Isolation and Characterization of Rhodococcus spp. from Pistachio and Almond Rootstocks and Trees in Tunisia
Abstract
1. Introduction
2. Materials and Methods
2.1. Surveys, Sites of Prospection and Sampling
2.2. Bacterial Isolation and Growth Conditions
2.3. Identification of Bacterial Isolates and Virulence Detection
2.4. Multilocus Analysis
2.5. Pathogenicity on Pisum Sativum
2.5.1. Bacterial Strains
2.5.2. Pea Bioassay
2.5.3. Re-Isolation of the Pathogen
2.6. Statistical Analysis
3. Results
3.1. Prospection and Sampling
3.2. Isolation and Identification of Bacterial Isolates
3.3. Multilocus Analysis of Bacterial Strains
3.4. Virulence Screening of Bacterial Strains
3.4.1. Virulence on Pisum Sativum
3.4.2. Fas and Att Virulence Genes Detection
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Bell, K.S.; Philp, J.C.; Aw, D.W.J.; Christofi, N. The genus Rhodococcus. Appl. Microbio. 1998, 85, 195–210. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Miteva, V.I.; Sheridan, P.P.; Brenchley, J.E. Phylogenetic and physiological diversity of microorganisms isolated from a deep Greenland glacier ice core. Appl. Environm. Microbiol. 2004, 70, 202–213. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Máthé, I.; Borsodi, A.K.; Tóth, E.M.; Felföldi, T.; Jurecska, L.; Krett, G.; Kelemen, Z.; Elekes, E.; Barkács, K.; Márialigeti, K. Vertical physico−chemical gradients with distinct microbial communities in the hypersaline and heliothermal Lake Ursu (Sovata, Romania). Extremophiles 2014, 18, 501–514. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Benedek, T.; Vajna, B.; Tancsics, A.; Marialigeti, K.; Lanyi, S.Z.; Mathe, I. Remarkable impact of PAHs and TPHs on the richness and diversity of bacterial species in surface soils exposed to long−term hydrocarbon pollution. World, J. Microbiol. Biotechnol 2013, 29, 1989–2002. [Google Scholar] [CrossRef] [Scilit]
- Táncsics, A.; Máthé, I.; Benedek, T.; Tóth, E.M.; Atasayar, E.; Spröer, C.; Márialigeti, K.; Felföldi, T.; Kriszt, B. Rhodococcus sovatensis sp. nov.; an actinomycete isolated from the hypersaline and heliothermal Lake Ursu. Int. J. Syst. Evol. Microbiol. 2017, 67, 190–196. [Google Scholar]
- Silva, L.J.; Souza, D.T.; Genuario, D.B.; Hoyos, H.A.V.; Santos, S.N.; Rosa, L.H.; Zucchi, T.D.; Melo, I.S. Rhodococcus psychrotolerans sp. nov.; isolated from rhizosphere of Deschampsia antarctica. Antonie Van Leeuwenhoek 2017, 111, 629–636. [Google Scholar] [CrossRef] [Scilit]
- Kämpfer, P.; Wellner, S.; Lohse, K.; Lodders, N.; Martin, K. Rhodococcus cerastii sp. nov. and Rhodococcus trifolii sp. nov.; two novel species isolated from leaf surfaces. Int. J. Syst. Evol. Microbiol. 2013, 63, 1024–1029. [Google Scholar] [CrossRef] [Scilit]
- Traw, M.B.; Kniskern, J.M.; Bergelson, J. SAR increases fitness of Arabidopsis thaliana in the presence of natural bacterial populations. Evolution 2007, 61, 2444–2449. [Google Scholar] [CrossRef] [Scilit]
- Li, J.; Zhao, G.Z.; Chen, H.H.; Qin, S.; Xu, L.H.; Jiang, C.L.; Li, W.J. Rhodococcus cercidiphylli sp. nov.; a new endophytic actinobacterium isolated from a Cercidiphyllum japonicum leaf. Syst. Appl. Microbiol. 2008, 31, 108–113. [Google Scholar] [CrossRef] [Scilit]
- Achari, G.A.; Ramesh, R. Diversity, biocontrol, and plant growth promoting abilities of xylem residing bacteria from solanaceous crops. Int. J. Microbiol. 2014, 296521. [Google Scholar] [CrossRef] [Scilit]
- Belimoy, A.A.; Safronova, V.I.; Sergeyeva, T.A.; Egorova, T.N.; Matveyeva, V.A.; Tsyganov, V.E.; Borisov, A.Y.; Tikhonovich, I.A.; Kluge, C.; Preisfeld, A.; et al. Characterization of plant growth promoting rhizobacteria isolated from polluted soils and containing 1−aminocyclopropane−1−carboxylate deaminase. Can. J. Microbio. 2001, 47, 642–652. [Google Scholar] [CrossRef] [PubMed]
- Tsavkelova, E.A.; Cherdyntseva, T.A.; Lobakova, E.S.; Kolomeitseva, G.L.; Netrusov, A.I. Microbiota of the orchid rhizoplane. Microbiology 2001, 70, 492–497. [Google Scholar] [CrossRef] [Scilit]
- Cohen, M.F.; Yamasaki, H. Involvement of nitric oxide synthase in sucrose−enhanced hydrogen peroxide tolerance of Rhodococcus sp. strain APG1, a plant−colonizing bacterium. Nitric Oxide 2003, 9, 1–9. [Google Scholar] [CrossRef] [Scilit]
- Francis, I.M.; Stes, E.; Zhang, Y.; Rangel, D.; Audenaert, K.; Vereecke, D. Mining the genome of Rhodococcus fascians, a plant growth−promoting bacterium gone astray. New Biotechnol. 2016, 33, 706–717. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Creason, A.L.; Vandeputte, O.M.; Savory, E.A.; Davis, E.W., II; Putnam, M.L.; Hu, E.; Swader−Hines, D.; Mol, A.; Baucher, M.; Prinsen, E.; et al. Analysis of genome sequences from plant pathogenic Rhodococcus reveals genetic novelties in virulence loci. PLoS ONE 2014, 9, e101996. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Savory, E.A.; Fuller, S.L.; Weisberg, A.J.; Thomas, W.J.; Gordon, M.I.; Stevens, D.M.; Creason, A.L.; Belcher, M.S.; Serdani, M.; Wiseman, M.S.; et al. Evolutionary transitions between beneficial and phytopathogenic Rhodococcus challenge disease management. eLife 2017, 6, e30925. [Google Scholar] [CrossRef] [Scilit]
- Savory, E.; Weisberg, A.J.; Stevens, D.M.; Creason, A.L.; Fuller, S.L.; Pearce, E.M.; Chang, J.H. Phytopathogenic Rhodococcus Have Diverse Plasmids with few conserved virulence functions. Front. Microbiol. 2020, 11, 1022. [Google Scholar] [CrossRef] [Scilit]
- Francis, I.M.; Vereecke, D. Plant−Associated Rhodococcus Species, for Better and for Worse. In Biology of Rhodococcus; Alvarez, H., Ed.; Microbiology Monographs; Springer: Berlin/Heidelberg, Germany, 2019; Volume 16, pp. 359–377. [Google Scholar]
- Dhaouadi, S.; Mougou, A.H.; Rhouma, A. The plant pathogen Rhodococcus fascians. History, disease symptomatology, host range, pathogenesis and plant–pathogen interaction. Ann. Appl. Biol. 2020, 177, 4–15. [Google Scholar] [CrossRef] [Scilit]
- Cornelis, K.; Ritsema, T.; Nijsse, J.; Holsters, M.; Goethals, K.; Jaziri, M. The plant pathogen Rhodococcus fascians colonizes the exterior and interior of the aerial parts of plants. Mol. Plant Microbe Interact. 2001, 14, 599–608. [Google Scholar] [CrossRef] [Scilit]
- Goethals, K.; Vereecke, D.; Jaziri, M.; Van Montagu, M.; Holsters, M. Leafy gall formation by Rhodococcus fascians. Annu. Rev. Phytopatho. 2001, 39, 27–52. [Google Scholar] [CrossRef] [Scilit]
- Stes, E.; Francis, I.; Pertry, I.; Dolzblasz, A.; Depuydt, S.; Vereecke, D. The leafy gall syndrome induced by Rhodococcus fascians. FEMS Microbiol. Lett. 2013, 342, 187–194. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Dolzblasz, A.; Banasiak, A.; Vereecke, D. Neovascularization during leafy gall formation on Arabidopsis thaliana upon Rhodococcus fascians infection. Planta 2018, 247, 215–228. [Google Scholar] [CrossRef] [PubMed]
- Pertry, I.; Václavíková, K.; Depuydt, S.; Galuszka, P.; Spíchal, L.; Temmerman, W.; Stes, E.; Schmülling, T.; Kakimoto, T.; Van Montagu, M.; et al. Identification of Rhodococcus fascians cytokinins and their modus operandi to reshape the plant. Proc. Natl. Acad. Sci. USA 2009, 106, 929–934. [Google Scholar] [CrossRef] [Scilit]
- Pertry, I.; Václavíková, K.; Gemrotová, M.; Spíchal, L.; Galuszka, P.; Depuydt, S.; Temmerman, W.; Stes, E.; De Keyser, A.; Riefler, M.; et al. Rhodococcus fascians impacts plant development through the dynamic Fas−mediated production of a cytokinin mix. Mol. Plant Microbe Interact. 2010, 23, 1164–1174. [Google Scholar] [CrossRef] [Scilit]
- Francis, I.M.; De Keyser, A.; De Backer, P.; Simón−Mateo, C.; Kalkus, J.; Pertry, I.; Ardiles−Diaz, W.; De Rycke, R.; Vandeputte, O.M.; El Jaziri, M.; et al. pFiD188, the linear virulence plasmid of Rhodococcus fascians D188. Mol. Plant Microbe Int. 2012, 25, 637–647. [Google Scholar] [CrossRef] [Scilit]
- Radhika, V.; Ueda, N.; Tsuboi, Y.; Kojima, M.; Kikuchi, J.; Kudo, T.; Sakakibara, H. Methylated cytokinins from the phytopathogen Rhodococcus fascians mimic plant hormone activity. Plant Physiol. 2015, 169, 1118–1126. [Google Scholar] [CrossRef] [Scilit]
- Dhandapani, P.; Song, J.; Novak, O.; Jameson, P.E. Infection by Rhodococcus fascians maintains cotyledons as a sink tissue for the pathogen. Ann. Bot. 2017, 119, 841–852. [Google Scholar]
- Dhandapani, P.; Song, J.; Novák, O.; Jameson, P.E. Both epiphytic and endophytic strains of Rhodococcus fascians influence transporter gene expression and cytokinins in infected Pisum sativum L. seedlings. Plant Growth Regul. 2018, 85, 231–242. [Google Scholar] [CrossRef] [Scilit]
- Jameson, P.E.; Dhandapani, P.; Song, J.; Zatloukal, M.; Strnad, M.; Remus−Emsermann, M.N.P.; Schlechter, R.O.; Novák, O. The cytokinin complex associated with Rhodococcus fascians: Which compounds are critical for virulence? Front. Plant Sci. 2019, 10, 674. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Temmerman, W.; Vereecke, D.; Dreesen, R.; Van Montagu, M.; Holsters, M.; Goethals, K. Leafy gall formation is controlled by fasR, an AraC−type regulatory gene in Rhodococcus fascians. Bacteriology 2000, 182, 5832–5840. [Google Scholar] [CrossRef] [Scilit]
- Crespi, M.; Messens, E.; Caplan, A.B.; van Montagu, M.; Desomer, J. Fasciation induction by the phytopathogen Rhodococcus fascians depends upon a linear plasmid encoding a cytokinin synthase gene. EMBO J. 1992, 11, 795–804. [Google Scholar] [CrossRef] [Scilit]
- Vereecke, D.; Zhang, Y.; Francis, I.M.; Lambert, P.Q.; Venneman, J.; Stamler, R.A.; Kilcrease, J.; Randall, J.J. Functional genomics insights into the pathogenicity, habitat fitness, and mechanisms modifying plant development of Rhodococcus sp. PBTS1 and PBTS2. Front. Microbiol. 2020, 11, 14. [Google Scholar] [CrossRef] [Scilit]
- Maes, T.; Vereecke, D.; Ritsema, T.; Cornelis, K.; Ngo Thi Thu, H.; Van Montagu, M.; Holsters, M.; Goethals, K. The att locus of Rhodococcus fascians strain D188 is essential for full virulence on tobacco through the production of an autoregulatory compound. Mol. Microbiol. 2001, 42, 13–28. [Google Scholar] [CrossRef] [Scilit]
- Nikolaeva, E.V.; Park, S.Y.; Kang, S.; Olson, T.N.; Kim, S.H. Ratios of cells with and without virulence genes in Rhodococcus fascians populations correlate with degrees of symptom development. Plant Dis. 2009, 93, 499–506. [Google Scholar] [CrossRef] [Scilit]
- Stamler, R.A.; Kilcrease, J.; Kallsen, C.; Fichtner, E.J.; Cooke, P.; Heerema, R.J.; Randall, J.J. First Report of Rhodococcus isolates causing pistachio bushy top syndrome on ‘UCB−1′ rootstock in California and Arizona. Plant Dis. 2015, 99, 1468–1476. [Google Scholar] [CrossRef] [Scilit]
- Stamler, R.A.; Heerema, R.; Randall, J.J. First report of Phytopathogenic Rhodococcus isolates on pistachio bushy top syndrome ‘UCB−1′ rootstock in New Mexico. Plant Dis. 2015, 99, 1854. [Google Scholar] [CrossRef] [Scilit]
- Dhaouadi, S.; Mougou, A.H.; Bahri, B.A.; Rhouma, A.; Fichtner, E.J. First report of Rhodococcus spp. isolates causing stunting and lateral stem proliferation of Iresine herbstii ‘Aureo−Reticulata’ in Tunisia. Phytopathol. Mediterr. 2019, 58, 391–394. [Google Scholar]
- Dhaouadi, S.; Mougou, A.H.; Gleason, M.L.; Rhouma, A.; Fichtner, E.J. First report of bushy stunt of Japanese spindle caused by Rhodococcus spp. in Tunisia. Plant Dis. 2020, 104, 1250. [Google Scholar] [CrossRef] [Scilit]
- Dhaouadi, S.; Win, J.; Mougou, A.H.; Harant, A.; Kamoun, S.; Rhouma, A. Genome sequences of plant−associated Rhodococcus sp. isolates from Tunisia. Microbiol. Resour. Announc. 2020, 9, e00293-20. [Google Scholar] [CrossRef] [Scilit]
- California Department of Food and Agriculture. Fruit and nut crops. In California Agricultural Statistics Review; 2013–2014; pp. 56–80. Available online: https://www.motherjones.com/wp-content/uploads/resourcedirectory_2013-2014_1.pdf (accessed on 5 January 2021).
- International Nut and Dried Fruit Council. Statistics Database; PR Newswire: New York, NY, USA, 2018. [Google Scholar]
- Gouta, H.; Ksia, E.; Ayachi, M.M.; Martínez−Gómez, P. Agronomical evaluation of local Tunisian almond cultivars and their breeding prospects. Eur. J. Hortic. Sci. 2019, 84, 73–84. [Google Scholar] [CrossRef] [Scilit]
- Ghrab, M.; Ben Mimoun, M.; Gouta, H. Pistachio production in Tunisia. FAO CIHEAM Nucis−Newsletter 2004, 12, 19–21. [Google Scholar]
- Gouta, H.; Mars, M.; Gouiaa, M.; Ghrab, M.; Zarrouk, M.; Mliki, A. Genetic diversity of almond (Prunus amygdalus batsch) in Tunisia: A morphological traits analysis. Acta Hortic. 2011, 912, 351–358. [Google Scholar] [CrossRef] [Scilit]
- Ghrab, M.; Zribi, F.; Chelli−Chaabouni, A.; Gouta, H.; Ben Mimoun, M. Genetic diversity of Pistachio in Tunisia. Options Méditerranéennes Série A Séminaires Méditerranéens 2010, 94, 221–228. [Google Scholar]
- Michailides, T.J.; Morgan, D.P.; Doster, M.A.; Kölliker, R. Biology, Epidemiology and Control of Alternaria and Aspergillus Bligths of Pistachio and Effects of These Diseases on Nut Quality; Annual Reports Crop; California Pistachio Industry, 1994; pp. 49–56. [Google Scholar]
- Michailides, T.J. Foliar and Fruit Fungal Diseases of Pistachio. In Advanced Course Production and Economics of Nut Crops; 1998; pp. 18–29. [Google Scholar]
- Michailides, T.J. Panicle and shoot blight. Compendium of Nut Crop Diseases in Temperate Zones; Teviotdale, B.L., Michailides, T.J., Pscheidt, J.W., Eds.; American Phytopathological Society: St. Paul, MN, USA, 2002; pp. 68–69. [Google Scholar]
- Guldur, M.E.; Dikilitas, M.; Ak, B.E. Pistachio diseases in the southeastern Anatolian region. Acta Hortic. 2011, 912, 739–742. [Google Scholar] [CrossRef] [Scilit]
- Vereecke, D.; Fichtner, E.J.; Lambert, P.Q.; Cooke, P.; Kilcrease, J.; Stamler, R.; Zhang, Y.; Francis, I.M.; Randall, J.J. Colonization and survival capacities underlying the multi−faceted life of Rhodococcus sp. PBTS1 and PBTS2. Plant Pathol. 2020. [Google Scholar] [CrossRef] [Scilit]
- Kado, C.I.; Heskett, M.G. Selective media for isolation of Agrobacterium, Corynebacterium, Erwinia, Pseudomonas, and Xanthomonas. Phytopathology 1970, 60, 969–976. [Google Scholar] [CrossRef] [Scilit]
- Pei, Z.; Bini, E.J.; Yang, L.; Zhou, M.; Francois, F.; Blaser, M.J. Bacterial biota in the human distal esophagus. PNAS 2004, 101, 4250–4255. [Google Scholar] [CrossRef] [Scilit]
- Nikolaeva, E.V.; Kang, S.; Olson, T.N.; Kim, S.H. Real−time PCR detection of Rhodococcus fascians and discovery of new plants associated with R. fascians in Pennsylvania. Plant Health Prog. 2012, 13, 24. [Google Scholar] [CrossRef] [Scilit]
- Stange, R.R.; Jeffares, D.; Young, C.; Scott, D.B.; Eason, J.R.; Jameson, P.E. PCR amplification of the fas−1 gene for the detection of virulent strains of Rhodococcus fascians. Plant Pathol. 1996, 45, 407–417. [Google Scholar] [CrossRef] [Scilit]
- Serdani, M.; Curtis, M.; Miller, M.L.; Kraus, J.; Putnam, M.L. Loop−mediated isothermal amplification and polymerase chain reaction methods for specific and rapid detection of Rhodococcus fascians. Plant Dis. 2013, 97, 517–529. [Google Scholar] [CrossRef] [Scilit]
- Dhaouadi, S.; Mougou, A.H.; Wu, C.J.; Gleason, M.L.; Rhouma, A. Sequence analysis of 16S rDNA, gyrB and alkB genes of plant−associated Rhodococcus species from Tunisia. Int. J. Syst. Evol. Microbio. 2020. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Altschul, S.F.; John, C.; Wootton, E.; Gertz, M.; Agarwala, R.; Morgulis, A.; Schaffer, A.A.; Yi−Kuo, Y. Protein database searches using compositionally adjusted substitution matrices. FEBS J. 2005, 272, 5101–5109. [Google Scholar] [CrossRef] [Scilit]
- Altschul, S.F.; Thomas, L.; Madden, A.A.; Zhang, S.J.; Zhang, Z.; Miller, W.; Lipman, D.J. Gapped BLAST and PSI−BLAST: A new generation of protein database search programs. Nucleic Acids Res. 1997, 25, 3389–3402. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Tamura, K.; Stecher, G.; Peterson, D.; Filipski, A.; Kumar, S. MEGA6: Molecular Evolutionary Genetics Analysis version 6.0. Mol. Biol. Evol. 2013, 30, 2725–2729. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Tamura, K.; Nei, M. Estimation of the number of nucleotide substitutions in the control region of mitochondrial DNA in humans and chimpanzees. Mol. Biol. Evol. 1993, 10, 512–526. [Google Scholar] [PubMed]
- Stamatakis, A. Maximum likelihood−based phylogenetic analyses with thousands of taxa and mixed models. Bioinformatics 2006, 22, 2688–2690. [Google Scholar] [CrossRef] [Scilit]
- Biesta−Peters, E.G.; Reij, G.M.; Joosten, H.; Gorris, L.G.M.; Marcel, H.; Zwietering, M.H. Comparison of two optical−density−based methods and a plate count method for estimation of growth parameters of Bacillus cereus. Appl. Environ. Microbiol. 2010, 76, 1399–1405. [Google Scholar] [CrossRef] [Scilit]
- Vereecke, D.; Cornelis, K.; Temmerman, W.; Jaziri, M.; Van Montagu, M.; Holsters, M.; Goethals, K. Chromosomal locus that affects pathogenicity of Rhodococcus fascians. Bacteriology 2002, 184, 1112–1120. [Google Scholar] [CrossRef] [Scilit]
- Putnam, M.L.; Miller, M.L. Rhodococcus fascians in herbaceous perennials. Plant Dis. 2007, 91, 1064–1076. [Google Scholar] [CrossRef] [Scilit]



| Primer | Nucleotide Sequence (5′ → 3′) | Target | Amplicon Size (bp) | Reference | Cycling Conditions | Total Amount (25 µL/PCR) |
|---|---|---|---|---|---|---|
| 27F 1492R | AGAGTTTGATCMTGGCTCAG TACGGYTACCTTGTTACGACTT | 16S ribosomal DNA | 1500 | [53] | 1 cycle of initial denaturation: at 95 °C for 5 min; 35 cycles of denaturation at 95 °C for 30 s, annealing at 59 °C for 30 s, and extension at 72 °C for 90 s; 1 cycle of final extension at 72 °C for 5 min | 50 ng: DNA 1X: Taq buffer 0.2 mM: dNTPs 4 mM: MgCl2 24 pmol: each primer 1U: Taq DNA polymerase |
| vicA1497FvicA1990R | TCTGGATCTCGAAGTGCAAACCGT AGCGTACAAGGCCTTCCTGAAAGA | Putative malate synthase | 179 | [54] | 1 cycle of initial denaturation: at 95 °C for 5 min; 45 cycles of denaturation at 95 °C for 30 s, annealing at 64 °C for 30 s, and extension at 72 °C for 90 s; 1 cycle of final extension at 72 °C for 5 min | 50 ng: DNA 1X: Taq buffer 0.24 mM: dNTPs 2 mM: MgCl2 10 pmol: each primer 1U: Taq DNA polymerase |
| JPEL JPER | GGGAATTCCGACCGTATCCAGTGT CGGGATCCATATCGAACCGCCCTC | fas−1 isopentenyltransferase | 225 | [55] | 1 cycle of initial denaturation: at 94 °C for 3 min; 33 cycles of denaturation at 94 °C for 30 s, annealing at 65 °C for 60 s, and extension at 72 °C for 40 s; 1 cycle of final extension at 72 °C for 5 min | 10 ng: DNA 1X: Taq buffer 0.4 mM: dNTPs 4 mM: MgCl2 10 pmol: each primer 1U: Taq DNA polymerase |
| p450−F p450−R | TATCCTTGCTGCGGAGTTCT CAACCACCGCAATAATTCCT | fasA, P450 monooxygenase | 538 | [56] | 1 cycle of initial denaturation: at 94 °C for 2 min; 33 cycles of denaturation at 94 °C for 30 s, annealing at 55 °C for 30 s, and extension at 72 °C for 60 s; 1 cycle of final extension at 72 °C for 5 min | 50 ng: DNA 1X: Taq buffer, 1.5 mM: MgCl2, 0.2 mM dNTPs, 10 pmol: each primer, 1U: Taq DNA polymerase. |
| Fas−F Fas−R | CAACACTACTTTGCCCAGCA GGCCAACTCCTCTGGTGTTA | fasD, isopentenyltransferase | 195 | |||
| fasR F fasR R | ATCAACGTCGACCTCGGAAT GCACGGGTTACAGTCATT | fasR gene, putative transcriptional regulator | 688 | [31] | ||
| attA−585F attA−879R | GCCTGGAAGCGCATCAACATCAAT TTCTTCTGCGGCATGATCGAGCTA | attA, Arginino−succinate lyase | 505 | [35] | 1 cycle of initial denaturation: at 95 °C for 2 min; 35 cycles of denaturation at 95 °C for 20 s, annealing at 55 °C for 20 s, and extension at 72 °C for 60 s; 1 cycle of final extension at 72 °C for 5 min | 10 ng: DNA 1X: Taq buffer 0.2mM: dNTPs 2 mM: MgCl2 10pmol: each primer 1U: Taq DNA polymerase |
| attR−683F attR−887R | GGTGCAGCAGTATTCGTTGTCGTT TGCACATCTCGTCTTCTGCAGTCA | attR, LysR type transcriptional regulator | 320 |
| Nursery/Orchard | Isolate Code | Location | Crop | Rootstock/Scion Cultivars | Symptomatic/Asymptomatic | Epi−/Endophytic | Isolate Color | 16S rDNA Gene GenBank Accession Number | vicA Gene GenBank Accession Number |
|---|---|---|---|---|---|---|---|---|---|
| Nursery | JZ1 | Gafsa | Almond | Bitter almond | Asymptomatic | Epiphyte | Yellow chrome | MN366362 | * |
| JZ2 | GF | Epiphyte | Yellow chrome | MN366363 | MN544259 | ||||
| BA2 | Manouba | Almond | Mazetto/GF | Asymptomatic | Epiphyte | Red–orange | MN366364 | MN544260 | |
| BA3 | Epiphyte | Yellow chrome | MN366365 | MN544261 | |||||
| F1 | Tunis | Almond | GF | Asymptomatic | Epiphyte | Yellow chrome | MN366366 | MN544262 | |
| GS6 | Kasserine | Almond | Bitter almond | Symptomatic | Endophyte | Yellow chrome | MK455765 | MN544263 | |
| SB10 | Sidi Bouzid | Almond | Garnem | Asymptomatic | Endophyte | Yellow chrome | MK455764 | MN544264 | |
| CS | Gafsa | Pistachio | P. vera var. Mateur | Asymptomatic | Epiphyte | Yellow chrome | MN366367 | * | |
| Orchard | K4 | Kef | Pistachio | P. vera var. Mateur | Symptomatic | Epiphyte | Yellow chrome | MN366368 | MN544265 |
| K5 | Epiphyte | Red–orange | MK455766 | MN544266 | |||||
| Mt1 | Bizerte | Pistachio | P. vera var. Mateur | Asymptomatic | Epiphyte | Yellow chrome | MN366369 | MN544267 | |
| Mt2 | P. atlantica | Symptomatic | Epiphyte | Yellow chrome | MN366370 | MN544268 | |||
| Mt5 | Epiphyte | Red–orange | MN366371 | MN544269 | |||||
| Mt9 | P. vera | Symptomatic | Epiphyte | Yellow chrome | MN366372 | MN544270 | |||
| Mt11 | Epiphyte | Red–orange | MN366373 | * |
| Strain | Fasciation Symptoms x (%) | Main Stem Length (mm) y | Total Number of Shoots z |
|---|---|---|---|
| Control | 0 | 108.8a ± 0.50 | 1a ± 0.00 |
| JZ1 | 0 | 61 bcdef ± 0.6 | 1.0a ± 0.0 |
| JZ2 | 0 | 73 abcdef ± 1.0 | 1.0a ± 0.0 |
| BA2 | 0 | 54 cdef ± 0.7 | 1.0a ± 0.0 |
| BA3 | 10 | 40 edfg ± 0.7 | 1.7a ± 0.4 |
| F1 | 20 | 17,1 g ± 0.14 | 1.3a ± 0.21 |
| GS6 | 40 | 32.2 fg ± 0.51 | 1.8a ± 0.35 |
| SB10 | 90 | 38 efg ± 0.48 | 3.3b ± 0.33 |
| CS | 0 | 69 abcdef ± 1.4 | 1.0a ± 0.0 |
| K4 | 10 | 73.3 abcde ± 1.2 | 1.3a ± 0.2 |
| K5 | 60 | 58 bcdef ± 0.83 | 2.3b ± 0.42 |
| Mt1 | 20 | 85 abc ± 0.8 | 1.7a ± 0.4 |
| Mt2 | 0 | 77 abcde ± 1.4 | 1.0a ± 0.2 |
| Mt5 | 20 | 63 bcdef ± 1.1 | 2.3b ± 0.8 |
| Mt9 | 0 | 81 abcd ± 0.8 | 1.0a ± 0.0 |
| Mt11 | 100 | 59 bcdef ± 0.8 | 2.0b ± 0.2 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Dhaouadi, S.; Hamdane, A.M.; Rhouma, A. Isolation and Characterization of Rhodococcus spp. from Pistachio and Almond Rootstocks and Trees in Tunisia. Agronomy 2021, 11, 355. https://doi.org/10.3390/agronomy11020355
Dhaouadi S, Hamdane AM, Rhouma A. Isolation and Characterization of Rhodococcus spp. from Pistachio and Almond Rootstocks and Trees in Tunisia. Agronomy. 2021; 11(2):355. https://doi.org/10.3390/agronomy11020355
Chicago/Turabian StyleDhaouadi, Sabrine, Amira Mougou Hamdane, and Ali Rhouma. 2021. "Isolation and Characterization of Rhodococcus spp. from Pistachio and Almond Rootstocks and Trees in Tunisia" Agronomy 11, no. 2: 355. https://doi.org/10.3390/agronomy11020355
APA StyleDhaouadi, S., Hamdane, A. M., & Rhouma, A. (2021). Isolation and Characterization of Rhodococcus spp. from Pistachio and Almond Rootstocks and Trees in Tunisia. Agronomy, 11(2), 355. https://doi.org/10.3390/agronomy11020355

