baseline of comparison to hemp. For example, several plant species such as canola, rapeseed, and mustard from the Brassicaceae plant family contain glucosinolate secondary metabolite compounds that suppress soilborne pathogens [36]. Glucosinolate PSMs act as biofumigants in a variety of cropping systems, and are used in various forms, including rotational crops, green manures, cover crops, and seed meal amendments. In potato fields, when canola and rapeseed were used as rotational crops, the severity of soilborne pathogens (i.e., Rhizoctonia canker, black scurf, and common scab) was reduced by 18 to 38% along with incremental increases in tuber yield [36]. When brassicaceious seed meals were amended in soil inoculated with two soilborne nematodes (Pratylenchus penetrans and Meloidogyne incognita), plant-parasitic nematode populations were reduced by up to 90%, depending on the seed meal type and nematode species [37]. Similarly, in durum wheat, the use of Ethiopian mustard as a green manure reduced the development of Bipolaris sorokiniana, Microdochium nivale, and Fusarium culmorum by 41 to 100% and improved grain yield [38]. To our knowledge, the use of industrial hemp plant as a biofumigant has received little attention, apart from a study [39], which reported that fiber hemp reduced the population dynamics of Verticillium dahliae and Meloidogyne chitwoodi in greenhouse and field experiments.
In our study, we hypothesized that the use of hemp as a cover crop would reduce the soilborne pathogen abundance and the disease severity level compared to fallow or other cover crops. The abundance of the pathogens is usually positively correlated with the disease severity. In the 2022 greenhouse experiment, the hemp treatment significantly reduced Fusarium crown rot disease severity compared to the fallow and barley treatments. However, in the 2020 greenhouse experiment, the hemp treatment did not reduce disease severity compared to the fallow and barley treatments. The differences in findings between the two years may be likely due to the difference in cover crop assay methods and growing media used in the experiments. Cover crop roots were presented in the cover crop assay in 2020, while the cover crop roots were not presented in the biomass assay in 2022. The difference in results between the two years could also be due to the different wheat and hemp varieties used in the experiments. In addition, natural soil was used in 2020, and growing media in 2022. In the field data, according to the field qPCR results, there were no significant differences in the pathogen abundance among treatments. There are several possible explanations for the lack of treatment effects in pathogen abundance in field conditions. Firstly, the effects of the PSMs may have been diluted in the field. Assuming that the amount of PSMs secreted by an individual plant is approximately the same, the concentration of PSMs in the field would be much lower than that in the greenhouse due to the large volume differences of the soil. Significant effects could have been observed in the field, given more years of accumulation of the compounds. In addition, low disease pressure may have masked treatment effects in the field.
Our findings also underscore that several aspects could play a critical role when using hemp as a cover crop to reduce soilborne disease pressure in the wheat production system. Some aspects worth considering include hemp cover crop management practices and environmental conditions. For example, the hemp cover crop biomass should be fully decomposed before the wheat crop is sown to see a positive impact on disease suppression, allowing the availability of PSMs during critical time. Secondly, the termination of the cover crop should be timed in a way that beneficial microbes responsible for disease suppression are still active during wheat sowing time. Other aspects such as environmental conditions, soil type, and pathogen dynamics should be under consideration while using hemp as a cover crop. Nevertheless, this is the first study to document the potential of using hemp as a cover crop to suppress soilborne diseases in a wheat cropping system in the PNW.

5. Conclusions

This study documented the potential of using hemp as a cover crop to suppress soilborne diseases in a wheat cropping system in the PNW. While the study did not find evidence of hemp’s effectiveness in reducing soilborne diseases under field conditions, promising trends were observed in the greenhouse studies. Therefore, future studies should focus on understanding the roles of cover crop management practices and environmental conditions in disease suppression.

Author Contributions

Conceptualization, C.H.H., D.J.W. and T.P.; methodology, C.H.H., D.R.K. and G.F.N.; formal analysis, C.H.H., G.S. and N.W., investigation, C.H.H., G.S. and N.W.; resources, C.H.H. and T.P.; data curation, C.H.H., N.W., D.R.K. and G.F.N.; writing—original draft preparation, C.H.H., G.S. and N.W.; writing—review and editing, C.H.H., G.S., N.W., D.R.K. and G.F.N.; visualization, C.H.H. and N.W.; supervision, C.H.H., D.R.K. and G.F.N.; project administration, C.H.H. and T.P.; funding acquisition, C.H.H. and T.P. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by the USDA—ARS, Non-Assistance Cooperative Agreement number 58-5348-4-027 and the Agricultural Research Foundation.

Data Availability Statement

The original contributions presented in the study are included in the article, further inquiries can be directed to the corresponding author.

Acknowledgments

We thank the faculty and staff at the Columbia Basin Agricultural Research Center for assistance with operations. We thank Oregon State University’s Global Hemp Innovation Center for support and guidance.

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. Rehman, M.; Fahad, S.; Du, G.; Cheng, X.; Yang, Y.; Tang, K.; Liu, L.; Liu, F.-H.; Deng, G. Evaluation of hemp (Cannabis sativa L.) as an industrial crop: A review. Environ. Sci. Pollut. Res. 2021, 28, 52832–52843. [Google Scholar] [CrossRef]
  2. Public Law 113-79. An Act to Provide for the Reform and Continuation of Agricultural and Other Programs of the Department of Agriculture Through Fiscal Year 2018, and for Other Purposes. 2014. Available online: https://www.govinfo.gov/content/pkg/PLAW-113publ79/pdf/PLAW-113publ79.pdf (accessed on 18 October 2024).
  3. Johnson, R. Hemp as an Agricultural Commodity: Congressional Research Service. 2018. Available online: https://crsreports.congress.gov/product/pdf/R/R45525 (accessed on 23 December 2022).
  4. Ahmed, A.F.; Islam, M.Z.; Mahmud, M.S.; Sarker, M.E.; Islam, M.R. Hemp as a potential raw material toward a sustainable world: A review. Heliyon 2022, 8, e08753. [Google Scholar] [CrossRef] [PubMed]
  5. USDA NASS. National Hemp Report. 2022. Available online: https://downloads.usda.library.cornell.edu/usda-esmis/files/gf06h2430/xd07hw825/v692v917t/hempan22.pdf (accessed on 16 December 2022).
  6. USDA NASS. AGRI-FACTS. 2022. Available online: https://www.nass.usda.gov/Statistics_by_State/Regional_Office/Northwest/includes/Publications/Agri_facts/2022/AF05_1.pdf (accessed on 16 December 2022).
  7. Ehrensing, D.T. Feasibility of industrial hemp production in the United States Pacific Northwest. In Oregon State University Agricultural Experiment Station Bulletin SB681. 1998; Available online: https://ir.library.oregonstate.edu/concern/parent/j3860729t/file_sets/2b88qc644 (accessed on 4 December 2024).
  8. Steiner, J. Making Hemp a 21st Century Commodity in Oregon—and Beyond. Crops Soils 2021, 54, 24–31. [Google Scholar] [CrossRef]
  9. Jeliazkov, V.D.; Noller, J.S.; Angima, S.D.; Rondon, S.I.; Roseberg, R.J.; Summers, S.; Jones, G.B.; Sikora, V. What Is Industrial Hemp? Oregon State University Extension Service: Corvallis, OR, USA, 2019. [Google Scholar]
  10. Schillinger, W.F.; Papendick, R.I. Then and now: 125 years of dryland wheat farming in the Inland Pacific Northwest. Agron. J. 2008, 100, S-166. [Google Scholar] [CrossRef]
  11. Flores-Sanchez, I.J.; Verpoorte, R. Secondary metabolism in cannabis. Phytochem. Rev. 2008, 7, 615–639. [Google Scholar] [CrossRef]
  12. Jin, D.; Dai, K.; Xie, Z.; Chen, J. Secondary metabolites profiled in cannabis inflorescences, leaves, stem barks, and roots for medicinal purposes. Sci. Rep. 2020, 10, 3309. [Google Scholar] [CrossRef] [PubMed]
  13. Bourgaud, F.; Gravot, A.; Milesi, S.; Gontier, E. Production of plant secondary metabolites: A historical perspective. Plant Sci. 2001, 161, 839–851. [Google Scholar] [CrossRef]
  14. Tang, L.; Fan, C.; Yuan, H.; Wu, G.; Sun, J.; Zhang, S. The Effect of Rotational Cropping of Industrial Hemp (Cannabis sativa L.) on Rhizosphere Soil Microbial Communities. Agronomy 2022, 12, 2293. [Google Scholar] [CrossRef]
  15. Gilchrist-Saavedra, L. Practical Guide to the Identification of Selected Diseases of Wheat and Barley; International Maize and Wheat Improvement Center (CIMMYT): El Batán, Mexico, 1997. [Google Scholar]
  16. Rovira, A.D. The impact of soil and crop management practices on soil-borne root diseases and wheat yields. Soil Use Manag. 1990, 6, 195–200. [Google Scholar] [CrossRef]
  17. Smiley, R.W.; Cook, R.J.; Paulitz, T. Controlling Root and Crown Diseases of Small Grain Cereals. Controlling Root and Crown Diseases of Small Grain Cereals; Pacific Northwest Extension Publication PNW639; Oregon State University: Corvallis, OR, USA, 2002. [Google Scholar]
  18. Hagerty, C.H.; Lutcher, L.; McLaughlin, K.; Hayes, P.; Garland-Campbell, K.; Paulitz, T.C.; Graebner, R.C.; Kroese, D. Reaction of winter wheat and barley cultivars to Fusarium pseudograminearum-inoculated fields in the dryland Pacific Northwest, USA. Agrosyst. Geosci. Environ. 2021, 4, e20173. [Google Scholar] [CrossRef]
  19. University of Idaho. Principles of Vegetation Measurement and Assessment. Estimating Biomass. 2009. Available online: https://www.webpages.uidaho.edu/veg_measure/Modules/Lessons/Module%207(Biomass&Utilization)/7_4_Estimates%20Double%20Sampling.htm (accessed on 27 February 2022).
  20. Yin, C.; McLaughlin, K.; Paulitz, T.C.; Kroese, D.R.; Hagerty, C.H. Population dynamics of wheat root pathogens under different tillage systems in Northeast Oregon. Plant Dis. 2020, 104, 2649–2657. [Google Scholar] [CrossRef] [PubMed]
  21. Schroeder, K.L.; Okubara, P.A.; Tambong, J.T.; Lévesque, C.A.; Paulitz, T.C. Identification and quantification of pathogenic Pythium spp. from soils in eastern Washington using real-time polymerase chain reaction. Phytopathology 2006, 96, 637–647. [Google Scholar] [CrossRef]
  22. Okubara, P.A.; Schroeder, K.L.; Paulitz, T.C. Identification and quantification of Rhizoctonia solani and R. oryzae using real-time polymerase chain reaction. Phytopathology 2008, 98, 837–847. [Google Scholar] [CrossRef]
  23. R Development Core Team. R: A Language and Environment for Statistical Computing; R Foundation for Statistical Computing: Vienna, Austria, 2018. [Google Scholar]
  24. Zhang, Q.Y.; Li, Z.L.; Han, B.J.; Zhou, K.Q.; Hashemi, M.; Liu, X.B. Immediate responses of cyst nematode, soil-borne pathogens and soybean yield to one-season crop disturbance after continuous soybean in northeast China. Int. J. Plant Prod. 2013, 7, 341–354. [Google Scholar]
  25. Marquez, J.; Hajihassani, A. Successional effects of cover cropping and deep tillage on suppression of plant-parasitic nematodes and soilborne fungal pathogens. Pest Manag. Sci. 2023, 79, 2737–2747. [Google Scholar] [CrossRef] [PubMed]
  26. Gorchs, G.; Lloveras, J.; Serrano, L.; Cela, S. Hemp yields and its rotation effects on wheat under rainfed mediterranean conditions. Agron. J. 2017, 109, 1551–1560. [Google Scholar] [CrossRef]
  27. Mark, T.B.; Will, S. Economic issues and perspectives for industrial hemp. In Industrial Hemp as a Modern Commodity Crop; American Society of Agronomy Crop Science Society of America Soil Science Society of America: Madison, WI, USA, 2019; pp. 107–118. [Google Scholar]
  28. Makkar, H.P.; Siddhuraju, P.; Becker, K. Plant Secondary Metabolites; Humana Press: Totowa, NJ, USA, 2007; Volume 393, pp. 1–122. [Google Scholar]
  29. Yeshi, K.; Crayn, D.; Ritmejerytė, E.; Wangchuk, P. Plant secondary metabolites produced in response to abiotic stresses has potential application in pharmaceutical product development. Molecules 2022, 27, 313. [Google Scholar] [CrossRef]
  30. Peyravian, N.; Deo, S.; Daunert, S.; Jimenez, J.J. The Anti-Inflammatory Effects of Cannabidiol (CBD) on Acne. J. Inflamm. Res. 2022, 15, 2795. [Google Scholar] [CrossRef] [PubMed]
  31. Seltzer, E.S.; Watters, A.K.; MacKenzie, D., Jr.; Granat, L.M.; Zhang, D. Cannabidiol (CBD) as a promising anti-cancer drug. Cancers 2020, 12, 3203. [Google Scholar] [CrossRef] [PubMed]
  32. Golub, V.; Reddy, D. Cannabidiol therapy for refractory epilepsy and seizure disorders. Adv. Exp. Med. Biol. 2021, 1264, 93–110. [Google Scholar]
  33. Romero-Zerbo, S.Y.; García-Fernández, M.; Espinosa-Jiménez, V.; Pozo-Morales, M.; Escamilla-Sánchez, A.; Sánchez-Salido, L.; Lara, E.; Cobo-Vuilleumier, N.; Rafacho, A.; Olveira, G. The atypical cannabinoid Abn-CBD reduces inflammation and protects liver, pancreas, and adipose tissue in a mouse model of prediabetes and non-alcoholic fatty liver disease. Front. Endocrinol. 2020, 11, 103. [Google Scholar] [CrossRef] [PubMed]
  34. Benelli, G.; Pavela, R.; Petrelli, R.; Cappellacci, L.; Santini, G.; Fiorini, D.; Sut, S.; Dall’Acqua, S.; Canale, A.; Maggi, F. The essential oil from industrial hemp (Cannabis sativa L.) by-products as an effective tool for insect pest management in organic crops. Ind. Crops Prod. 2018, 122, 308–315. [Google Scholar] [CrossRef]
  35. Ahmed, M.; Peiwen, Q.; Gu, Z.; Liu, Y.; Sikandar, A.; Hussain, D.; Javeed, A.; Shafi, J.; Iqbal, M.F.; An, R. Insecticidal activity and biochemical composition of Citrullus colocynthis, Cannabis indica and Artemisia argyi extracts against cabbage aphid (Brevicoryne brassicae L.). Sci. Rep. 2020, 10, 522. [Google Scholar] [CrossRef] [PubMed]
  36. Larkin, R.P.; Griffin, T.S.; Honeycutt, C.W. Rotation and cover crop effects on soilborne potato diseases, tuber yield, and soil microbial communities. Plant Dis. 2010, 94, 1491–1502. [Google Scholar] [CrossRef] [PubMed]
  37. Zasada, I.; Meyer, S.; Morra, M. Brassicaceous seed meals as soil amendments to suppress the plant-parasitic nematodes Pratylenchus penetrans and Meloidogyne incognita. J. Nematol. 2009, 41, 221. [Google Scholar] [PubMed]
  38. Campanella, V.; Mandalà, C.; Angileri, V.; Miceli, C. Management of common root rot and Fusarium foot rot of wheat using Brassica carinata break crop green manure. Crop Prot. 2020, 130, 105073. [Google Scholar] [CrossRef]
  39. Kok, C.; Coenen, G.; De Heij, A. The effect of fibre hemp (Cannabis sativa L.) on selected soil-borne pathogens. J. Int. Hemp Assoc. 1994, 1, 6–9. [Google Scholar]
Agronomy 14 02978 g001
Figure 1. Boxplots of each treatment and relationship to Fusarium crown and root rot symptoms on winter wheat for the greenhouse cover crop assay. Red point indicates the mean. Boxes encompass the second and third quartiles. Within boxes, horizontal lines are medians. Whiskers indicate the 1.5 quartile range on either side of the box. Data beyond the ends of the whiskers are outliers and plotted as points. Post-hoc Tukey’s least significant difference. Treatments with the same letter are not significantly different (p > 0.05).
Figure 1. Boxplots of each treatment and relationship to Fusarium crown and root rot symptoms on winter wheat for the greenhouse cover crop assay. Red point indicates the mean. Boxes encompass the second and third quartiles. Within boxes, horizontal lines are medians. Whiskers indicate the 1.5 quartile range on either side of the box. Data beyond the ends of the whiskers are outliers and plotted as points. Post-hoc Tukey’s least significant difference. Treatments with the same letter are not significantly different (p > 0.05).
Agronomy 14 02978 g001
Agronomy 14 02978 g002
Figure 2. Boxplots of each cover crop treatment and relationship to Fusarium crown and root rot symptoms in the greenhouse biomass assay. Red point indicates the mean. Boxes encompass the second and third quartiles. Within boxes, horizontal lines are medians. Whiskers indicate the 1.5 quartile range on either side of the box. Data beyond the ends of the whiskers are outliers and plotted as points. Post-hoc Tukey’s least significant difference. Treatments with the same letter are not significantly different (p > 0.05).
Figure 2. Boxplots of each cover crop treatment and relationship to Fusarium crown and root rot symptoms in the greenhouse biomass assay. Red point indicates the mean. Boxes encompass the second and third quartiles. Within boxes, horizontal lines are medians. Whiskers indicate the 1.5 quartile range on either side of the box. Data beyond the ends of the whiskers are outliers and plotted as points. Post-hoc Tukey’s least significant difference. Treatments with the same letter are not significantly different (p > 0.05).
Agronomy 14 02978 g002
Agronomy 14 02978 g003
Figure 3. Boxplots of the relative quantification in arbitrary units (a.u.) of R. solani AG2-1, R. solani AG8, R. oryzae genotype III, P. abappressorium, P. irregulare group IV, P. ultimum, P. rostratifingens, F. culmorum, and F. pseudograminearum (y-axis) in wheat samples with cover crop treatments (x-axis) in the field trial 2021. Red point indicates the mean. Boxes encompass the second and third quartiles. Within boxes, horizontal lines are medians. Whiskers indicate the 1.5 quartile range on either side of the box. Data beyond the ends of the whiskers are outliers and plotted as points. Treatments are not significantly different (p > 0.05).
Figure 3. Boxplots of the relative quantification in arbitrary units (a.u.) of R. solani AG2-1, R. solani AG8, R. oryzae genotype III, P. abappressorium, P. irregulare group IV, P. ultimum, P. rostratifingens, F. culmorum, and F. pseudograminearum (y-axis) in wheat samples with cover crop treatments (x-axis) in the field trial 2021. Red point indicates the mean. Boxes encompass the second and third quartiles. Within boxes, horizontal lines are medians. Whiskers indicate the 1.5 quartile range on either side of the box. Data beyond the ends of the whiskers are outliers and plotted as points. Treatments are not significantly different (p > 0.05).
Agronomy 14 02978 g003
Agronomy 14 02978 g004
Figure 4. Boxplots of the relative quantification in arbitrary units (a.u.) of F. culmorum and F. pseudograminearum (y-axis) in wheat samples with cover crop treatments (x-axis) in the field trial 2022. Red point indicates the mean. Boxes encompass the second and third quartiles. Within boxes, horizontal lines are medians. Whiskers indicate the 1.5 quartile range on either side of the box. Data beyond the ends of the whiskers are outliers and plotted as points. Treatments are not significantly different (p > 0.05).
Figure 4. Boxplots of the relative quantification in arbitrary units (a.u.) of F. culmorum and F. pseudograminearum (y-axis) in wheat samples with cover crop treatments (x-axis) in the field trial 2022. Red point indicates the mean. Boxes encompass the second and third quartiles. Within boxes, horizontal lines are medians. Whiskers indicate the 1.5 quartile range on either side of the box. Data beyond the ends of the whiskers are outliers and plotted as points. Treatments are not significantly different (p > 0.05).
Agronomy 14 02978 g004
Agronomy 14 02978 g005
Figure 5. Boxplots of winter wheat cash crop yield for each treatment in years 2021 and 2022. Red point indicates the mean. Boxes encompass the second and third quartiles. Within boxes, horizontal lines are medians. Whiskers indicate the 1.5 quartile range on either side of the box. Treatments are not significantly different (p > 0.05).
Figure 5. Boxplots of winter wheat cash crop yield for each treatment in years 2021 and 2022. Red point indicates the mean. Boxes encompass the second and third quartiles. Within boxes, horizontal lines are medians. Whiskers indicate the 1.5 quartile range on either side of the box. Treatments are not significantly different (p > 0.05).
Agronomy 14 02978 g005
Table 1. Fungal and oomycete pathogen species-specific primers used for qPCR assay.
Table 1. Fungal and oomycete pathogen species-specific primers used for qPCR assay.
SpeciesPrimerSequence (5′-3′)Amplicon Size (bp)Reference
Fusarium culmorumFCKY648945_FAGTACCACTGCATCCCAACC120[20]
FCKY648945_RCTTCTCGATGGTTCGCTTGT
F. pseudograminearumFPKY927890_F GTGTCAATCAGTCACTAACAACC 194[20]
FPKY927890_R GAGGACAATAGTGACAACATACC
Pythium ultimum ULT1F GACACTGGAACGGGAGTCAGC 414[21]
ULT4R AAAGGACTCGACAGATTCTCGATC
P. irregulare group IV IIV7F GTATCGTCTTGGCGGAGTGG 370[21]
ABA1R TGCATAAACGAATATACCAACCGC
P. abappressoriumABA1bFGTTGTTGTGCGTCTGCGGATTTG397[21]
ABA1RTGCATAAACGAATATACCAACCGC
P. rostratifingensPROSF2GCGCAGATAGAGAGACTGATTTGG100[21]
PROSR2ACTACCAACACACACACACACACG
Rhizoctonia oryzae genotype IIIRoGr3FCTGTTGAAACCGGTTTACTATG286[22]
RoGr3RCTTCCAAGTCCAAATACAACAATC
R. solani AG 8Rs8FGGGGGAATTTATTCATTTATTGGAC327[22]
Rs8RGGTGTGAAGCTGCAAAAG
R. solani AG 2–1AG2-1FGTTGTAGCTGGCCCATTCATTTG123[22]
AG2-1RCCTATTGCCTTTGTATTCCAAAAAGC
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Hagerty, C.H.; Shrestha, G.; Wen, N.; Kroese, D.R.; Namdar, G.F.; Paulitz, T.; Wysocki, D.J. Hemp Cover Cropping and Disease Suppression in Winter Wheat of the Dryland Pacific Northwest. Agronomy 2024, 14, 2978. https://doi.org/10.3390/agronomy14122978

AMA Style

Hagerty CH, Shrestha G, Wen N, Kroese DR, Namdar GF, Paulitz T, Wysocki DJ. Hemp Cover Cropping and Disease Suppression in Winter Wheat of the Dryland Pacific Northwest. Agronomy. 2024; 14(12):2978. https://doi.org/10.3390/agronomy14122978

Chicago/Turabian Style

Hagerty, Christina H., Govinda Shrestha, Nuan Wen, Duncan R. Kroese, Grayson F. Namdar, Tim Paulitz, and Donald J. Wysocki. 2024. "Hemp Cover Cropping and Disease Suppression in Winter Wheat of the Dryland Pacific Northwest" Agronomy 14, no. 12: 2978. https://doi.org/10.3390/agronomy14122978

APA Style

Hagerty, C. H., Shrestha, G., Wen, N., Kroese, D. R., Namdar, G. F., Paulitz, T., & Wysocki, D. J. (2024). Hemp Cover Cropping and Disease Suppression in Winter Wheat of the Dryland Pacific Northwest. Agronomy, 14(12), 2978. https://doi.org/10.3390/agronomy14122978

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop