Next Article in Journal
Diversity of Chemical Composition and Morphological Traits of Eight Iranian Wild Salvia Species during the First Step of Domestication
Previous Article in Journal
Spatial Variation in Soil Physico-Chemical Properties along Slope Position in a Small Agricultural Watershed Scale
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Agronomy
Volume 12
Issue 10
10.3390/agronomy12102458
agronomy-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Application of Light-Emitting Diodes with Plant Growth-Promoting Rhizobacteria and Arbuscular Mycorrhiza Fungi for Tomato Seedling Production

by
Apisit Songsaeng
1,
Panlada Tittabutr
1,
Kamolchanok Umnajkitikorn
2,
Nantakorn Boonkerd
1,
Jenjira Wongdee
1,
Pongpan Songwattana
1,
Pongdet Piromyou
1,
Teerana Greetatorn
1,
Teerayoot Girdthai
2,* and
Neung Teaumroong
1,*
1
School of Biotechnology, Institute of Agricultural Technology, Suranaree University of Technology, Nakhon Ratchasima 30000, Thailand
2
School of Crop Production Technology, Institute of Agricultural Technology, Suranaree University of Technology, Nakhon Ratchasima 30000, Thailand
*
Authors to whom correspondence should be addressed.
Agronomy 2022, 12(10), 2458; https://doi.org/10.3390/agronomy12102458
Submission received: 12 September 2022 / Revised: 5 October 2022 / Accepted: 7 October 2022 / Published: 10 October 2022
Browse Figures
Review Reports Versions Notes

Abstract

:
Various technologies, such as light-emitting diodes (LEDs) and beneficial plant micro-organisms, have been applied to enhance plant growth and development. We aimed to develop appropriate technology by incorporating the benefits of LED light, plant growth promoting rhizobacteria (PGPR), and arbuscular mycorrhiza fungi (AMF) into sweet girl cherry tomato (Solanum lycopersicum L.) seedling production. Our results demonstrated that incorporating red (R) and blue (B) LED lights, PGPR, and AMF positively affected tomato seedling growth. The optimal lighting conditions for tomato seedling growth were LEDs at 200 µmol/m2/s with a ratio of R60:B40 and 20 h/d exposure. The optimum LED-illuminated tomato seedlings significantly upregulated photosynthesis-related genes, including psbA, psbB, fdx, atpB, and rbcL. Plants inoculated with PGPR Bradyrhizobium sp. SUTN9-2, Bacillus velezensis SD10 and B. megaterium A20 had a high health index after inoculation. Furthermore, the optimized LED-illuminated tomato seedlings inoculated with SD10 had the highest health index. In addition, the optimum LED-illuminated tomato seedlings inoculated with SD10 and AMF had the highest biomass. Our experiment demonstrated that tomato seedlings produced under optimized LED lights inoculated with SD10 and AMF increased yield by about 16% under field conditions. Therefore, these results provided the optimum conditions for a high-quality tomato seedling production system.

1. Introduction

Tomato (Solanum lycopersicum L.) is an important economic crop in many countries, with broad genetic diversity and forms of consumption, including fresh consumption and processing. Cherry tomatoes are widely planted and consumed. Problems with seed germination and seedling vigor are common in old seeds and seeds germinated under unsuitable conditions. Most commercial hybrid seeds are expensive, especially the pure-line parents developed for different varieties, which often limits germination and seedling vigor.
Artificial light technology is being developed to control the light properties required by plants. It is mainly used for planting in a place with insufficient light. It has been used to stimulate plant growth by supplementing specific wavelengths of light to plants. The general type of lamp used for planting under closed systems is a light-emitting diode (LED) lamp. LED lamps are low-temperature, have no disadvantages to plant growth, and can adjust for several wavelengths. Previous reports have shown that planting under the appropriate ratio between red (R) and blue (B) light can stimulate seed germination, growth, productivity, and quality in many crop species [1,2,3,4]. LED lights can also stimulate plants’ resistance to pathogens [5]. LED lamp wavelengths affect seedling quality. Under red light, red leaf lettuce showed a higher leaf area and fresh weight than blue light or a mixture of red and blue light [6].
Plant-associated microbes with symbionts have shown the potential to improve plant growth. These beneficial micro-organisms can be applied to the agricultural system as biofertilizers, bioherbicides, biopesticides, and biocontrol agents [7]. Using microbes or their metabolites increases yield and plant nutrient uptake, controls pests, and mitigates plant stress responses [8]. Maize growth has increased due to stimulation by bacterial species [9]. Additionally, arbuscular mycorrhiza fungi (AMF) are the microbes considered natural biofertilizers, because AMF provide the host with water, nutrients in exchange for photosynthetic products, and pathogen protection [10]. Tomato co-inoculated with AMF and Trichoderma had increased growth [11]. Co-inoculated AMF and Trichoderma also positively affect tomato seedling growth [12]. However, no study has investigated the combination of LED light and microbes promoting tomato growth.
Therefore, LED light technology and beneficial micro-organisms may be applied to tomato seedling production systems to enhance the health of seedlings. The cherry-type tomato was used in this study. We explored the optimum conditions for high-quality tomato seedling production using LED light technology and beneficial micro-organisms.

2. Materials and Methods

2.1. Plant Materials

We used the cherry tomato (Solanum lycopersicum L.), a sweet girl variety, in this study. The seeds were surface-sterilized by 95% ethanol for 10 s, then washed with 3% sodium hypochlorite (NaOCl) for 12 min, washed in sterilized water eight times, and soaked in sterilized water for 2 h. The seeds were sown and germinated in seed trays containing sterilized peat moss. Afterward, the seed tray of tomatoes was placed under lighting conditions for 14 days.

2.2. Investigation of the Optimum LED Light Condition

The seed tray was placed under an LED red and blue spectrum to determine the optimum lighting conditions. The suitable light intensity of the seedlings was determined using a ratio of 50:50% between red and blue light at 50, 100, 200, 300, 400, and 500 µmole/m2/s, fluorescent light (Philips TL-D 36 W/865 1 SL/25) at 150 µmol/m2/s (illuminated for 12 h/day), and greenhouse conditions with ambient light as a control. Then, we used the selected light intensity to find the specific light ratio for the seedling grown. The light ratio was investigated using various LED ratios between red and blue at R80:B20, R60:B40, R50:B50, R40:B60, and R20:B80 (exposed for 12 h/d). Then, suitable light intensities and ratios were used to find the specific photoperiod for seedling growth. We examined the seedlings during different photoperiods. The seeds were treated under LED or fluorescent light illumination for 14, 18, 20, and 24 h/day, and in greenhouse conditions as a control. We recorded the results after the tomatoes were grown grew for 14 days.

2.3. Determination of the Tomato Seedling Growth

We verified plant growth in the tomato seedlings 14 days after planting. The seedling was investigated with some parameters, including the shoot height, stem diameter, and root length. We determined the total fresh and dry weights. At the same time, the leaf area was measured with a leaf area meter (10 plants/replication for four replications) and for chlorophyll content with a chlorophyll meter (SPAD). We also determined the health index (HI), which is a tool for assessing parameters that directly affect the survival and growth of plants after transplanting. We followed a health index according to Fan [13] with the following formula
Health index = (Stem diameter/Stem height) × Dry weight.

2.4. Detection of H2O2 Accumulation and Antioxidant Enzyme Activities

The tomato seedlings were planted under optimized LED lighting conditions of 200 µmole/m2/s and R60:B40 at 20 h/d for 14 days. Then, the tomato seedlings were treated under optimized LED light for 3 h. The control tomato seedling treatment was planted in the greenhouse for 14 days and exposed to sunlight under greenhouse conditions for 3 h. The leaves were cut and soaked in 1 mg/mL of DAB (3,3′-Diaminobenzidine) solution (pH 3.8) for 12 h in darkness. Subsequently, we boiled the leaves in 95% ethanol for 10 min and examined H2O2 production in the leaves [14]. We investigated the superoxide dismutase (SOD) activity with the method described by Muneer [15].

2.5. Gene Reference Selection and Primers Design

We investigated the genes related to tomato photosynthesis (rbcL, rbcS, atpB, fdx, psbA, and psbB genes) at the relative expression level. The gene references (GCA_000188115.3) were obtained from an NCBI database for designing specific primers. We obtained the designed primer from a study by Wu et al. [16] and Guo et al. [17], and performed it using Snap Gene Viewer 5.1.4.1 (Table 1).

2.6. Preparation of Plant Sample for RNA Extraction and Gene Expressions Analysis

The tomato seedlings were planted under optimized LED lighting conditions of 200 µmole/m2/s and R60:B40 at 20 h/day for 14 days. Then, the tomato seedlings were treated under optimized LED light for 3 h. The control tomato seedling treatment was planted in a greenhouse for 14 days and exposed to sunlight under greenhouse conditions for 3 h. The leaves were cut and ground in liquid nitrogen using a sterilized mortar and pestle to create the powder. One hundred milligrams powdered were quickly transferred into 1.5 mL tubes for total RNA extraction. Total RNA extraction was extracted using the FavorPrep Plant Total RNA Purification Mini Kit following the manufacturer’s protocol. We converted 500 ng of total RNA to cDNA using the iScriptTM cDNA Synthesis Kit. The cDNA sample was diluted 10-fold using DI typeI for qPCR analysis (the qPCR component for 10 µL reaction: 5 µL Luna® Universal qPCR Master Mix, 0.1 µL of forwarding primer (10 uM), 0.1 µL of reward primer (10 uM), 1 µL of cDNA template, and 3.8 µL of nuclease-free water). The relative gene expressions (rbcL, rcbS, atpB, fdx, psbA, and psbB) were detected using the qPCR method and calculated using Applied Biosystem, QuantStudio Design (Spectronic 200, Thermo Scientific, Waltham, MA, USA) (the conditions: initial denaturation at 95 °C for 5 min (denaturation at 95 °C for 30 s, and extension at 95 °C for 30 s for 40 cycles)). We analyzed relative gene expression using the comparative Ct method (−ΔΔCT), and actin (ACT) as the control to normalize qPCR results [18].

2.7. Effect of PGPR Inoculation on Seedling Growth

We used bacterial strains, including Bradyrhizobium sp. SUTN9-2 (JN578804.1), Pseudomonas sp. SUT19 (HQ230346), Bacillus velezensis S141 (AP018402.1), Bacillus megaterium A20 (MT597980), Shinella sp. Ch12 (ON342887), Bacillus velezensis SD10 (ON342885), Pseudomonas aeruginosa Cat697 (ON342886), and Enterobacter sp. 3D13 (ON342888), to investigate the effect of PGPR strains on seedling growth. We investigated the PGPR characteristics, including indole-3-acetic acid (IAA) production [19], nitrogen fixation (screening by growth in LG N-free medium agar), 1-aminocyclopropane-1-carboxylic acid (ACC) deaminase production [20], phosphate solubilization [21], and biocontrol as antagonistic bacteria (Tables S1 and S2) [22]. The sterilized seeds were inoculated with PGPR strains. We prepared the PGPR inoculants by culturing SUT19, S141, A20, Ch12, 3D13, Cat697, and SD10 in Luria–Bertani (LB) medium, whereas SUTN9-2 was cultured in yeast-mannitol (YM) medium at 150 rpm at 30 °C, for 24 h and for 5 days, respectively. The cell culture was centrifuged at 4000 rpm for 10 min and the supernatant was discarded. Then, the cell pellet was washed in 0.85% NaCl twice and the cell density was adjusted to 1.0 for OD600. The cell suspension was diluted 10-fold using DI sterilized water as the diluent. Afterward, the sterilized seeds were inoculated with cell suspension (by soaking the seeds in the cell suspension for 10 min). The seeds were planted in a seed tray containing sterilized peat moss, incubated, and planted in a darkroom for 48 h. They were then placed a greenhouse with non-inoculated tomato seedlings as the control. The plant growth promotion result was recorded when the tomatoes had grown for 14 days.

2.8. Effect of PGPR Inoculation on Tomatoes under Different Light Conditions

We used Bradyrhizobium sp. SUTN9-2 and B. velezensis SD10 in this experiment. SUTN9-2 and SD10 were inoculated with tomato under three conditions: greenhouse, fluorescent light exposed for 18 h/day, and optimized LED light. Our experiment was divided into nine treatments, including greenhouse (GR control), greenhouse inoculated Bradyrhizobium sp. SUTN9-2 (GR SUTN9-2), greenhouse inoculated B. velezensis SD10 (GR SD10), fluorescent (Flu control), fluorescent inoculated Bradyrhizobium sp. SUTN 9-2 (Flu SUTN9-2), fluorescent inoculated B. velezensis SD10 (GR SD10), LED (LED control), LED inoculated Bradyrhizobium sp. SUTN9-2 (LED SUTN9-2), and LED inoculated B. velezensis SD10 (LED SD10). The sterilized seed and cell suspensions were created with Methods 2.1 and 2.7, respectively. Afterward, the sterilized seeds were inoculated with cell suspension by soaking them in the cell suspension for 10 min. The seeds were planted in the tray containing sterilized peat moss, incubated in a darkroom for 48 h, and exposed to lighting conditions. The plant growth promotion results were recorded when the tomatoes had grown for 14 days.

2.9. Effect of AMF on Tomato Seedling Growth

Our experiment was divided into six treatments, including tomato seedlings grown in a greenhouse (control), tomato seedlings inoculated with B. velezensis SD10 grown in a greenhouse (con/SD10), tomato seedlings grown in a greenhouse and inoculated with Rhizophagus irregularis (AMF) (con/AMF), tomato seedlings grown in a greenhouse and inoculated with SD10 + AMF (con/SD10/AMF), tomato seedlings exposed to LED light (LED), tomato seedling inoculated with SD10 exposed to LED light (LED/SD10), tomato seedlings exposed to LED light and inoculated with AMF (LED/AMF), and tomato seedlings exposed to LED light and inoculated with SD10 + AMF (LED/SD10/AMF). A total of 500 AMF spores were inoculated per plant. The treatments were planted in a Leonard jar containing sterilized vermiculite (1 plant/pot, for four replications) using Hoagland solution (half-strength phosphate) applied from Kaur [23] and placed under greenhouse conditions. We measured tomato growth from plant height, stem diameter, shoot fresh weight, root fresh weight, shoot dry weight, root dry weight, total fresh weight, total dry weight, chlorophyll content, and root colonization [24]. These parameters were determined 30 days after being planted in the Leonard jar.

2.10. Evaluation of Tomato Fruit Yield Production

Tomato seedlings were produced under optimized lighting conditions (LED light at 200 µmole/m2/s, R60:B40, 20 h/D, inoculated with SD10 and AMF at 14 days) and tomato were seedlings produced in greenhouse conditions at 14 days (control). Afterward, they were transferred to the experimental field (soil characteristics: pH 7.12, OM 0.63%, EC 0.1397 ms/cm, N 0.032%, P 83.35 mg/kg, K 184.10 mg/kg, Ca 4242.5 mg/kg, Mg 486 mg/kg, Fe 62 mg/kg, Zn 2.95 mg/kg, Cu 7.65 mg/kg, and Mn 13.05 mg/kg). We added 5 kg of filter cake and 2.5 kg of organic fertilizer per square meter. The tomato seedlings were planted in three replications (15 plants/replication, distance 50 × 50 cm). The tomato was managed with urea (0.5 g/plant for a week) and pesticides (according to product instructions) for growth and plant disease prevention. We recorded the tomato yield, including fruit number and weight, upon ripening at 76 days and continued for another 30 days (harvested seven times, period 3–5 days/time).

2.11. Statistical Analysis

Mean values and standard error were analyzed using SPSS software (SPSS version 26.0 Windows; SPSS Inc., Chicago, IL, USA). Mean comparisons were conducted using Duncan’s multiple range test and independent sample t-test (for enzyme activity and gene expression), with p < 0.05.

3. Results

3.1. Effect of Different Light Intensity on Tomato Seedling Growth

The highest plant height was found under greenhouse (control) conditions, which differed significantly from fluorescent and LED light conditions. Meanwhile, total fresh weight was slightly increased when planted under LED light at 200 and 300 µmol/m2/s compared to control. The tomato seedlings exposed to LED lights >300 or <200 µmol/m2/s and fluorescent light had decreased total fresh weight. In addition, root length and total dry weight were increased when grown under LED lights >200 µmol/m2/s compared to control. The tomato seedlings treated under LED light intensity >100 µmol/m2/s were found to not differ significantly in stem diameter compared to control. The stem diameter was reduced when exposed to LED light at 50 µmol/m2/s or fluorescent light compared to control. Furthermore, under LED light at 50 µmol/m2/s, the leaf area was significantly reduced compared to other treatments. The chlorophyll content was higher under fluorescent or LED lights at ≥50 µmol/m2/s; most of the chlorophyll content found under LED light at 500 µmol/m2/s was significantly different compared to control. Then, these data were used to calculate the tomato health index of seedlings, focusing on the high health index to define the optimal lighting conditions. A high health index was found under LED light intensities at 200, 300, 400, and 500 µmol/m2/s, which differed significantly from the control. These results indicated that LED light at 200 µmol/m2/s is the most appropriate for tomato seedling growth (Table 2).

3.2. The Effect of Red (R) and Blue (B) Light Ratios on the Tomato Seedling Growth

The highest health index was found under the LED light ratio R60:B40, followed by the light ratio R50:B50. The health index was significantly lower under the LED light ratios R80:B20, R40:B60, and R20:B80 compared to R60:B40 and R50:B50. Thus, the LED light ratio R60:B40 was the best ratio for tomato seedling growth (Figure 1).

3.3. Effects of Light Photoperiod on Tomato Seedlings Growth

The fluorescent light illuminated the tomato seedling for 18 h/day or longer. LED-illuminated tomato seedlings were ≥14 h/day, which significantly increased the health index compared to control. When the tomato seedlings were exposed to fluorescent light for 14 h/day, the health index was similar to the control. However, the tomato seedlings grown under LED light 24 h/day had the highest health index, but did not differ significantly from LED light 20 h/day. Our results illustrated that the tomato seedlings grown under LED light at 200 µmol/m2/s, a ratio of R60:B40, and irradiated for 20 h/day had the highest health index. These results refer to optimized lighting conditions. Increasing the light photoperiod to ≥20 h/day did not affect the health index (Figure 2). The phenotype of the tomato seedlings is displayed in Figure 3.

3.4. H2O2 Accumulation, SOD Activity Assay, and Photosynthetic Gene Expression in Leaves

The hydrogen peroxide staining showed that the tomato leaves were dark brown when exposed to LED light, whereas the tomato leaves from a seedling planted under greenhouse conditions displayed white (Figure 4a). SOD activity increased 1.8-fold in tomato seedlings grown under LED lights compared to those grown under greenhouse conditions (Figure 4b). These results revealed that the LED light induces H2O2 and SOD activity accumulations in tomato leaves. Moreover, the expression of photosynthetic genes, including rbcL, fdx, atpB, psbA, and psbB was significantly upregulated when tomato seedlings were treated under LED light (2.6, 3.1, 2.0, 5.0, and 2.6-fold, respectively) compared to those grown under greenhouse conditions. By contrast, the rbcS gene expression did not differ significantly from tomato seedlings grown under greenhouse conditions. Therefore, photosynthesis-related genes, including rbcL, rbcS, fdx, atpB, psbA, and psbB, transcriptionally increased under optimized LED light conditions (Figure 4c).

3.5. The Effect of PGPR on the Tomato Seedling Growth

Tomatoes inoculated with Bradyrhizobium sp. SUTN9-2 had the highest health index, followed by inoculation with B. velezensis SD10 and B. megaterium A20, which differed significantly from the control. Tomatoes inoculated with Pseudomonas sp. SUT19, B. velezensis S141, Shinella sp. Ch12, Enterobacter sp. 3D13, and P. aeruginosa Cat697 had a significantly reduced health index compared to control. These results suggested that SUTN9-2, SD10, and A20 could promote tomato seedling growth (Figure 5).

3.6. Effect of PGPR on Tomato Seedlings under Different Lighting Conditions

The high health index was used to determine PGPR strains’ ability to promote seedling growth under artificial light. We found that the health index slightly increased when tomato seedlings were inoculated with Bradyrhizobium sp. SUTN9-2 and B. velezensis SD10 under three light conditions. Nevertheless, it did not differ significantly from non-inoculated seedlings, except for SUTN9-2 with tomato seedlings under fluorescent light. However, tomato seedlings grown under LED light had a higher health index than those grown under greenhouse conditions and fluorescent light. The highest health index was found with SD10 inoculation of tomato seedlings grown under optimized LED light. Our results demonstrated that light affected tomato seedling growth more than PGPR (Figure 6).

3.7. Effects of PGPR Inoculation on LED-illuminated Tomato Seedlings and AMF on Tomato Seedling Growth under Greenhouse Conditions

The plant height, shoot fresh weight, and total fresh weight significantly increased in tomato seedlings inoculated with SD10 alone or SD10 + Rhizophagus irregularis (AMF) and AMF alone compared to the control. LED-illuminated seedlings inoculated with SD10 + AMF had a higher stem diameter, shoot fresh weight, root fresh weight, shoot dry weight, root dry weight, total fresh weight, and total dry weight. We determined that AMF root colonization showed the highest colonization in root tomato seedlings inoculated with AMF and grown under greenhouse conditions. By contrast, root colonization was significantly reduced when the tomato seedlings were inoculated with SD10 + AMF and grown in a greenhouse. Furthermore, the colonization of AMF under illuminated LED tomato root seedlings showed the same trend as in the greenhouse. Our results demonstrated that SD10 alone or SD10 + AMF inoculation of tomato seedlings promotes tomato seedling growth. LED-illuminated seedlings inoculated with SD10 + AMF grew well compared to other treatments (Figure 7 and Table 3).

3.8. Evaluation of Tomato Fruit Yield Production

The harvesting yield from tomato seedlings produced in a greenhouse had a fresh fruit weight of 953 g/plant, while the fruit number was 72.2 fruits/plant. The optimized LED-illuminated tomato seedlings were inoculated with B. velezensis SD10 for 14 days and inoculated with AMF before planting in the field. The fresh fruit weight yield was 1105 g/plant, and the fruit number was 76.9 fruits/plant. However, the seedlings grown under greenhouse conditions had a higher fruit weight and number than LED-illuminated tomato seedlings inoculated with SD10 and AMF during the first to third harvest times, whereas the fourth harvest time had almost the same yield. In the fifth and sixth harvest times, we found that LED-illuminated tomato seedlings inoculated with SD10 and AMF had a significantly higher fruit weight than seedlings grown under greenhouse conditions. However, the fruit number slightly increased in the sixth harvest time. Nevertheless, at the seventh harvest time, we found that fruit weight derived from optimized LED-illuminated tomato seedlings inoculated with SD10 and AMF had a higher fruit weight and number than seedlings grown under greenhouse conditions. Fruit weight and number increased by 16 and 7.98%, respectively (Figure 8).

4. Discussion

Most plants require red- and blue-emitting lights for photosynthesis. However, changes in the light intensity [25,26], light ratios [27,28], and photoperiods [29,30] received by plants affect growth and development. Previous reports have shown that blue light can transform cryptochrome into its active form and has an inhibitory effect on hypocotyl elongation [31,32]. Plant height was reduced when exposed to increased light intensity [33]. Plant height increased under low light conditions, possibly due to limited photosynthesis under insufficient lighting conditions. The tomato height significantly increased when planted without blue light or in low blue light conditions [34]. Therefore, the short stems under LED and fluorescent light may promote more blue light intensity and a higher ratio than in the greenhouse, inhibiting stem elongation. Young tomato seedling’ fresh weight, dry weight, and health index significantly increased when exposed to red and blue LEDs ≥300 µmol/m2/s. The light intensity of 300 µmol/m2/s was suitable for growing young tomatoes, whereas a light intensity >300 µmol/m2/s decreased photosynthetic efficiency [13]. Yao [3] reported that LED light <400 µmol/m2/s led to the accumulation of biomass and photosynthesis products. The low intensity may result in limited photosynthesis. By contrast, the increased light intensity can induce plant stress and inhibit photosynthesis [35,36]. Our results suggested that an LED of 200 µmol/m2/s was suitable for planting tomato seedlings. This light intensity is sufficient and suitable for tomato seedlings’ growth and development, resulting in a high health index. The plant can adapt to light intensity by reducing exposure to the leaf area [26,37].
The red and blue light play a role in regulating plant growth and development. High gibberellin production induced by red light leads to the stem elongation of Picea abies (L.) Karst [38]. The height of tomato plants significantly increased when exposed to red light alone or red combined with blue in a ratio of 10:1. However, the photosynthesis rate significantly reduced when grown under a single red light [34]. In addition, lettuce, spinach, and radish were planted under an increased amount of red light, which negatively affected biomass accumulation [39]. A light ratio of R70:B30 or R60:B40 results in the efficient photosynthesis of Gerbera jamesonii [40]. Similarly, the combination of red and blue light at a ratio of R75%:B25% or blue light alone promotes genes involved in photosynthesis and enzymatic activity related to the Cavin cycle in sweet peppers better than red light alone [41]. Therefore, we recommend that the combination of red with blue light at a ratio of R60:B40 is suitable for the photosynthesis of tomato seedlings. By contrast, exposure to more particular wavelengths alone may negatively affect the photosynthesis of seedlings thus reducing the amount of chlorophyll and biomass accumulated and decreasing the health index.
In terms of light photoperiods on tomato seedlings, many plant processes were affected by the gene network’s response to changes in the photoperiod cycle [42]. Exposure to light beyond the saturation point decreases biomass accumulation in plants [43]. The growth, chlorophyll content, and carbohydrate accumulation of Sulhyang and Maehyang were reduced when planted with exposure >20 h/day [44]. The tomato seedlings grown under optimal light intensities and light ratios from LED light (200 µmol/m2/s, R60:B40) and illuminated for 20 h/day underwent the optimal conditions for growth (Figure 2). These conditions may represent the seedling’s saturation point. The parameters did not increase or even decrease during prolonged exposure, which may result from the plant receiving light over the saturation point, negatively affecting seedlings.
The high SOD activity might have been a mechanism responding to the light stress of tomatoes from the LED lighting conditions. It also induced a high H2O2 accumulation in tomato leaves, referred to as brown leaves. Blue light-induced ROS production and SOD activity also occurred [45,46]. The psbB gene CP47 encodes the CP47 protein, whose main function is the inner light-harvesting complex, which it drives in the form of excitation energy to photochemical reaction proteins (D1, D2 proteins) [47,48]. The shorter wavelength green and blue LED lights induced the expression of pebA and psbB genes in Synechococcus sp. [49]. The psbA gene encodes the D1 protein, one of the core proteins in the PSII reaction center [50]. Although light is necessary for photosynthesis, unsuitable light conditions lead to PSII damage, referred to as photoinhibition. Photoinhibition occurs when the damage rate exceeds the PSII repair rate. The D1 protein is highly sensitive to photodamage [51,52]. The light quality controls the transcription level rate on the chloroplast genome as psbA and psbB [53]. A low light intensity of red and blue light (50, 100 µmol/m2/s) increases photosynthesis-related genes, including Lhcb4.2, Lhcb6, psbA, psbB, and psbD genes. Increasing these genes may a strategy to protect photosynthetic machinery and enhance the system’s potential [54]. Therefore, light-induced the psbA mRNA is triggered by D1 damage, whereas photosynthesis products trigger an increase in translation elongation rate [55].
The fdx gene encodes ferredoxin protein production. Ferredoxins play important roles in the electron transport chain of photosynthesis, CO2 assimilation, nitrate, sulfate, and other metabolites [56,57,58]. Previous studies reported that light regulates the ferredoxin gene expression in plants such as Arabidopsis thaliana., Nicotiana tabacum L., and Pisum sativum L. [59,60]. The ferredoxin gene shows the highest expression in Codonopsis lanceolata seedlings when treated under red and blue light. Blue and red lights regulate the abundance of fdx expression [61]. Therefore, LED light conditions can upregulate the dx gene. A higher fdx expression enhances NADPH synthesis in the photosynthetic system. High NADPH levels lead to photosynthesis, resulting in high biomass. The atpB gene encodes the β-subunit of ATP synthase. Oxidative stress causes the degradation of RbcL and atpB proteins [62]. The atpB and expression respond to light quality [63,64]. Therefore, the upregulation of fdx and atpB genes may be induced by LED light conditions. Higher fdx and atpB expression enhances NADPH and ATP synthesis in the photosynthetic system.
Ribulose-1,5-bisphosphate carboxylase/oxygenase (RuBisCO) is encoded by the rbcL and rbcS genes, and has large and small subunits [65,66]. Increased rbcL and rbcS mRNA may have been induced by light. An abundance of rbcL and rbcS proteins were found when peas were illuminated by light [67]. The ribulose-1,5-bisphosphate carboxylase small subunits’ mRNA and enzymes were increased by illumination [68]. Higher RuBisCo activity was found when chili seedlings were treated with blue or a combination of red and blue light. Meanwhile, the red and blue light combination results in the highest biomass [41]. Similarly, the Codonopsis lanceolata seedlings were exposed to red and blue light, significantly upregulating rbcL [61]. This study suggested that the significant upregulation of rbcL was also found in tomato seedlings treated under LED light conditions. rbcS expression slightly increased under LED lights. Our results revealed that the optimized LED lights may influence rbcL and rbcS gene expressions. High rbcL and rbcS mRNA levels lead to carbohydrate synthesis and biomass accumulation in tomato seedlings.
Possible reasons why PGPR increased the health index may be related to various beneficial PGPR mechanisms inoculated into seedlings (Tables S1 and S2). PGPR enhances the absorption of nutrients needed for photosynthesis and protein synthesis of plant seedlings. During plant growth, certain substances are released through the roots called root exudate [69]. Root exudates affect the microbial population surrounding the roots [70,71]. Previous reports suggested that light quality and intensity affect the quantity and components of root exudates [72,73]. Therefore, the root exudates’ transformation under different lighting conditions may influence PGPR metabolite variants, affecting the growth of different tomato seedlings.
Seedling inoculation with R. irregularis (AMF) was performed under different conditions. Increases of biomass or changes in various seedlings’ development may be attributed to SD10 and AMF activity and the properties associated with their metabolites, such as ACC deaminase production, plant hormone production, phosphate dissolving, and adsorption enhancement of water and various plant nutrients. Inoculation with PGPR and AMF alone or together promoted the growth and photosynthesis of tobacco by regulating various metabolites [74]. Co-inoculation with Bacillus megaterium and Funneliformis mosseae effectively promoted biomass accumulation and developed the shoots and roots of Elymus nutans Griseb [75]. However, the reduced root colonization in AMF was attributable to the influence of SD10. SD10 may inhibit AMF growth and infestation in tomato roots because one of its characteristics is biocontrol. The number of AMF/unit/root lengths was significantly reduced when Pseudomonas putida KT2440 was inoculated with R. irregularis in Mercato plants [76].
The fruit yield in the field experiment of tomato seedlings at 30 days indicated that seedlings produced under optimized LED light conditions and inoculated with SD10 + AMF had a 16% increase in fruit weight. This increased yield might be attributed to a 7.98% increase in fruit number compared to greenhouse yield. The red and blue LED light ratios directly affected cherry tomato seedlings’ growth and reproductive growth [77]. The AMF inoculation of Prunella vulgaris has been reported to increase flowering [78]. Inoculation with AMF Glomus mosseae accelerates flowering and fruit development and increases tomato yield [79]. Inoculation with rhizobium, PGPR, and AMF, alone or combined, promotes Vicia faba L. and Triticum durum L. yields [80]. Therefore, the combination of LED light with PGPR and AMF inoculant could be used to promote seedling growth. Nevertheless, laser-based technology has also been used in agriculture for plant growth stimulation [81]. It would be interesting to further investigate the efficiency of LED light in comparison with laser-based technology when applied with biofertilizer for seedling growth enhancement.

5. Conclusions

Light plays a major role in the regulation of plant growth and development. In terms of quality and quantity, applying LED light at 200 µmol/m2/s with a ratio R60:B40 and irradiation for 20 h/d promotes high-quality tomato seedlings. LED lights regulate photosynthetic genes expression. Some PGPR strains, such as Bradyrhizobium sp. SUTN9-2, B. megaterium A20, and B. velezensis SD10 promoted seedling growth in greenhouse conditions. SUTN9-2 or SD10 promoted the growth of LED-illuminated seedlings. However, some strains negatively affected seedling growth. The PGPR inoculation of LED-illuminated seedlings with AMF promoted seedling growth in the transplanting state. Finally, high-quality seedlings were produced by LED light and beneficial micro-organisms promoted yield production.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/agronomy12102458/s1, Table S1: The PGPR characteristics; Table S2: The antagonistic PGPR test.

Author Contributions

Conceptualization: N.B. and N.T.; Methodology: A.S.; Data curation: A.S.; Formal analysis: A.S.; Visualization: A.S.; Writing—original draft preparation: A.S.; Writing—editing: A.S., P.T., T.G. (Teerayoot Girdthai), K.U., N.B. and N.T.; Supervision: P.T., K.U., N.B., J.W., P.S., P.P., T.G. (Teerana Greetatorn), T.G.(Teerayoot Girdthai) and N.T. All authors have read and agreed to the published version of the manuscript.

Funding

This study was funded by (i) the Suranaree University of Technology scholarship (OROG), (ii) National Research Council of Thailand (NRTC) and Suranaree University of Technology [grant number N41D640013], (iii) Agricultural Research Development Agency (ARDA) [grant number CRP6205030580], and the (iv) National Science, Research and Innovation Fund (NSRF) via the Program Management Unit for Human Resources & Institutional Development, Research and Innovation [grant number B16F640113].

Data Availability Statement

Data available on request from the first author.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Piovene, C.; Orsini, F.; Bosi, S.; Sanoubar, R.; Bregola, V.; Dinelli, G.; Gianquinto, G. Optimal Red:Blue Ratio in Led Lighting for Nutraceutical Indoor Horticulture. Sci. Hortic. 2015, 193, 202–208. [Google Scholar] [CrossRef]
  2. Chen, X.; Yang, Q.; Song, W.; Wang, L.; Guo, W.; Xue, X. Growth and Nutritional Properties of Lettuce Affected by Different Alternating Intervals of Red and Blue LED Irradiation. Sci. Hortic. 2017, 223, 44–52. [Google Scholar] [CrossRef]
  3. Yao, X.; Liu, X.; Xu, Z.; Jiao, X. Effects of Light Intensity on Leaf Microstructure and Growth of Rape Seedlings Cultivated under a Combination of Red and Blue LEDs. J. Integr. Agric. 2017, 16, 97–105. [Google Scholar] [CrossRef]
  4. Wojciechowska, R.; Długosz-Grochowska, O.; Kołton, A.; Żupnik, M. Effects of LED Supplemental Lighting on Yield and Some Quality Parameters of Lamb’s Lettuce Grown in Two Winter Cycles. Sci. Hortic. 2015, 187, 80–86. [Google Scholar] [CrossRef]
  5. Xu, H.; Fu, Y.; Li, T.; Wang, R. Effects of Different LED Light Wavelengths on the Resistance of Tomato against Botrytis Cinerea and the Corresponding Physiological Mechanisms. J. Integr. Agric. 2017, 16, 106–114. [Google Scholar] [CrossRef] [Green Version]
  6. Johkan, M.; Shoji, K.; Goto, F.; Hashida, S.; Yoshihara, T. Blue Light-Emitting Diode Light Irradiation of Seedlings Improves Seedling Quality and Growth after Transplanting in Red Leaf Lettuce. HortScience 2010, 45, 1809–1814. [Google Scholar] [CrossRef] [Green Version]
  7. Alori, E.T.; Babalola, O.O. Microbial Inoculants for Improving Crop Quality and Human Health in Africa. Front. Microbiol. 2018, 9, 2213. [Google Scholar] [CrossRef] [Green Version]
  8. Trivedi, P.; Schenk, P.M.; Wallenstein, M.D.; Singh, B.K. Tiny Microbes, Big Yields: Enhancing Food Crop Production with Biological Solutions. Microb. Biotechnol. 2017, 10, 999–1003. [Google Scholar] [CrossRef] [Green Version]
  9. Alori, E.T.; Babalola, O.O.; Prigent-Combaret, C. Impacts of Microbial Inoculants on the Growth and Yield of Maize Plant. Open Agric. J. 2019, 13, 1–8. [Google Scholar] [CrossRef] [Green Version]
  10. Berruti, A.; Lumini, E.; Balestrini, R.; Bianciotto, V. Arbuscular Mycorrhizal Fungi as Natural Biofertilizers: Let’s Benefit from Past Successes. Front. Microbiol 2016, 6, 1559. [Google Scholar] [CrossRef]
  11. Commatteo, J.; Consolo, V.F.; Barbieri, P.A.; Covacevich, F. Publicación: Indigenous arbuscular mycorrhiza and Trichoderma from systems with soybean predominance can improve tomato growth. Soil Environ. 2019, 38, 151–161. [Google Scholar] [CrossRef]
  12. Chliyeh, M.; Chahdi, A.O.; Selmaoui, K.; Ouazzani, A.; Maltouf, A.F.; Modafar, C.E.; Moukhli, A.; Oukabli, A.; Benkirane, R.; Douira, A. Effect of Trichoderma harzianum and arbuscular mycorrhizal fungi against verticillium wilt of tomato. Int. J. Recent Sci. Res. 2014, 5, 449–459. [Google Scholar]
  13. Fan, X.-X.; Xu, Z.-G.; Liu, X.-Y.; Tang, C.-M.; Wang, L.-W.; Han, X. Effects of Light Intensity on the Growth and Leaf Development of Young Tomato Plants Grown under a Combination of Red and Blue Light. Sci. Hortic. 2013, 153, 50–55. [Google Scholar] [CrossRef]
  14. Kumar, D.; Yusuf, M.A.; Singh, P.; Sardar, M.; Sarin, N.B. Histochemical Detection of Superoxide and H2O2 Accumulation in Brassica Juncea Seedlings. Bio-Protocol 2014, 4, e1108. [Google Scholar] [CrossRef]
  15. Muneer, S.; Ko, C.H.; Wei, H.; Chen, Y.; Jeong, B.R. Physiological and Proteomic Investigations to Study the Response of Tomato Graft Unions under Temperature Stress. PLoS ONE 2016, 11, e0157439. [Google Scholar] [CrossRef] [Green Version]
  16. Wu, Q.; Su, N.; Shen, W.; Cui, J. Analyzing Photosynthetic Activity and Growth of Solanum Lycopersicum Seedlings Exposed to Different Light Qualities. Acta Physiol. Plant 2014, 36, 1411–1420. [Google Scholar] [CrossRef]
  17. Guo, X.; Xie, Q.; Li, B.; Su, H. Molecular Characterization and Transcription Analysis of DNA Methyltransferase Genes in Tomato (Solanum Lycopersicum). Genet. Mol. Biol. 2020, 43, e20180295. [Google Scholar] [CrossRef] [Green Version]
  18. Greetatorn, T.; Hashimoto, S.; Maeda, T.; Fukudome, M.; Piromyou, P.; Teamtisong, K.; Tittabutr, P.; Boonkerd, N.; Kawaguchi, M.; Uchiumi, T.; et al. Mechanisms of Rice Endophytic Bradyrhizobial Cell Differentiation and Its Role in Nitrogen Fixation. Microbes Environ. 2020, 35, ME20049. [Google Scholar] [CrossRef]
  19. Sibponkrung, S.; Kondo, T.; Tanaka, K.; Tittabutr, P.; Boonkerd, N.; Yoshida, K.; Teaumroong, N. Co-Inoculation of Bacillus Velezensis Strain S141 and Bradyrhizobium Strains Promotes Nodule Growth and Nitrogen Fixation. Microorganisms 2020, 8, 678. [Google Scholar] [CrossRef]
  20. Ali, S.Z.; Sandhya, V.; Venkateswar Rao, L. Isolation and Characterization of Drought-Tolerant ACC Deaminase and Exopolysaccharide-Producing Fluorescent Pseudomonas sp. Ann. Microbiol. 2014, 64, 493–502. [Google Scholar] [CrossRef] [Green Version]
  21. Zeng, Q.; Wu, X.; Wang, J.; Ding, X. Phosphate Solubilization and Gene Expression of Phosphate-Solubilizing Bacterium Burkholderia multivorans WS-FJ9 under Different Levels of Soluble Phosphate. J. Microbiol. Biotechnol. 2017, 27, 844–855. [Google Scholar] [CrossRef] [PubMed]
  22. Yuttavanichakul, W.; Lawongsa, P.; Wongkaew, S.; Teaumroong, N.; Boonkerd, N.; Nomura, N.; Tittabutr, P. Improvement of Peanut Rhizobial Inoculant by Incorporation of Plant Growth Promoting Rhizobacteria (PGPR) as Biocontrol against the Seed Borne Fungus, Aspergillus niger. Biol. Control 2012, 63, 87–97. [Google Scholar] [CrossRef]
  23. Kaur, H.; Sharda, R.; Sharma, P. Effect of hoagland solution for growing tomato hydroponi-cally in greenhouse. HortFlora Res. Spectr. 2016, 5, 310–315. [Google Scholar]
  24. Trouvelot, A.; Kough, J.L.; Gianinazzi-Pearson, V.; Mesure du taux de mycorhization VA d’un système radiculaire. Recherche de Méthode d’estimation Ayant Une Signification Fonctionnelle. In Proceedings of the European symposium on mycorrhizae, Paris, France, 1–5 July 1985. [Google Scholar]
  25. Feng, L.; Raza, M.A.; Li, Z.; Chen, Y.; Khalid, M.H.B.; Du, J.; Liu, W.; Wu, X.; Song, C.; Yu, L.; et al. The Influence of Light Intensity and Leaf Movement on Photosynthesis Characteristics and Carbon Balance of Soybean. Front. Plant Sci. 2019, 9, 1952. [Google Scholar] [CrossRef]
  26. Modarelli, G.C.; Paradiso, R.; Arena, C.; De Pascale, S.; Van Labeke, M.-C. High Light Intensity from Blue-Red LEDs Enhance Photosynthetic Performance, Plant Growth, and Optical Properties of Red Lettuce in Controlled Environment. Horticulturae 2022, 8, 114. [Google Scholar] [CrossRef]
  27. Bartucca, M.L.; Guiducci, M.; Falcinelli, B.; Del Buono, D.; Benincasa, P. Blue: Red LED Light Proportion Affects Vegetative Parameters, Pigment Content, and Oxidative Status of Einkorn (Triticum monococcum L. ssp. Monococcum) Wheatgrass. J. Agric. Food Chem. 2020, 68, 8757–8763. [Google Scholar] [CrossRef]
  28. Ying, Q.; Jones-Baumgardt, C.; Zheng, Y.; Bozzo, G. The Proportion of Blue Light from Light-Emitting Diodes Alters Microgreen Phytochemical Profiles in a Species-Specific Manner. HortScience 2021, 56, 13–20. [Google Scholar] [CrossRef]
  29. Kang, J.; Sugumaran, K.; Atulba, S.L.; Jeong, B.R.; Hwang, S. Light Intensity and Photoperiod Influence the Growth and Development of Hydroponically Grown Leaf Lettuce in a Closed-Type Plant Factory System. Horticulture 2013, 54, 501–509. [Google Scholar] [CrossRef]
  30. Xu, Y.; Yang, M.; Cheng, F.; Liu, S.; Liang, Y. Effects of LED Photoperiods and Light Qualities on in Vitro Growth and Chlorophyll Fluorescence of Cunninghamia Lanceolata. BMC Plant Biol. 2020, 20, 269. [Google Scholar] [CrossRef]
  31. Dieleman, J.; Visser, P.; Meinen, E.; Grit, J.; Dueck, T. Integrating Morphological and Physiological Responses of Tomato Plants to Light Quality to the Crop Level by 3D Modeling. Front. Plant Sci. 2019, 10, 839. [Google Scholar] [CrossRef] [Green Version]
  32. Yu, X.; Liu, H.; Klejnot, J.; Lin, C. The Cryptochrome Blue Light Receptors. Arab. Book 2010, 8, e0135. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  33. Ologundudu, A.F.; Adelusi, A.A.; Adekoya, K.P. Effect of Light Stress on Germination and Growth Parameters of Corchorus olitoriusi, Celosia argentea, Amaranthus cruentus, Abelmoschus esculentus and Delonix regia. Not. Sci. Biol. 2013, 5, 468–475. [Google Scholar] [CrossRef]
  34. Naznin, M.T.; Lefsrud, M.G. Impact of LED Irradiance on Plant Photosynthesis and Action Spectrum of Plantlet; Awwal, A.A.S., Iftekharuddin, K.M., Matin, M.A., Márquez, A., Eds.; SPIE: Bellingham, WA, USA, 2014; p. 921602. [Google Scholar]
  35. Lu, T.; Yu, H.; Li, Q.; Chai, L.; Jiang, W. Improving Plant Growth and Alleviating Photosynthetic Inhibition and Oxidative Stress From Low-Light Stress With Exogenous GR24 in Tomato (Solanum Lycopersicum L.) Seedlings. Front. Plant Sci. 2019, 10, 490. [Google Scholar] [CrossRef] [PubMed]
  36. Ma, Z.; Li, S.; Zhang, M.; Jiang, S.; Xiao, Y. Light Intensity Affects Growth, Photosynthetic Capability, and Total Flavonoid Accumulation of Anoectochilus Plants. HortScience 2010, 45, 863–867. [Google Scholar] [CrossRef] [Green Version]
  37. Mil Thorpe, F.L.; Newton, P. Studies on the Expansion of the Leaf Surface: III. The influence of radiation on cell division and leaf expansion. J. Exp. Bot. 1963, 14, 483–495. [Google Scholar] [CrossRef]
  38. OuYang, F.; Mao, J.-F.; Wang, J.; Zhang, S.; Li, Y. Transcriptome Analysis Reveals That Red and Blue Light Regulate Growth and Phytohormone Metabolism in Norway Spruce [Picea Abies (L.) Karst.]. PLoS ONE 2015, 10, e0127896. [Google Scholar]
  39. Yorio, N.C.; Goins, G.D.; Kagie, H.R.; Wheeler, R.M.; Sager, J.C. Improving Spinach, Radish, and Lettuce Growth under Red Light-Emitting Diodes (LEDs) with Blue Light Supplementation. HortScience 2001, 36, 380–383. [Google Scholar] [CrossRef] [Green Version]
  40. Meng, X.; Wang, Z.; He, S.; Shi, L.; Song, Y.; Lou, X.; He, D. LED-Supplied Red and Blue Light Alters the Growth, Antioxidant Status, and Photochemical Potential of in Vitro-Grown Gerbera jamesonii Plantlets. Hortic. Sci. Technol. 2019, 37, 473–489. [Google Scholar]
  41. Li, Y.; Xin, G.; Liu, C.; Shi, Q.; Yang, F.; Wei, M. Effects of Red and Blue Light on Leaf Anatomy, CO2 Assimilation and the Photosynthetic Electron Transport Capacity of Sweet Pepper (Capsicum Annuum L.) Seedlings. BMC Plant Biol. 2020, 20, 318. [Google Scholar] [CrossRef]
  42. Osnato, M.; Cota, I.; Nebhnani, P.; Cereijo, U.; Pelaz, S. Photoperiod Control of Plant Growth: Flowering Time Genes Beyond Flowering. Front. Plant Sci. 2022, 12, 805635. [Google Scholar] [CrossRef]
  43. Huang, J.J.; D’Souza, C.; Zhou, W. Light-Time-Biomass Response Model for Predicting the Growth of Choy Sum (Brassica Rapa var. Parachinensis) in Soil-Based LED-Constructed Indoor Plant Factory for Efficient Seedling Production. Front. Plant Sci. 2021, 12, 623682. [Google Scholar] [CrossRef] [PubMed]
  44. Li, Y.; Xiao, J.; Hu, J.; Jeong, B.R. Critical Photoperiod and Optimal Quality of Night Interruption Light for Runner Induction in June-Bearing Strawberries. Agronomy 2021, 11, 1996. [Google Scholar] [CrossRef]
  45. Lee, J.-B.; Kim, S.-H.; Lee, S.-C.; Kim, H.-G.; Ahn, H.-G.; Li, Z.; Yoon, K.C. Blue Light-Induced Oxidative Stress in Human Corneal Epithelial Cells: Protective Effects of Ethanol Extracts of Various Medicinal Plant Mixtures. Investig. Ophthalmol. Vis. Sci. 2014, 55, 4119–4127. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  46. Rossa, M.M.; de Oliveira, M.C.; Okamoto, O.K.; Lopes, P.F.; Colepicolo, P. Effect of Visible Light on Superoxide Dismutase (SOD) Activity in the Red Alga Gracilariopsis tenuifrons (Gracilariales, Rhodophyta). J. Appl. Phycol. 2002, 14, 151–157. [Google Scholar] [CrossRef]
  47. Luciński, R.; Jackowski, G. The Structure, Functions and Degradation of Pigment-Binding Proteins of Photosystem II. Acta Biochim. Pol. 2006, 53, 693–708. [Google Scholar] [CrossRef] [Green Version]
  48. De Weerd, F.L.; van Stokkum, I.H.M.; van Amerongen, H.; Dekker, J.P.; van Grondelle, R. Pathways for Energy Transfer in the Core Light-Harvesting Complexes CP43 and CP47 of Photosystem II. Biophys. J. 2002, 82, 1586–1597. [Google Scholar] [CrossRef] [Green Version]
  49. Kim, N.N.; Shin, H.S.; Park, H.G.; Lee, J.; Kil, G.-S.; Choi, C.Y. Profiles of Photosynthetic Pigment Accumulation and Expression of Photosynthesis-Related Genes in the Marine Cyanobacteria Synechococcus sp.: Effects of LED Wavelengths. Biotechnol. Bioprocess Eng. 2014, 19, 250–256. [Google Scholar] [CrossRef]
  50. Singh, M. Turnover of D1 Protein Encoded by PsbA Gene in Higher Plants and Cyanobacteria Sustains Photosynthetic Efficiency to Maintain Plant Productivity Under Photoinhibitory Irradiance. Photosynthetica 2000, 38, 161–169. [Google Scholar] [CrossRef]
  51. Ahmad, N.; Zaidi, S.S.-A.; Mansoor, S. Alternative Routes to Improving Photosynthesis in Field Crops. Trends Plant Sci. 2020, 25, 958–960. [Google Scholar] [CrossRef]
  52. Kale, R.; Hebert, A.E.; Frankel, L.K.; Sallans, L.; Bricker, T.M.; Pospíšil, P. Amino Acid Oxidation of the D1 and D2 Proteins by Oxygen Radicals during Photoinhibition of Photosystem II. Proc. Natl. Acad. Sci. USA 2017, 114, 2988–2993. [Google Scholar] [CrossRef] [Green Version]
  53. Pfannschmidt, T.; Nilsson, A.; Tullberg, A.; Link, G.; Allen, J. Direct Transcriptional Control of the Chloroplast Genes PsbA and PsaAB Adjusts Photosynthesis to Light Energy Distribution in Plants. IUBMB Life 1999, 48, 271–276. [Google Scholar] [CrossRef] [PubMed]
  54. Wu, X.; Khan, R.; Gao, H.; Liu, H.; Zhang, J.; Ma, X. Low Light Alters the Photosynthesis Process in Cigar Tobacco via Modulation of the Chlorophyll Content, Chlorophyll Fluorescence, and Gene Expression. Agriculture 2021, 11, 755. [Google Scholar] [CrossRef]
  55. Chotewutmontri, P.; Barkan, A. Light-Induced PsbA Translation in Plants Is Triggered by Photosystem II Damage via an Assembly-Linked Autoregulatory Circuit. Proc. Natl. Acad. Sci. USA 2020, 117, 21775–21784. [Google Scholar] [CrossRef]
  56. Chen, Y.; Zhong, D.; Yang, X.; Zhao, Y.; Dai, L.; Zeng, D.; Wang, Q.; Gao, L.; Li, S. ZmFdC2 Encoding a Ferredoxin Protein With C-Terminus Extension Is Indispensable for Maize Growth. Front. Plant Sci. 2021, 12, 646359. [Google Scholar] [CrossRef]
  57. Kozuleva, M.; Goss, T.; Twachtmann, M.; Rudi, K.; Trapka, J.; Selinski, J.; Ivanov, B.; Garapati, P.; Steinhoff, H.-J.; Hase, T.; et al. Ferredoxin:NADP(H) Oxidoreductase Abundance and Location Influences Redox Poise and Stress Tolerance1. Plant Physiol. 2016, 172, 1480–1493. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  58. Liu, Y.; Ren, X.; Jeong, B.R. Manipulating the Difference between the Day and Night Temperatures Can Enhance the Quality of Astragalus membranaceus and Codonopsis lanceolata Plug Seedlings. Agronomy 2019, 9, 654. [Google Scholar] [CrossRef] [Green Version]
  59. Bovy, A.; Van Den Berg, C.; De Vrieze, G.; Thompson, W.F.; Weisbeek, P.; Smeekens, S. Light-Regulated Expression of the Arabidopsis thaliana Ferredoxin Gene Requires Sequences Upstream and Downstream of the Transcription Initiation Site. Plant Mol. Biol. 1995, 27, 27–39. [Google Scholar] [CrossRef]
  60. Gallo-Meagher, M.; Sowinski, D.A.; Thompson, W.F. The Pea Ferredoxin I Gene Exhibits Different Light Responses in Pea and Tobacco. Plant Cell 1992, 4, 383–388. [Google Scholar]
  61. Ren, X.; Liu, Y.; Jeong, H.K.; Jeong, B.R. Supplementary Light Source Affects the Growth and Development of Codonopsis lanceolata Seedlings. Int. J. Mol. Sci. 2018, 19, 3074. [Google Scholar] [CrossRef] [Green Version]
  62. Li, J.; Yuan, J.; Li, Y.; Sun, H.; Ma, T.; Huai, J.; Yang, W.; Zhang, W.; Lin, R. The CDC48 Complex Mediates Ubiquitin-Dependent Degradation of Intra-Chloroplast Proteins in Plants. Cell Rep. 2022, 39, 110664. [Google Scholar] [CrossRef]
  63. Valle, K.C.; Nymark, M.; Aamot, I.; Hancke, K.; Winge, P.; Andresen, K.; Johnsen, G.; Brembu, T.; Bones, A.M. System Responses to Equal Doses of Photosynthetically Usable Radiation of Blue, Green, and Red Light in the Marine Diatom Phaeodactylum tricornutum. PLoS ONE 2014, 9, e114211. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  64. Zhang, H.; Xu, N.; Li, X.; Sun, G.; Shi, G. Photosynthetic Function and the Photoprotective Mechanism of Leaves of Morus Alba L. Seedlings under NaCl and NaHCO3 Stress Revealed by Proteomics. Preprints 2019, 2019050167. [Google Scholar]
  65. Manzara, T.; Gruissem, W. Organization and Expression of the Genes Encoding Ribulose-1,5-Bisphosphate Carboxylase in Higher Plants. Photosynth. Res. 1988, 16, 117–139. [Google Scholar] [CrossRef] [PubMed]
  66. Yamada, K.; Davydov, I.I.; Besnard, G.; Salamin, N. Duplication History and Molecular Evolution of the RbcS Multigene Family in Angiosperms. J. Exp. Bot. 2019, 70, 6127–6139. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  67. Inamine, G.; Nash, B.; Weissbach, H.; Brot, N. Light Regulation of the Synthesis of the Large Subunit of Ribulose-1,5-Bisphosphate Carboxylase in Peas: Evidence for Translational Control. Proc. Natl. Acad. Sci. USA 1985, 82, 5690–5694. [Google Scholar] [CrossRef] [Green Version]
  68. Sasaki, Y.; Ishiye, M.; Sakihama, T.; Kamikubo, T. Light-Induced Increase of MRNA Activity Coding for the Small Subunit of Ribulose-1,5-Bisphosphate Carboxylase. J. Biol. Chem. 1981, 256, 2315–2320. [Google Scholar] [CrossRef]
  69. Matusova, R.; Rani, K.; Verstappen, F.W.A.; Franssen, M.C.R.; Beale, M.H.; Bouwmeester, H.J. The Strigolactone Germination Stimulants of the Plant-Parasitic Striga and Orobanche spp. Are Derived from the Carotenoid Pathway. Plant Physiol. 2005, 139, 920–934. [Google Scholar] [CrossRef] [Green Version]
  70. Nazir, N.; Kamili, A.N.; Zargar, M.Y.; Khan, I.; Shah, D.; Tyub, S. Effect of Root Exudates on Rhizosphere Soil Microbial Communities. J. Res. Dev. 2016, 16, 9. [Google Scholar]
  71. Williams, A.; de Vries, F.T. Plant Root Exudation under Drought: Implications for Ecosystem Functioning. New Phytol. 2020, 225, 1899–1905. [Google Scholar] [CrossRef] [Green Version]
  72. Yang, L. Root Exudation Pattern of Sugar Beet (Beta Vulgaris L.) as Influenced by Light Intensity and P Deficiency. Ph.D. Thesis, Georg-August-University of Göttingen, Lower Saxony, Germany, 2016. Available online: https://ediss.uni-goettingen.de/handle/11858/00-1735-0000-0028-87DC-8 (accessed on 29 June 2022).
  73. Zhou, C.; Zhang, Y.; Liu, W.; Zha, L.; Shao, M.; Li, B. Light Quality Affected the Growth and Root Organic Carbon and Autotoxin Secretions of Hydroponic Lettuce. Plants 2020, 9, 1542. [Google Scholar] [CrossRef]
  74. Begum, N.; Wang, L.; Ahmad, H.; Akhtar, K.; Roy, R.; Khan, M.I.; Zhao, T. Co-Inoculation of Arbuscular Mycorrhizal Fungi and the Plant Growth-Promoting Rhizobacteria Improve Growth and Photosynthesis in Tobacco Under Drought Stress by Up-Regulating Antioxidant and Mineral Nutrition Metabolism. Microb. Ecol. 2022, 83, 971–988. [Google Scholar] [CrossRef] [PubMed]
  75. Yu, L.; Zhang, H.; Zhang, W.; Liu, K.; Liu, M.; Shao, X. Cooperation between Arbuscular Mycorrhizal Fungi and Plant Growth-Promoting Bacteria and Their Effects on Plant Growth and Soil Quality. PeerJ 2022, 10, e13080. [Google Scholar] [CrossRef] [PubMed]
  76. Pérez-de-Luque, A.; Tille, S.; Johnson, I.; Pascual-Pardo, D.; Ton, J.; Cameron, D.D. The Interactive Effects of Arbuscular Mycorrhiza and Plant Growth-Promoting Rhizobacteria Synergistically Enhance Host Plant Defences against Pathogens. Sci. Rep. 2017, 7, 16409. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  77. Son, K.-H.; Kim, E.-Y.; Oh, M.-M. Growth and Development of Cherry Tomato Seedlings Grown under Various Combined Ratios of Red to Blue LED Lights and Fruit Yield and Quality after Transplanting. Prot. Hortic. Plant Fact. 2018, 27, 54–63. [Google Scholar] [CrossRef]
  78. Young, T.; Cameron, D.D.; Phoenix, G.K. Using AMF Inoculum to Improve the Nutritional Status of Prunella Vulgaris Plants in Green Roof Substrate during Establishment. Urban For. Urban Green 2015, 14, 959–967. [Google Scholar] [CrossRef] [Green Version]
  79. Salvioli, A.; Zouari, I.; Chalot, M.; Bonfante, P. The Arbuscular Mycorrhizal Status Has an Impact on the Transcriptome Profile and Amino Acid Composition of Tomato Fruit. BMC Plant Biol. 2012, 12, 44. [Google Scholar] [CrossRef] [Green Version]
  80. Raklami, A.; Bechtaoui, N.; Tahiri, A.; Anli, M.; Meddich, A.; Oufdou, K. Use of Rhizobacteria and Mycorrhizae Consortium in the Open Field as a Strategy for Improving Crop Nutrition, Productivity and Soil Fertility. Front. Microbiol. 2019, 10, 1106. [Google Scholar] [CrossRef]
  81. Nadimi, M.; Sun, D.-W.; Paliwal, J. Recent Applications of Novel Laser Techniques for Enhancing Agricultural Production. Laser Phys. 2021, 31, 053001. [Google Scholar] [CrossRef]
Agronomy 12 02458 g001 550
Figure 1. The effect of R:B ratio on health index of tomato seedling. The tomato seedlings were recorded at 14 days after planting. Mean and standard error are calculated from four replicates and values with different letters in each treatment are significantly different at p ≤ 0.05.
Figure 1. The effect of R:B ratio on health index of tomato seedling. The tomato seedlings were recorded at 14 days after planting. Mean and standard error are calculated from four replicates and values with different letters in each treatment are significantly different at p ≤ 0.05.
Agronomy 12 02458 g001
Agronomy 12 02458 g002 550
Figure 2. The effect of photoperiods on the health index of tomato seedlings. The tomato seedlings were recorded at 14 days after planting. Mean and standard error are calculated from four replicates. Values with different letters in each treatment differ significantly at p ≥ 0.05. Flu: fluorescent light at 150 µmol/m2/s, LED: LED light at 200 µmol/m2/s, ratio R60:B40.
Figure 2. The effect of photoperiods on the health index of tomato seedlings. The tomato seedlings were recorded at 14 days after planting. Mean and standard error are calculated from four replicates. Values with different letters in each treatment differ significantly at p ≥ 0.05. Flu: fluorescent light at 150 µmol/m2/s, LED: LED light at 200 µmol/m2/s, ratio R60:B40.
Agronomy 12 02458 g002
Agronomy 12 02458 g003 550
Figure 3. The phenotype of tomato seedling growth under different photoperiods of 14–24 h/d at 14 days. Flu: fluorescent light at 150 µmol/m2/s, LED: LED light at 200 µmol/m2/s, ratio R60:B40.
Figure 3. The phenotype of tomato seedling growth under different photoperiods of 14–24 h/d at 14 days. Flu: fluorescent light at 150 µmol/m2/s, LED: LED light at 200 µmol/m2/s, ratio R60:B40.
Agronomy 12 02458 g003
Agronomy 12 02458 g004 550
Figure 4. The H2O2 accumulation, SOD activity assay, and photosynthetic gene expression in leaves. The hydrogen peroxide accumulation (a), superoxide dismutase activity assay (b), photosynthetic-related gene expression (c). The tomato seedlings were recorded at 14 days after planting. Mean and standard error are calculated from three replicates, the symbol of * indicates significance, and the symbol of NS indicates a non-significant effect at p ≥ 0.05.
Figure 4. The H2O2 accumulation, SOD activity assay, and photosynthetic gene expression in leaves. The hydrogen peroxide accumulation (a), superoxide dismutase activity assay (b), photosynthetic-related gene expression (c). The tomato seedlings were recorded at 14 days after planting. Mean and standard error are calculated from three replicates, the symbol of * indicates significance, and the symbol of NS indicates a non-significant effect at p ≥ 0.05.
Agronomy 12 02458 g004
Agronomy 12 02458 g005 550
Figure 5. The effect of PGPR on tomato seedling growth. The tomato seedlings were recorded at 14 days after planting. Mean and standard error are calculated from four replicates. Values with different letters in each treatment differed significantly at p ≥ 0.05.
Figure 5. The effect of PGPR on tomato seedling growth. The tomato seedlings were recorded at 14 days after planting. Mean and standard error are calculated from four replicates. Values with different letters in each treatment differed significantly at p ≥ 0.05.
Agronomy 12 02458 g005
Agronomy 12 02458 g006 550
Figure 6. The effect of PGPR inoculation under different lighting conditions on the tomato seedling health index. The tomato seedlings were recorded at 14 days after planting. Mean and standard error are calculated from four replicates. Values with different letters in each treatment differed significantly at p ≥ 0.05. GR: tomatoes planted under greenhouse conditions, Flu: tomatoes planted under fluorescent light (150 µmol/m2/s, exposed for 18 h/day), LED: tomatoes planted under LED light (200 µmol/m2/s, ratio R60:B40, exposed for 20 h/d).
Figure 6. The effect of PGPR inoculation under different lighting conditions on the tomato seedling health index. The tomato seedlings were recorded at 14 days after planting. Mean and standard error are calculated from four replicates. Values with different letters in each treatment differed significantly at p ≥ 0.05. GR: tomatoes planted under greenhouse conditions, Flu: tomatoes planted under fluorescent light (150 µmol/m2/s, exposed for 18 h/day), LED: tomatoes planted under LED light (200 µmol/m2/s, ratio R60:B40, exposed for 20 h/d).
Agronomy 12 02458 g006
Agronomy 12 02458 g007 550
Figure 7. Tomato seedling phenotype after PGPR inoculation and AMF’s effect on the seedling growth stage under greenhouse conditions. Tomato plants at 30 days old after the seedling stage.
Figure 7. Tomato seedling phenotype after PGPR inoculation and AMF’s effect on the seedling growth stage under greenhouse conditions. Tomato plants at 30 days old after the seedling stage.
Agronomy 12 02458 g007
Agronomy 12 02458 g008 550
Figure 8. The effect of PGPR inoculation on LED-illuminated tomato seedlings and AMF on the seedling growth stage under greenhouse conditions for 30 days. Total fruit number (a), total fruit yield (b). Mean and standard error are calculated from three replicates. The asterisk symbol * indicates significance.
Figure 8. The effect of PGPR inoculation on LED-illuminated tomato seedlings and AMF on the seedling growth stage under greenhouse conditions for 30 days. Total fruit number (a), total fruit yield (b). Mean and standard error are calculated from three replicates. The asterisk symbol * indicates significance.
Agronomy 12 02458 g008
Table
Table 1. The primer sequence of the tomato on photosynthetic-related genes.
Table 1. The primer sequence of the tomato on photosynthetic-related genes.
PrimerSequence (5′-3′)Reference
ActinF: GAAATAGCATAAGATGGCAGACG
R: ATACCCACCATCACACCAGTAT		[17]
rbcLF: CTGCGAATCCCTCCTGCTTA
R: CCAACAGGGGACGACCATAC		[16]
rbcSF: TGAGACTGA GCACGGATTTG
R: TTTAGCCTCTTGAACCT CAGC
pabAF: CCGTAAAGTAGAGACCCTGAAAC
R: TGGATG GTTTGGTGTTTTGATG
pabBF: CCTATTCCATCTTAGCGTCCG
R: TTGCC GAACCATACCACATAG
atpBF: TGGGCGGTTTCGTAATGTTC
R: GTACCCGCAGACGATTTGAC		This study
fdxF: GTGTGATTCATACTCACCAGG
R: CACCTGACCATTCTCAATTACAG
Table
Table 2. Effect of different light intensities on tomato seedling growth.
Table 2. Effect of different light intensities on tomato seedling growth.
Light Intensity (µmol/m2/s)Shoot Height
(cm)		Root Length
(cm)		Stem Diameter (mm)Total Fresh Weight
(g)		Total Dry Weight
(mg)		Chlorophyll Content (SPAD Unit)Leaves Area
(cm2)		Health Index
Control7.30 ± 0.06 a6.11 ± 0.17 bc1.33 ± 0.09 a0.31 ± 0.04 a20.76 ± 2.98 ab23.9 ± 0.6 e6.96 ± 0.89 a3.87 ± 0.84 b
Fluorescent 4.18 ± 0.18 b5.64 ± 0.32 c1.06 ± 0.09 b c0.19 ± 0.00 c13.40 ± 0.30 cd28.6 ± 1.0 d6.911.04 a3.38 ± 0.22 b
503.68 ± 0.05 c2.90 ± 0.11 d0.98 ± 0.07 c0.11 ± 0.00 d7.92 ± 0.78 d27.5 ± 1.2 de3.560.08 b2.14 ± 0.35 b
1004.07 ± 0.05 b6.10 ± 0.63 bc1.23 ± 0.02 abc0.24 ± 0.01 bc16.38 ± 1.56 bc30.8 ± 2.3 d7.730.63 a4.96 ± 0.56 b
2004.14 ± 0.13 b8.03 ± 0.77 ab1.43 ± 0.06 a0.33 ± 0.01 a26.93 ± 0.96 a39.2 ± 2.2 c8.88 ± 0.82 a9.29 ± 0.57 a
3003.89 ± 0.10 bc8.94 ± 0.61 a1.45 ± 0.09 a0.33 ± 0.04 a26.70 ± 3.61 a40.0 ± 1.3 bc8.78 ± 1.14 a9.85 ± 1.21 a
4003.31 ± 0.05 d8.46 ± 1.21 a1.32 ± 0.04 abc0.26 ± 0.02 abc27.53 ± 2.91 a44.0 ± 1.2 ab6.66 ± 0.64 a10.97 ± 1.33 a
5003.23 ± 0.09 d7.71 ± 0.12 a b1.24 ± 0.11 ab0.27 ± 00 abc27.01 ± 1.33 a46.3 ± 0.9 a6.49 ± 0.78 a10.42 ± 1.25 a
The tomato seedlings were recorded at 14 days after planting. Values with different letters in the same column in each condition differ significantly p ≥ 0.05.
Table
Table 3. The effect of PGPR inoculation on tomato seedlings and AMF on growth under greenhouse conditions.
Table 3. The effect of PGPR inoculation on tomato seedlings and AMF on growth under greenhouse conditions.
TreatmentShoot Height
(cm)		Stem Diameter (mm)Shoot Fresh Weight
(g)		Root Fresh Weight
(g)		Total Fresh Weight
(g)		Shoot Dry Weight
(g)		Root Dry Weight
(g)		Total Dry Weight
(g)		Root Colonization (%)
Control43.6 ± 1.86 d4.6 ± 0.15 e17.0 ± 1.65 d5.3 ± 0.59 c22.4 ± 2.21 d2.2 ± 0.27 c0.43 ± 0.05 c2.6 ± 0.32 a0.0 ± 0.00 c
Con/SD1067.2 ± 0.58 b5.3 ± 0.21 bc32.2 ± 1.91 b9.3 ± 1.17 ab41.5 ± 3.00 b4.6 ± 0.21 b0.60 ± 0.12 c5.2 ± 0.12 bc0.0 ± 0.00 c
Con/AMF56.4 ± 1.91 c4.7 ± 0.13 de23.5 ± 1.30 c7.4 ± 0.60 bc31.0 ± 1.69 c2.8 ± 0.17 c0.53 ± 0.04 c3.3 ± 0.20 d11.3 ± 0.95 a
Con/SD10/AMF70.0 ± 2.28 b4.9 ± 0.08 cde29.4 ± 2.9 b7.8 ± 0.93 bc37.4 ± 3.33 b c4.2 ± 0.38 b0.67 ± 0.08 bc4.8 ± 0.42 bc1.5 ± 0.53 c
LED67.4 ± 1.07 b5.2 ± 0.10 bcd32.4 ± 1.96 b8.0 ± 0.87 bc40.1 ± 2.46 b4.4 ± 0.22 b0.69 ± 0.10 bc5.1 ± 0.29 bc0.0 ± 0.00 c
LED/SD1066.4 ± 1.80 b5.5 ± 0.18 ab33.7 ± 2.20 b11.3 ± 1.31 a45.1 ± 3.33 b4.8 ± 0.46 b0.90 ± 0.12 ab5.7 ± 0.41 b0.0 ± 0.00 c
LED/AMF65.4 ± 1.63 b5.6 ± 0.12 ab32.1 ± 0.73 b8.2 ± 0.19 b c40.2 ± 0.87 b3.9 ± 0.11 b0.61 ± 0.02 bc4.5 ± 0.11 c10 ± 0.83 a
LED/SD10/AMF75.0 ± 1.44 a6.0 ± 0.29 a40.2 ± 1.14 a12.3 ± 1.71 a52.5 ± 2.48 a6.0 ± 0.22 a1.08 ± 0.13 a7.0 ± 0.32 a7.4 ± 1.19 b
The tomato plants were recorded at 30 days old after seedling stage. Values with different letters in the same column differed significantly at p ≥ 0.05.
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Share and Cite

MDPI and ACS Style

Songsaeng, A.; Tittabutr, P.; Umnajkitikorn, K.; Boonkerd, N.; Wongdee, J.; Songwattana, P.; Piromyou, P.; Greetatorn, T.; Girdthai, T.; Teaumroong, N. Application of Light-Emitting Diodes with Plant Growth-Promoting Rhizobacteria and Arbuscular Mycorrhiza Fungi for Tomato Seedling Production. Agronomy 2022, 12, 2458. https://doi.org/10.3390/agronomy12102458

AMA Style

Songsaeng A, Tittabutr P, Umnajkitikorn K, Boonkerd N, Wongdee J, Songwattana P, Piromyou P, Greetatorn T, Girdthai T, Teaumroong N. Application of Light-Emitting Diodes with Plant Growth-Promoting Rhizobacteria and Arbuscular Mycorrhiza Fungi for Tomato Seedling Production. Agronomy. 2022; 12(10):2458. https://doi.org/10.3390/agronomy12102458

Chicago/Turabian Style

Songsaeng, Apisit, Panlada Tittabutr, Kamolchanok Umnajkitikorn, Nantakorn Boonkerd, Jenjira Wongdee, Pongpan Songwattana, Pongdet Piromyou, Teerana Greetatorn, Teerayoot Girdthai, and Neung Teaumroong. 2022. "Application of Light-Emitting Diodes with Plant Growth-Promoting Rhizobacteria and Arbuscular Mycorrhiza Fungi for Tomato Seedling Production" Agronomy 12, no. 10: 2458. https://doi.org/10.3390/agronomy12102458

APA Style

Songsaeng, A., Tittabutr, P., Umnajkitikorn, K., Boonkerd, N., Wongdee, J., Songwattana, P., Piromyou, P., Greetatorn, T., Girdthai, T., & Teaumroong, N. (2022). Application of Light-Emitting Diodes with Plant Growth-Promoting Rhizobacteria and Arbuscular Mycorrhiza Fungi for Tomato Seedling Production. Agronomy, 12(10), 2458. https://doi.org/10.3390/agronomy12102458

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop