Next Article in Journal
Winter Greenhouse Tomato Cultivation: Matching Leaf Pruning and Supplementary Lighting for Improved Yield and Precocity
Previous Article in Journal
Can Basic Soil Quality Indicators and Topography Explain the Spatial Variability in Agricultural Fields Observed from Drone Orthomosaics?
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Enzymatic and Molecular Identification of Meloidogyne Species in Tomato Orchards in Paraguay

by
Gloria Resquín-Romero
1,*,
Vanessa S. Mattos
2,
Jessica M. S. Monteiro
2,
Horacio D. Lopez-Nicora
3,
Shyrley P. Amarilla
4,
Sergio Chamorro-Diaz
1,
Juan Moral
5 and
Regina M. D. G. Carneiro
2,*
1
Area of Protection Vegetal, Faculty of Agrarian Sciences, National University of Asunción, San Lorenzo 1055, Paraguay
2
Nematology Laboratory, Embrapa Recursos Genéticos e Biotecnologia, Brasília 70849-979, DF, Brazil
3
Department of Plant Pathology, The Ohio State University, Columbus, OH 43210, USA
4
Department of Pathological Sciences, Faculty of Veterinary Sciences, National University of Asunción, San Lorenzo 1055, Paraguay
5
Unit of Excellence Maria de Maeztu, Department of Agronomy, University of Córdoba, 14003 Córdoba, Spain
*
Authors to whom correspondence should be addressed.
Agronomy 2023, 13(3), 670; https://doi.org/10.3390/agronomy13030670
Submission received: 6 October 2022 / Revised: 25 January 2023 / Accepted: 17 February 2023 / Published: 25 February 2023
(This article belongs to the Section Pest and Disease Management)

Abstract

Tomato is a major crop in Paraguay, where it provides a source of employment and income for households. Tomato production can be affected by root-knot nematodes, especially Meloidogyne spp. The unequivocal identification of Meloidogyne spp. in Paraguay has not been conducted yet. This study aims to identify Meloidogyne species in eight tomato production districts of this country by biochemical and molecular techniques. Females of Meloidogyne spp. were extracted from tomato roots and characterized using esterase isozyme phenotypes. In addition, DNA was extracted from nematode eggs, and species-specific SCARs (sequence-characterized amplified regions) were used to confirm the diagnosis. Nematodes were detected in 100% of studied samples (prevalence), of which M. incognita (Est: I2, Rm: 1.1;1.2) and M. javanica (Est: J3, Rm: 1.0, 1.20, 1.35) were present in 39.13% and 26.08% of samples, respectively. One population (8.69%) of Meloidogyne sp. presenting an atypical esterase profile (Rm: 1.0 and 1.3) was only detected in Julián Augusto Saldívar District. Mixed populations, mostly M. incognita and M. javanica, were observed in 26.08% of samples. The SCAR primers incK14F/incK14R amplified specific fragments for M. incognita (399 bp) and M. javanica (670 bp), confirming the enzymatic results. Here, we present the first study of root-knot nematode identification at the species level in Paraguay.

1. Introduction

Tomato is an important crop in Paraguay and occupies a prominent position in the food security of this country, providing employment and income for households. During 2015 and 2017, Paraguayan orchards produced 55 million kg of tomatoes in 1390 ha [1]. In this country, tomato is grown mainly by smallholder rural families, who participate in the production and commercialization of this crop. Unfortunately, many abiotic and biotic factors can adversely impact tomato production, including plant-parasitic nematodes. Root-knot nematodes (RKN) are among the most economically significant tomato pests; remarkably, the genus Meloidogyne is distributed worldwide [2,3,4,5].
RKN are sedentary parasites that attack the tomato root vascular system, leading to host nutrient deprivation and impaired water transport, causing aboveground symptoms of stunting, wilting, chlorosis, and reduced crop yields. Integrated pest management practices remain an effective strategy to maintain RKN population densities below damage thresholds. However, smallholder tomato growers must first recognize the presence of such a threat in their tomato production. Moreover, a correct diagnosis of the RKN species present in the orchard is essential for adequate pathogen management, including cultivar selection [4,6]. Because over 100 Meloidogyne species have been reported [7], their identification at the species level remains challenging for many researchers [6]. There are specific preventive strategies that can be included in a nematode management plan, such as the use of resistant plants to control different Meloidogyne species [8]. Both enzymatic and molecular techniques have been commonly used to improve the accuracy of RKN species diagnosis.
Esterase phenotyping has been used to identify Meloidogyne species and has been proven to be species-specific in many cases [9,10]. In addition, specific sequence characterized amplified region (SCAR) markers have been successfully developed to diagnose the dominant tropical root-knot nematodes associated with important crops such as tomato, coffee, guava, and grapevine; these nematodes include M. javanica [11], M. arenaria [11], M. incognita [12], M. paranaensis, M. exigua [12], M. enterolobii [13], M. arabicida, M. izalcoensis [14], and M. ethiopica [15].
Several plant-parasitic nematode species have been reported in Paraguay [16,17,18]. However, these latter studies were conducted based only on the perineal pattern morphology of the nematodes: they allowed the identification of the species M. incognita and M. javanica affecting lettuce (Lactuca sativa) in the Central Department [19] and peanuts (Arachis hypogaea) in Conolinias Mennonitas, Chaco, Paraguay [17], respectively. However, relying only on morphological characteristics to identify root-knot nematode species can lead to misdiagnoses. The available literature on Meloidogyne species in Paraguay needs to be updated and clarified. The objective of this study was to identify Meloidogyne species from small-scale orchards in seven tomato-producing departments in Paraguay using enzymatic and molecular methods.

2. Materials and Methods

2.1. Sampling Collection and Nematode Extraction

From 2015 to 2017, eight tomato orchards were surveyed, and various plant roots with knot samples were collected. The studied orchards are distributed in seven departments of Paraguay. One or two districts were arbitrarily selected within each department, and within those districts, two or three orchards were chosen for sample collection. Samples were collected from the district of Julian Augusto Saldivar, Central Department (JAS); San Pedro de Ycuamandiyu, San Pedro (SPY); Tobati, Cordillera (TC); Yaguaron, Paraguari (YP); San Juan Bautista, Misiones (SJB); San Ignacio, Misiones (SIM); San Cosme y Damian, Itapua (SCD); and Coronel Oviedo, Caaguazu (CO) (Figure 1).
The studied orchards had been planted with tomatoes for at least five consecutive seasons. Three tomato plants exhibiting aboveground symptoms of nematode damage from each orchard were randomly selected and uprooted. If root galls were present, suggesting root-knot nematode infection, roots were collected, placed in labeled plastic sample bags, and transported to the laboratory in insulated containers. Upon arrival at the laboratory, samples were kept at 4 °C until processed.

2.2. Morphological, Biochemical, and Molecular Characterization

Samples were processed in the laboratory of “Área de Protección Vegetal” (Facultad de Ciencias Agrarias, Universidad Nacional de Asunción) in Paraguay and the Laboratory of Nematology (EMBRAPA-CENARGEN, Brasília, DF) in Brazil. First, female nematodes were carefully excised from the plant tissue; perineal patterns were cut according to Hartman and Sasser (1985) [20] and cleaned with lactic acid. Finally, the perineal patterns were mounted in glycerin on glass slides, viewed, and photographed with a bright field light microscope equipped with AxioCam ICc1 digital camera and ZEN imaging software (Carl Zeiss, Germany).

2.3. Identification of Meloidogyne spp. by Esterase Phenotype

Additionally, single young female nematodes were extracted from tomato roots and identified by esterase phenotype according to the method described by Carneiro and Almeida (2001) [9]. Briefly, females were placed in glass microtubes containing 5 μL of extraction solution Sucrose/Triton X-100 (20 g saccharose and glycerol, 1cc Triton X-100, and 100 mL distilled water) and macerated with the use of a syringe Hamilton Syringe (volume 25 μL, needle size 22s ga (blunt tip), needle L 51 mm [2 in]). Electrophoresis was conducted in 7% polyacrylamide gels run in a horizontal CL18 Permatron gel tank. Isoenzymes were electrophoresed for 2 h at 4 °C and 80 volts. The 10 exemplars of Meloidogyne javanica (J3; Rm: 1.0, 1.3, and 1.4) were used as a gels reference.

2.4. DNA Extraction

Nematode genomic DNA was extracted from eggs collected from infected tomato roots using the method described in Carneiro et al. (2004) [21]. Cleaned eggs were concentrated and kept in sterile water suspension. Total genomic DNA was extracted and purified from 200 μL aliquots of egg suspension for each population following the method described by Randig et al. (2002) [12]. Species-specific SCAR primers (Table 1) were used individually or in multiplex polymerase chain reactions (PCR). All reactions were performed in 25 μL volume, containing 2 μL of genomic DNA (3 ng·μL−1), 1 μL (10 μM) of each primer, 4 μL of each dNTP (1.25 mM of dATP, dTTP, dGTP and dCTP; Invitrogen), 2.5 μL of 1× reaction buffer + MgCl2 (Phoneutria Biotecnologia & Serviços, Belo Horizonte, Brazil), 1-unit Taq DNA polymerase (Phoneutria Biotecnologia & Serviços, Belo Horizonte, Brazil), and 14.25 μL purified water. The PCR reactions were run in a T100TM thermal cycler (Bio-Rad), with thermal conditions as follows: 5 min at 94 °C, 35 cycles of 30 s at 94 °C, 45 s at 62 °C, 1 min at 70 °C, and a final extension step of 8 min at 70 °C. For multiplex reactions, the conditions used were as described by Silva et al. (2013) [22]. A universal pair of primers (18S nuclear rDNA primer (Mel F/R) was used to confirm the quality of the DNA extractions. The amplification products were electrophoresed on a 1.5% agarose gel, stained with ethidium bromide (0.3 μg·mL−1), and visualized under UV light. Each sample was processed at least twice.

2.5. Perineal Patterns

The perineal patterns were mounted in glycerine on glass slides, viewed, and photographed with a bright orchard light microscope equipped with an AxioCam ICc1 camera and ZEN imaging V 4.7 software (Zeiss, Oberkochen, Germany).

3. Results

3.1. Identification of Meloidogyne spp. by Esterase Phenotype

Overall, Meloidogyne species (RKN) were found (prevalence 100%) in all the samples analyzed from the San Pedro, Central, Paraguari, Misiones, Itapua, and Caaguazu of Paraguay (Table 2).
Species identification through enzymatic characterization by the esterase phenotype (Figure 2) method showed the presence of M. incognita (Est: I2, Rm: 1.1; 1.2) in 39.13% of surveyed orchards. Also, the species M. javanica (Est: J3, Rm: 1.0, 1.20, 1.35) and mix populations (M. incognita and M. javanica) were detected in 26.08% of the orchards. Interestingly, a species that presented an atypical esterase profile (Rm: 1.0 and 1.3) was observed in 8.69% of the samples; these correspond to the Central Department—Julián Augusto Saldívar District (Table 2).

3.2. Morphological, Biochemical, and Molecular Characterization

In order to confirm the esterase results, species-specific primers designed for M. incognita and M. javanica were tested in all the populations, including the atypical one (no amplification was detected—data not shown). The SCAR primers incK14F/incK14R [12] and Fjav/Rjav [11] amplified specific fragments for M. incognita (399 bp) and M. javanica (670 bp) confirming the enzymatic results. Mixed populations of M. incognita and M. javanica were also detected in a multiplex reaction (Figure 3). Although the perineal patterns were characteristic of M. javanica and M. incognita in our study, enzymatic and molecular approaches were essential for their identification (10). Unfortunately, population 3 (Meloidogyne sp.) could not be successfully reproduced in the greenhouse without further investigations. Here, we obtained RKN females of all samples, and perennial pattern morphology suggested the presence of M. incognita and M. javanica.

3.3. Perineal Patterns

Root-knot nematode females were retrieved from all samples. Perennial pattern morphology suggested the presence of M. incognita and/or M. javanica (Figure 4 and Figure 5).

4. Discussion

Yield reduction in small-scale tomato growers due to root-knot nematode (RKN) damage in Paraguay is of growing concern. Although the producers can indirectly recognize nematode presence in the orchards, they need to identify the species, limiting them from implementing adequate management strategies. On the other hand, biochemical and molecular techniques currently improve the accuracy of RKN species identification. Therefore, this study aimed to identify Meloidogyne species from small-scale orchards in seven tomato-producing Departments in Paraguay.
Unfortunately, a 100% prevalence of Meloidogyne spp. was displayed in all the samples analyzed from the San Pedro, Central, Paraguari, Misiones, Itapua, and Caaguazu of Paraguay. Our results agree with the recent report of Lopez-Nicora et al. (2022) [23], who described the genus Meloidogyne spp. as the most abundant nematode in vegetable orchards from Paraguay. Besides, it highlights that the population densities of Meloidogyne spp. in Misiones, Alto Paraná, Central, Paraguarí, and Caaguazú probably affect tomato production in Paraguay. Additionally, according to Jones et al. (2013) [24], Meloidogyne spp. is one of the three most significant nematodes due to the strong negative impact it causes on the economy. Likewise, the American Phytopathology Society estimated a 14% loss in crop yield, equivalent to approximately 125 billion dollars per year [25,26].
A loss in yield in tomato crops infected with M. incognita is estimated between 12% and 41%, with population densities of 1000 to 5000 nematodes/plant [27]. Previous studies in Paraguay on plant parasitic nematodes in tomatoes have focused on controlling them in greenhouses [28]. A recent report aimed to determine the prevalence and abundance of phytoparasitic nematodes in orchards in 37 vegetable orchards in nine Paraguay Departments only described the nematode population at the genus level. These authors highlighted the need for and importance of characterizing the most prevalent plant-parasitic nematodes described in their study to species level [22,28].
It is known that the dominant Mi-1.2 gene in tomato confers resistance to the three most important RKN species M. incognita, M. javanica, and M. arenaria, and minor species—M. ethiopica, M. hispanica, and M. luci, infect various crops in Brazil (8). Hence, the importance of identifying the different species of Meloidogyne.
Despite the importance of the tomato crop and RKN for Paraguayan agriculture, unequivocal information on nematode identification and species distribution in Paraguay is only now becoming available. For example, M. incognita was previously reported in lettuce [19]; while M. javanica was only described as affecting peanuts [17]. The identification of Meloidogyne spp. in these studies has relied upon the characterization of adult female perineal patterns using several morphometric and morphological features of juveniles. However, it is possible to confuse M. incognita with other related species (e.g., M. paranaensis, M. izalcoensis, and M. inornate) attending the female perineal pattern [8,10]. Here, we obtained RKN females of all samples [20], and perennial pattern morphology suggested the presence of M. incognita and M. javanica. Meloidogyne is a genus of obligated plant parasites with species distributed worldwide, with the ability to infect almost every vascular plant, both under protected agriculture, in greenhouses or the field. Major Meloidogyne species are M. arenaria, M. incognita, M. javanica, and M. hapla [24,29]. Although they have a broad host crop selection, the most economically important crops are soybean, cereals, tomato, potato, and other solanaceous and tubercules [9,28,30].
Mixed populations of M. incognita and M. javanica were also detected in a multiplex reaction and a population with unknown esterase phenotype (EST 1.0 and 1.3); unfortunately, further investigations could not be carried out. Although several reports coincide with our findings, future research, and studies may complement our results and provide a broader view of nematode diversity in Paraguay [10,25].
The study has displayed that esterase phenotypes make possible the identification of both Meloidogyne species and atypical populations. Furthermore, we confirmed the results obtained by esterase characterization using SCAR markers (INCK14 F/R (12); and Fjav/Rjav, [11] designed for M. incognita and M. javanica, respectively. This study represents the first identification report of RKNs to species level using enzymatic (esterase phenotypes) and DNA-based molecular (PCR-SCAR) methods from small-scale tomato orchards in Paraguay. Finally, control of parasitic nematodes depends on detection ability and accurate diagnosis of nematode species to choose suitable and sustainable management methods. Therefore, research aimed at identifying nematode species using enzymatic and molecular techniques will have a tremendous positive impact on tomato crops in the future.

5. Conclusions

Our study is the first in Paraguay to identify root-knot nematode species using esterase phenotypes and SCAR markers.
Two species were identified M. javanica and M. incognita, with predominance in all the sampled localities, and an atypical Meloidogyne species.

Author Contributions

Conceptualization and designed the experiments, G.R.-R. and R.M.D.G.C.; methodology and conducted the experiments, G.R.-R., V.S.M. and J.M.S.M.; analyzed the data V.S.M., J.M.S.M. and S.C.-D., and data curation R.M.D.G.C.; writing—original draft preparation, G.R.-R., supervision, H.D.L.-N., J.M., S.P.A. and V.S.M. All authors have read and agreed to the published version of the manuscript.

Funding

This research received no external funding.

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Ethical review and approval were waived for this study due to conducted test involving unprotected plants and microorganisms. All applicable international, national, and/or institutional guidelines for the care and use of animals were followed.

Data Availability Statement

Data are available by contacting G.R.R.

Acknowledgments

The first author thanks the National Council of Science and Technology (CONACYT, Paraguay) for the supported travel costs for this research and the Laboratory of Nematology (EMBRAPA-CENARGEN) (Brasília, DF, Brazil) for identifying the Meloidogyne species. J.M. is a Ramon y Cajal fellowship (RYC2019-028404-I) launched by the Spanish government (MICIN). The funders had no role in the study design, data collection, data analysis, decision to publish, or preparation of the manuscript.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Direction of Census and Agricultural Statistics—Department of Statistics, 2016/2017, Paraguay. Available online: https://www.academia.edu/41573866/S%C3%8DNTESIS_ESTAD%C3%8DSTICAS_PRODUCCI%C3%93N_AGROPECUARIA_2016_2017 (accessed on 1 January 2022).
  2. Moens, M.; Perry, R.N.; Starr, J.L. Meloidogyne species—A diverse group of novel and important plant parasites. In Root-Knot Nematodes; Perry, R.N., Moens, M., Starr, J.L., Eds.; CAB International: Wallingford, UK, 2009; pp. 1–17. [Google Scholar]
  3. Huang, W.K.; Sun, J.H.; Cui, J.K.; Wang, G.F.; Kong, L.A.; Peng, H.; Chen, S.L.; Peng, D.L. Efficacy Evaluation of Fungus Syncephalastrum racemosum and Nematicide Avermectin against the Root-Knot Nematode Meloidogyne incognita on Cucumber. PLoS ONE 2014, 9, e89717. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  4. Carneiro, R.M.D.G.; Monteiro, J.; Silva, U.C.; Gomes, G. Genero Meloidogyne: Diagnose através de electroforese de isoenzimas e marcadores SCAR. In Diagnose de Fitonematoides; Oliveira, C.M.G., Dos Santos, M.A., Castro, L.H.S., Eds.; Camara Brasileira do livro: Pinheiros, Brazil, 2016; pp. 48–70. [Google Scholar]
  5. Tapia-Vázquez, I.; Montoya-Martínez, A.C.; De los Santos-Villalobos, S.; Ek-Ramos, M.J.; Montesinos-Matías, R.; Martínez-Anaya, C. Root-knot nematodes (Meloidogyne spp.) a threat to agriculture in Mexico: Biology, current control strategies, and perspectives. J. Microbiol. Biotechnol. 2022, 38, 26. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  6. Blok, V.C.; Powers, T.O. Biochemical and molecular identification. In Root Knot Nematodes, 1st ed.; Perry, R.N., Moens, M., Star, J., Eds.; CABI International: London, UK, 2009; pp. 98–112. [Google Scholar]
  7. Hunt, D.; Handoo, Z.A. Taxonomy, identification and principal species. In Root-Knot Nematodes; Perry, R.N., Moens, M., Star, J., Eds.; CABI: Wallingford, UK, 2009; pp. 55–97. [Google Scholar] [CrossRef] [Scilit]
  8. Gabriel, M.; Kulczynski, M.; Muniz, M.F.B.; Boiteux, L.S.; Carneiro, R.M.D.G. Resistance of ‘Debora Plus’ tomato bearing Mi-1.2 gene/locus against fifteen Meloidogyne species. Plant Pathol. 2020, 69, 944–952. [Google Scholar] [CrossRef] [Scilit]
  9. Carneiro, R.M.D.G.; Almeida, M.R.A. Técnica de eletroforese usada no estudo de enzimas dos nematoides das galhas para identificação de especies. Nematol. Bras. 2001, 25, 35–44. [Google Scholar]
  10. Carneiro, R.M.D.G.; Cofcewicz, E.T. Taxonomy of coffee-parasitic root-knot nematodes, Meloidogyne spp. In Plant Parasitic Nematodes of Coffee; Souza, R.M., Ed.; Springer: New York, NY, USA, 2008; pp. 87–122. [Google Scholar] [CrossRef] [Scilit]
  11. Zijlstra, C.; Donkers-Venne, D.T.H.M.; Fargette, M. Identification of Meloidogyne incognita, M. javanica and M. arenaria using sequence characterised amplified region (SCAR) based PCR assays. Nematology 2000, 2, 847–883. [Google Scholar]
  12. Randig, O.; Bongiovanni, M.; Carneiro, R.M.D.G.; Castagnone-Sereno, P. Genetic diversity of root knot nematodes from Brazil and development of SCAR markers specific for the coffee-damaging species. Genome 2002, 45, 862–870. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  13. Tigano, M.; Siqueira, K.; Castagnone-Sereno, P.; Mulet, K.; Queiroz, P.; Santos, M.; Teixeira, C.; Almeida, M.; Silva, J.; Carneiro, R.M.D.G. Genetic diversity of the root-knot nematode Meloidogyne enterolobii and development of a SCAR marker for this guava-damaging species. Plant Pathol. 2010, 59, 1054–1061. [Google Scholar] [CrossRef] [Scilit]
  14. Correa, V.R.; Santos, M.F.A.; Almeida, M.R.A.; Peixoto, J.R.; Castagnone-Sereno, P.; Carneiro, R.M.D.G. Species-specific DNA markers for identification of two root-knot nematodes of coffee: Meloidogyne arabicida and M. izalcoensis. Eur. J. Plant Pathol. 2013, 137, 305–313. [Google Scholar] [CrossRef] [Scilit]
  15. Correa, V.R.; Mattos, V.S.; Almeida, M.R.A.; Santos, M.F.A.; Tigano, M.S.; Castagnone-Sereno, P.; Carneiro, R.M.D.G. Genetic diversity of the root-knot nematode Meloidogyne ethiopica and development of a species-specific SCAR marker for its diagnosis. J. Plant Pathol. 2014, 63, 476–483. [Google Scholar] [CrossRef] [Scilit]
  16. Valiente, A.R. Nematodos de Las Plantas, Morfología (Biología) y Control de Nematodos. Facultad de Ciencias Agrarias de la Universidad Nacional de Asunción (FCA/UNA/JICA); 2010; 978-99953-912-2-5. Available online: https://isbn.cloud/9789995391225/nematodos-de-plantas/ (accessed on 1 January 2022).
  17. Lordello, R.R.A.; Lordello, A.I.L.; Godoy, I.J. Occurrence of Meloidogyne javanica parasiting roots and nodules of peanuts in Paraguay. Bragantia 1997, 56, 87–89. [Google Scholar] [CrossRef] [Scilit]
  18. Lopez-Nicora, H.; Pedrozo, L.M.; Grabowski, C.; Orrego Fuente, A.; Villalba, E.H.; Ralston, T. First Report of the Reniform Nematode (Rotylenchulus reniformis) from Soybean in Paraguay. Plant Dis. 2018, 102, 2043. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  19. Soilan-Duarte, L.C.; Orrego-Fuente, A.L. Fuente. Identificación de la especie del nemátodo de las agallas Meloidogyne en el cultivo de lechuga (Lactuca sativa L.). In III Congreso Nacional de Ciencias Agrarias “Producción Sostenible de Alimentos Para el Desarrollo de Paraguay”; 2014; ISSN/ISBN: 978-9996. Available online: https://www.agr.una.py/descargas/publicaciones/IIICNCA2014.pdf (accessed on 1 January 2022).
  20. Hartman, K.M.; Sasser, J.N. Identification of Meloidogyne species on the basis of differential host test and perineal pattern morphology. In An Advanced Treatise on Meloidogyne; Barker, K.R., Carter, C.C., Sasser, J.N., Eds.; North Carolina State University Graphics: Raleigh, NC, USA, 1985; pp. 69–77. [Google Scholar]
  21. Carneiro, R.M.D.G.; Tigano, M.S.; Almeida, M.R.A.; Sarah, J.L. Identification and genetic diversity of Meloidogyne spp. on coffee from Brazil, Central America and Hawaii. Nematology 2004, 6, 287–298. [Google Scholar] [CrossRef] [Scilit]
  22. Silva, J.G.; Furlanetto, C.; Almeida, M.R.; Rocha, D.B.; Mattos, V.S.; Correa, V.R.; Carneiro, R.M. Occurrence of Meloidogyne spp. in Cerrado vegetations and reaction of native plants to Meloidogyne javanica. J. Phytopathol. 2013, 162, 449–455. [Google Scholar] [CrossRef] [Scilit]
  23. Lopez-Nicora, H.; Enciso-Maldonado, G.C.; Caballero Mairesse, G.; Sanabria-Velazquez, A.; Armadans-Rojas, A.; Soilan, L.; Grabowski, C.; Resquin-Romero, G.; Colmán, A.; Pedrozo-Fleitas, L.M.; et al. Distribution and abundance of nematodes in horticultural production in Paraguay. Plant Health Prog. 2022, 23, 466–475. [Google Scholar] [CrossRef] [Scilit]
  24. Jones, J.T.; Haegeman, A.; Danchin, E.G.J.; Gaur, H.S.; Helder, J.; Jones, M.G.K.; Taisei Kikuchi, J.; Manzanilla-López, R.; Palomares-Rius, J.E.; Wesemael, W.L.; et al. Top 10 plant-parasitic nematodes in molecular plant pathology. Mol. J. Plant Pathol. 2013, 14, 946–961. [Google Scholar] [CrossRef] [Scilit]
  25. Chitwood, D.J. Research on plant-parasitic nematode biology conducted by the United States department of agriculture agricultural research service. Pest Manag. Sci. Former. Pestic. Sci. 2003, 753, 748–753. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  26. Mesa-Valle, C.M.; Garrido-Cárdenas, J.A.; Cebrián-Carmona, J.; Talavera, M.; Manzano-Agugliaro, F. Investigación global sobre nematodos vegetales. Agronomía 2020, 10, 1148. [Google Scholar] [CrossRef] [Scilit]
  27. Inés-Vásquez, S.; Aquino-Bolaños, T. Biocontrol y Tolerancia de Meloidogyne incognita en Tomate. Southwest. Entomol. 2021, 45, 957–964. [Google Scholar] [CrossRef] [Scilit]
  28. Arrúa-Alvarenga, A.; Aquino-Jara, A. Effect of solarization on sclerotia of Sclerotinia sclerotiorum (Lib.) De Bary, and the fluctuation of the population of nematodes present in the soil. Investig. Agrar. 2013, 7, 5–11. [Google Scholar]
  29. Wesemael, W.M.L.; Viaene, N.; Moens, M. Root-knot nematodes (Meloidogyne spp.) in Europe. Nematology 2011, 13, 3–16. [Google Scholar] [CrossRef] [Scilit]
  30. Sikandar, A.; Zhang, M.Y.; Wang, Y.Y.; Zhu, X.F.; Liu, X.Y.; Fan, H.Y.; Xuan, Y.H.; Chen, L.J.; Duan, Y.X. Review article: Meloidogyne incognita (root-knot nematode) a risk to agriculture. Appl. Ecol. Environ. Res. 2020, 18, 1679–1690. [Google Scholar] [CrossRef] [Scilit]
Figure 1. Illustrative map of location and collection of samples to identify species of Meloidogyne.
Figure 1. Illustrative map of location and collection of samples to identify species of Meloidogyne.
Agronomy 13 00670 g001
Figure 2. Three esterase phenotypes (EST) found in eight populations of Meloidogyne spp. collected in Paraguay. I2 = Meloidogyne incognita/J3 = M. javanica/M.sp.2 = M. sp. M. javanica (J3*) was used as reference in the gel.
Figure 2. Three esterase phenotypes (EST) found in eight populations of Meloidogyne spp. collected in Paraguay. I2 = Meloidogyne incognita/J3 = M. javanica/M.sp.2 = M. sp. M. javanica (J3*) was used as reference in the gel.
Agronomy 13 00670 g002
Figure 3. PCR amplification with primers for M. incognita (incK14F/incK14R) and M. javanica (Fjav/Rjav) for seven populations of Meloidogyne spp. collected in Central Paraguay. Samples’ codes: 1, 2, 4, 5, 6, 7, and 8 (Table 2). I+ = positive control for M. incognita/J+ = positive control for M. javanica. M = molecular marker 1kb plus Invitrogen.
Figure 3. PCR amplification with primers for M. incognita (incK14F/incK14R) and M. javanica (Fjav/Rjav) for seven populations of Meloidogyne spp. collected in Central Paraguay. Samples’ codes: 1, 2, 4, 5, 6, 7, and 8 (Table 2). I+ = positive control for M. incognita/J+ = positive control for M. javanica. M = molecular marker 1kb plus Invitrogen.
Agronomy 13 00670 g003
Figure 4. Identification of species Meloidogyne based on the perineal pattern’s morphology of females (a,c) Meloidogyne javanica, (b,d) Meloidogyne incognita.
Figure 4. Identification of species Meloidogyne based on the perineal pattern’s morphology of females (a,c) Meloidogyne javanica, (b,d) Meloidogyne incognita.
Agronomy 13 00670 g004
Figure 5. Identification of species Meloidogyne based on the morphology of second instar larvae and male adults (a,b), juvenile of second instar larvae (ce) and male adults of Meloidogyne incognita (f,g).
Figure 5. Identification of species Meloidogyne based on the morphology of second instar larvae and male adults (a,b), juvenile of second instar larvae (ce) and male adults of Meloidogyne incognita (f,g).
Agronomy 13 00670 g005aAgronomy 13 00670 g005b
Table 1. Primers used in the reactions PCR-SCAR to identify Meloidogyne spp. from Paraguay.
Table 1. Primers used in the reactions PCR-SCAR to identify Meloidogyne spp. from Paraguay.
Primer SCARSequence (5′–3′)Amplification (bp)ReferenceTarget Species
inc-K14-F
inc-K14-R
GGGATGTGTAAATGCTCCTG CCCGCTACACCCTCAACTTC399[12]M. incognita
Fjav
Rjav
GGTGCGCGATTGAACTGAGC CAGGCCCTTCAGTGGAACTATAC670[11]M. javanica
Table 2. Meloidogyne spp. identified by esterase phenotypes (EST) and SCAR markers in Paraguay.
Table 2. Meloidogyne spp. identified by esterase phenotypes (EST) and SCAR markers in Paraguay.
Origin
Department
SamplesIdentification of Meloidogyne spp.
CodeDistrictTotal, SamplesSpeciesIdentification
SCAR/Esterase (EST.)
Perennial Pattern Morphology
1San PedroSPY3M. incognita + M. javanica Mi + MjEST I2 + EST J3M. incognita + M. javanica
2CordilleraTC 3M. incognita + M. javanica Mi + MjEST I2 + EST J3M. incognita + M. javanica
3CentralJAS2Meloidogyne sp.no amplification Atypical (EST 1.0 and 1.3) Meloidogyne sp.
4ParaguaríYP3M. javanicaMjEST J3M. javanica
5MisionesSJB3M. incognitaMiEST I2 M. incognita
6MisionesSIM3M. javanicaMjEST J3M. javanica
7ItapuaSCD3M. incognitaMiEST I2 M. incognita
8CaaguazuCO3M. incognitaMi EST I2M. incognita
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Resquín-Romero, G.; Mattos, V.S.; Monteiro, J.M.S.; Lopez-Nicora, H.D.; Amarilla, S.P.; Chamorro-Diaz, S.; Moral, J.; Carneiro, R.M.D.G. Enzymatic and Molecular Identification of Meloidogyne Species in Tomato Orchards in Paraguay. Agronomy 2023, 13, 670. https://doi.org/10.3390/agronomy13030670

AMA Style

Resquín-Romero G, Mattos VS, Monteiro JMS, Lopez-Nicora HD, Amarilla SP, Chamorro-Diaz S, Moral J, Carneiro RMDG. Enzymatic and Molecular Identification of Meloidogyne Species in Tomato Orchards in Paraguay. Agronomy. 2023; 13(3):670. https://doi.org/10.3390/agronomy13030670

Chicago/Turabian Style

Resquín-Romero, Gloria, Vanessa S. Mattos, Jessica M. S. Monteiro, Horacio D. Lopez-Nicora, Shyrley P. Amarilla, Sergio Chamorro-Diaz, Juan Moral, and Regina M. D. G. Carneiro. 2023. "Enzymatic and Molecular Identification of Meloidogyne Species in Tomato Orchards in Paraguay" Agronomy 13, no. 3: 670. https://doi.org/10.3390/agronomy13030670

APA Style

Resquín-Romero, G., Mattos, V. S., Monteiro, J. M. S., Lopez-Nicora, H. D., Amarilla, S. P., Chamorro-Diaz, S., Moral, J., & Carneiro, R. M. D. G. (2023). Enzymatic and Molecular Identification of Meloidogyne Species in Tomato Orchards in Paraguay. Agronomy, 13(3), 670. https://doi.org/10.3390/agronomy13030670

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop