Next Article in Journal
Hybrids Development between Greek Salvia Species and Their Drought Resistance Evaluation along with Salvia fruticosa, under Attapulgite-Amended Substrate
Next Article in Special Issue
NLR Genes Related Transcript Sets in Potato Cultivars Bearing Genetic Material of Wild Mexican Solanum Species
Previous Article in Journal
Influence of the Downwash Wind Field of Plant Protection UAV on Droplet Deposition Distribution Characteristics at Different Flight Heights
Previous Article in Special Issue
Structural Variations in the Genome of Potato Varieties of the Ural Selection
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Phenotypic and DNA Marker-Assisted Characterization of Russian Potato Cultivars for Resistance to Potato Cyst Nematodes

by
Tatjana A. Gavrilenko
1,*,
Aleksander V. Khiutti
2,
Natalia S. Klimenko
1,
Olga Y. Antonova
1,
Natalia A. Fomina
1 and
Olga S. Afanasenko
2
1
N.I. Vavilov All-Russian Institute of Plant Genetic Resources (VIR), 190000 Saint-Petersburg, Russia
2
All Russian Institute of Plant Protection (FSBSI VIZR), 196608 Saint-Petersburg, Russia
*
Author to whom correspondence should be addressed.
Agronomy 2021, 11(12), 2400; https://doi.org/10.3390/agronomy11122400
Submission received: 6 October 2021 / Revised: 18 November 2021 / Accepted: 22 November 2021 / Published: 25 November 2021
(This article belongs to the Special Issue Molecular Genetic Studies in Potato Breeding)

Abstract

Potato is one of the most important food crops in the world and also in the Russian Federation. Among harmful organisms reducing potato yield potential, the potato cyst nematodes (PCN) are considered to be ones of the most damaging pests. Information on PCN resistant cultivars is important for potato breeding and production. Russian potato cultivars are characterized in the state-bio-test program for resistance to only one PCN species Globodera rostochiensis and one pathotype Ro1 which is reported to be present in the country. This study aimed to find domestic cultivars with multiple resistances to different PCN species and different pathotypes using phenotyping coupled with molecular marker analysis due to the risk of the occasional introduction of new pests. The phenotypic response was determined by the inoculation of plants with pathotypes Ro5 of G. rostochiensis and Pa3 of G. pallida. The obtained results were supplemented by the state-bio-test data on resistance to Ro1 of G. rostochiensis. Nine of 26 Russian cultivars were resistant both to Ro5 and Ro1 pathotypes and two cultivars possess multiple resistances to both PCN species. Most tested molecular markers associated with the Gpa2, GpaVvrn, GpaVsspl, Grp1 loci showed discrepancies with phenotyping. However, a predictive haplotype and epistatic effect were detected.

1. Introduction

Potato is one of the most important food crops in the world and also in the Russian Federation which is the third largest producer of the crop and fourth by potato harvested area [1]. Many harmful organisms reduce the potato yield potential. Among them, the potato cyst nematodes (PCN) are considered to one of the most damaging worldwide-recognized quarantine pests of potato [2,3,4,5]. PCN originated in South America and since the 19th century they were introduced in North and Central America, Europe, Asia, Africa and Australia [3,4]. There are two economically important PCN species–the golden cyst nematode G. rostochiensis (Wollenweber) and the pale cyst nematode G. pallida (Stone) Behrens causing 19% to 80% potato yield losses depending on the cultivar, seasonal conditions and the pathogen populations in the fields [6,7]. Besides yield losses, the quarantine status of the PCN implies the high expense for monitoring and regulatory activities. Nematode eggs can survive within the cysts for several decades in the absence of a suitable host removing infested lands for a long time [8]. Many nematicides are ineffective and toxic to the environment. Moreover chemical control might be ineffective [9,10].
At present, the golden cyst nematode is recorded in all European countries and G. pallida is not present in only eight European countries [2,3,4,11,12]. These two PCN species are differentiated into eight pathotypes–five (Ro1–Ro5) for G. rostochiensis and three pathotypes (Pa1–Pa3) for G. pallida [13]. It was later suggested to rename the pathotypes of golden nematode and to recognize only three reliably recognizable pathotypes (Ro1/Ro4, Ro2/Ro3 and Ro5) [14]. Among them Ro1 is the most widely distributed pathotype of the golden nematode [15]. For G. pallida, there is no current information on the prevalence of a particular pathotype in European countries.
In the Russian Federation, G. rostochiensis was first reported in 1948 in the North-West part of the country and since then it has spread in the European part of the country, as well as in Southern Siberia and in the Russian Far East [16]. Ro1 of G. rostochiensis is the only one pathotype recorded in the Russian Federation [17,18]. According to the data given in the official sources, “The National Reports on the quarantine phytosanitary status of the territory of the Russian Federation”, for the last three years (2018–2020), the area of established quarantine phytosanitary zones for G. rostochiensis has decreased more than 1.5 times (from 1 120 413.27 hectares in 2018 to 733 421.09 hectares in 2020).
This is due to the increasing trend of growing cultivars which are resistant to pathotype Ro1 of G. rostochiensis [19,20,21]. In Russia, the state bio-testing of potato cultivars for nematode resistance is performed only for Ro1 of G. rostochiensis. At present, 57.1% of 490 cultivars included in the State Register of Breeding Achievements are resistant to Ro1 of golden potato nematode but only 31.4% of resistant cultivars were bred in Russia [22].
Pathotypes Ro2/Ro3 and Ro5 of golden nematode have never been reported for the Russian Federation. At the same time, they were detected in some regions of neighboring countries: in Finland—pathotype Ro2 [23], in Norway—pathotypes Ro2 and Ro3 [24] and in Poland—pathotype Ro5 [25].
G. pallida has never been reported for the Russian Federation. Pale cyst nematode was detected in a few territories of Finland [26] and Estonia [27]; restricted distribution was reported for Norway where all three pathotypes of G. pallida were identified [24,28]. G. pallida was also reported for specific region of Ukraine [29] and Poland [30]. However, currently, the pale cyst nematode is no longer present in these two countries [5].
The emergence of new pathotypes is possible due to both adaptation processes in PCN populations and the invasion from overseas. These risks make it necessary to search for cultivars, breeding clones, germplasm accessions with resistance to new pathotypes of PCN. More than 50 potato species show resistance to at least one pathotype of G. rostochiensis and/or G. pallida, in at least one accession [15]. The resistance against PCN was transferred into potato cultivars from Andean species (Solanum tuberosum ssp. andigena Hawkes, S. vernei Bitter & Wittm., S. sparsipilum (Bitter) Juz. & Bukasov, S. spegazzini Bitter, S. multidissectum Hawkes, others). More than 20 genes and QTLs involved in control of resistance to different PCN pathotypes and species have been identified and mapped; many of them are clustered in the potato genome, especially on the chromosome V (see the latest review of [15,31]). R-genes and QTLs conferring multiple resistance to different PCN species and PCN pathotypes are particularly valuable for breeding, for example Grp1_QTL conferring resistance to G. pallida Pa2 and Pa3, and also to G. rostochiensis pathotype Ro5 [32,33]. The Grp1_QTL was transferred into breeding lines from interspecific hybrid between S. tuberosum, S. vernei, S. oplocense Hawkes, S. tuberosum ssp. andigena [32]. The use of bioassays for selection of nematode resistant genotypes is time consuming, laborious and costly. In the last decades, in addition to phenotypic evaluation, marker-assisted selection (MAS) has increasingly been used for identification of PCN resistant cultivars and advanced breeding lines [34,35,36,37,38,39,40,41,42,43,44,45] and for assessment of genetic diversity for PCN resistance in potato germplasm collections [17,46,47,48]. The results of molecular screening are not influenced by environmental conditions and the plant developmental stage. At the same time MAS does not always give certain results when compared with bio-test data what can be related to the recombination between the linked marker and the resistance locus, the quantitative inheritance of resistance traits controlled by multiple QTLs with different effects and the insufficient number of reliable markers associated with them, the allelic effects and the epistatic interactions [49,50,51].
A number of molecular markers of major R-genes and QTLs involved in the quantitatively inherited nematode resistance were developed for breeding of the PCN resistant potatoes [15,52]. According to results of molecular marker analysis the majority of commercial potato cultivars which are highly resistant to the most wide-spread Ro1 pathotype of G. rostochiensis have the major H1 gene from S. tuberosum ssp. andigena while the Gro1-4 gene from S. spegazzini is much less common [36,37,38,39,40,41,43,53,54].
In the case of Russian cultivars, molecular screening for H1 resistance was first applied by V. Birukova and colleagues [55] who screened with marker TG689 a set of 109 cultivars of different origin (Western European, Ukrainian, Belarusian) including 36 cultivars bred in Russia. Later in a series of our research, a bigger subset of 211 cultivars bred in the Russian Federation were screened with several markers of the H1 and Gro1-4 genes [42,56,57,58,59]. These subsets included cultivars with declared resistance/susceptibility to Ro1 of golden nematode [22]. The obtained results indicated high (87%) predictive association between the presence of two markers of the H1 gene-57R and TG689- and phenotypic resistance to Ro1. The diagnostic value of these markers can be increased up to 90% in the case of counting moderately resistant cultivars as resistant genotypes [42,56,57,58,59]. This study also demonstrated the extremely low frequency of Gro1-4 resistance-predictive allele within the subset of Russian potato cultivars.
In the case of resistance to pathotype Ro5 of golden nematode and to Pa2/Pa3 pathotypes of G. pallida, MAS is less effective due to quantitative inheritance of these traits [15,37,52,60] in comparison with molecular screening for the H1 resistance.
Bio-testing of Russian cultivars for resistance to pathotypes other than Ro1 pathotype of G. rostochiensis and to G. pallida has never been performed. Information about the presence of cultivars potentially resistant to the pale nematode pathotypes was obtained in molecular screening with the intragenic marker Gpa2-2 of the Gpa2 gene which is involved in control of resistance to the pathotypes Pa2/3 of G. pallida [57,58,59,61]. However, for cultivars which were selected in molecular screening and had marker Gpa2-2, resistance was not validated in bio-testing.
The aim of this study was to search for potato cultivars bred in Russia with resistance to pathotype Ro5 of G. rostochiensis and to Pa3 of G. pallida using bioassays and molecular marker analysis with DNA markers associated with four loci: Gpa2, GpaVvrn_QTL, GpaVsspl_QTL, Grp1_QTL. The results obtained were supplemented by the official data of state tests on resistance to Ro1 of G. rostochiensis [22] for the same cultivars to select genotypes with multiple resistance to Ro1, Ro5 pathotypes of golden nematode and to Pa3 of G. pallida.

2. Materials and Methods

2.1. Plant Material

The research material is represented by 26 popular potato cultivars bred in five Russian breeding centers which are well adapted to different regions of the Russian Federation (Alyj parus, Antonina, Čaroit, Danaâ, Evraziâ, Grand, Gusar, Holmogorskij, Il’inskij, Kolobok, Krasavčik, Krepyš, Liga, Lomonosovskij, Lûbava, Meteor, Naâda, Nakra, Nevskij, Plamâ, Samba, Sirenevyj tuman, Tango, Utro, Varâg, Vympel). ISO 9: 1995 transliteration standard was used for transliteration of the Russian names (epithets) of cultivars from Cyrillic script into a Roman alphabetic script according to Recommendation 33A of the international code of nomenclature for cultivated plants [62]. Plant material for this study was obtained from collection of N.I. Vavilov All-Russian Institute of Plant Genetic Resources (VIR). In our previous research, all these cultivars were genotyped in SSR analysis and tested using molecular markers of the H1 and Gro1-4 genes conferring resistance to pathotype Ro1 of G. rostochiensis as well as with DNA markers associated with R-genes of extreme resistance to PVY, PVX and resistance to late blight [57,58,59]. Data about their resistance to Ro1 of golden nematode were obtained from the results of bioassays recorded in the State Register of Breeding Achievements [22].
Seven Western European cultivars (Alouette, Damaris, Estrella, Labella, Queen Anne, Red Lady, Red Scarlett) with a known PCN resistance score were used as controls in evaluation of nematode resistance.

2.2. PCN Inoculation and Resistance Evaluation

2.2.1. Pathotypes of G. rostochiensis and G. pallida

Pathotype Ro5 of G. rostochiensis and pathotype Pa3 of G. pallida were used as infectious material for evaluation of potato cultivars resistance. These pathotypes were kindly provided by Dr. Anna Podlewska-Przetakiewicz from the Institute Hodowli i Aklimatyzacji Roślin (IHAR, Poland) for laboratory biotests.
Reproduction of G. rostochiensis and G. pallida pathotypes was performed on the universally susceptible potato cultivar Nevskij according to the methodology recommended by the European and Mediterranean Plant Protection Organization (EPPO) [63], following to all rules of work with quarantine objects. After four months, sufficient for the development of G. rostochiensis and G. pallida, cysts were extracted from the soil by flotation [63] and transferred for storage in a refrigerator at +4℃ until using to inoculate potato genotypes.

2.2.2. Evaluation for PCN-Resistance in Bio-Tests

Potato cultivars were evaluated for resistance to G. rostochiensis and G. pallida using the methods recommended by the EPPO [63].
Each tuber was planted in 500 cm3 plastic pots half filled with soil (250 cm3). G. rostochiensis and G. pallida inoculum was added to each pot at the rate of 1500 eggs and larvae per 100 cm3 of soil. Eggs and larvae were obtained by crushing cysts in a drop of water. After plant inoculation, additional soil was added to the top of the pot. Plants were left in controlled conditions at 22 °C with a photoperiod of 16 h of light and 8 h of dark and adequately watered.
After three months, extraction of cysts from soil was performed by flotation [63]. The extracted cysts were transferred to microscopy slides in a drop of water, crushed, and the number of eggs and larvae were counted. Relative susceptibility was determined using the formula: number of eggs and larvae on the roots of the tested cultivar/number of eggs and larvae on the roots of the control susceptible cultivar × 100%. For determination of relative susceptibility to the pathotype Ro5 of G. rostochiensis and Pa3 of G. pallida cv. Nevskij were used. The cv. Nevskij, which was used earlier in our studies as a susceptible control in the assessment of resistance to pathotype Ro1 [17] was found to be susceptible to pathotypes Ro5 and Pa3 as well as in preliminary experiments. Infestation results were evaluated according to the 9-point EPPO scale [63] (Table 1).
Two cultivars Damaris and Estrella were used as resistant control for pathotype Ro5 of G. rostochiensis. In addition, three cultivars, Labella, Queen Anne, Red Lady, were used as susceptible control for pathotype Ro5; three cultivars Alouette, Labella, Queen Anne were used as susceptible controls for pathotype Pa3 of G. pallida (Table 2). The status of PCN resistance of these control cultivars was obtained from the variety lists of the Julius Kuhn-Institute, Gross Lϋsewitz, Germany [64] and from Potato Variety Database [65].
Besides German cv. Red Scarlett [66] which is in demand on the market in Russia has been also involved in phenotyping.
Each potato cultivar was evaluated in three replications, with three to five plants tested in each replication.

2.3. Marker Assisted Selection

2.3.1. DNA Isolation and PCR Amplification

Genomic DNA was isolated from leaf samples following the CTAB-extraction method with some modification [67]. Quality and quantity of the isolated DNA samples was checked using agarose gel electrophoresis (0.8% agarose gel) and spectrophotometer (Implen NanoPhotometer N60 Touch).
The CAPS- and SCAR-markers associated with the R-genes (QTLs) conferring PCN resistance used in this study are shown in Table 3.
PCR reactions were carried out in a total volume of 20 μL containing 10 ng DNA template, 1 × PCR reaction buffer (‘Dialat’, [73]), 2.5 mM MgCl2, 0.4 mM of each dNTP (‘Dialat’), 0.5 μM of forward/reverse primer (synthesized by ‘Evrogen’, [74]) and 1U Taq polymerase (‘Dialat’).
PCR was carried out according to the standard procedures. The annealing temperatures and cycling conditions corresponded to those indicated by primer-developers (references see in the Table 3). Amplification with TG432 primer pairs was conducted following PCR-conditions proposed by A. Finkers-Tomczak with colleagues (2009) [33] with the annealing temperature 66 °C to reduce the number of extra fragments.
All reactions were conducted in at least three replicates.
The cultivar Cara was used as positive control for markers GP34/TaqI and 77R/HaeIII [68,69] and cultivar Innovator–for marker HC [34].

2.3.2. Restriction

For CAPS-markers, enzymes TaqI, HaeIII, DraI, EcoRV, RsaI (from ‘SibEnzyme’ LLC [75]) were used. The restriction was performed overnight according to the manufacturer’s protocols.

2.3.3. Electrophoresis

The PCR products were separated by electrophoresis in 2.0% agarose gels in a TBE buffer followed by ethidium bromide staining and visualization in UV light. Documentation was done using GelDoc XR gel system (BIO-RAD).

2.3.4. Diagnostic Bands of Molecular Markers

The sizes of the amplification products corresponded to published by authors for STS-marker Gpa2-1—1120 bp [39], for CAPS-marker TG432 digested with RsaI—1900 bp [33] and for ASA-marker HC—276 bp [34]. The data about presence/absence of these diagnostic bands (Supplementary Figures S1a, S2a and S3) were registered in molecular marker analysis of the subset of Russian cultivars in present research.
The sizes of diagnostic bands for CAPS-markers GP179/RsaI and GP21/DraI were not indicated by the authors, however, they showed the electrophoreograms with digested PCR products both for resistant and susceptible genotypes [32]. Therefore, it was possible to select polymorphic bands which were present in resistant and absent in susceptible genotypes in the electrophoreograms. Corresponding bands were registered in our research (Supplementary Figures S2b and S4).
In the case of the CAPS-marker 77R/HaeIII, the size of the diagnostic band was not indicated by authors, however, they showed the target restriction fragment in the electrophoreograms by an arrow for the analyzed genotypes including cultivar Cara [70]. That’s why cv. Cara was included in our study as control in molecular marker analysis. We recorded an approximately 900 bp polymorphic fragment of cv. Cara as diagnostic. D. Milczarek and co-authors (2011) tested 77R/HaeIII on PCN resistant and susceptible cultivars and designated the 750 bp fragment as target for their plant material. However, in our subset the 750 bp band was not detected (Supplementary Figure S1b).
The marker GP34/TaqI was developed on the cultivar Cara [69], but the information about size of diagnostic bands and the electrophoreograms are absent in this paper. Later, D. Milczarek with co-authors (2011) involved marker GP34/TaqI in molecular screening and indicated the 495 bp band as diagnostic. However, we did not reveal any fragment of such size in the subset of tested Russian cultivars. In our subset several polymorphic bands of GP34/TaqI were detected. Among them, two bands approximately 520 bp and 550 bp-long were registered as possible diagnostic fragments (Supplementary Figure S5) as these bands were detected in cv. Cara.
As for two CAPS-markers GP179/EcoRV and TG432/DraI [60], there is no data about target fragment size, about control genotypes and there are no images of the amplification products digested with restrictases. In case of CAPS-marker GP179/EcoRV, an approximately 150 bp and 400 bp bands resulting from the digestion of the PCR product GP179 with restrictase EcoRV were considered as diagnostic fragments (Supplementary Figure S6). The restriction profiles of the CAPS-marker TG432/DraI consisted of several polymorphic fragments for each cultivar (Supplementary Figure S7) that complicated identification of the target fragment. Due to the complexity of fragment detection, we had to abandon this marker.

2.4. Statistical Analysis

Fisher’s exact test was used to determine if there is the relationship between these markers and bio-test data.

3. Results

3.1. Bio-Test for Resistance to Pathotype Ro5 of G. rostochiensis and Screening of Potato Cultivars with Molecular Markers of the Grp1_QTL Involved in Control of Resistance to Pathotype Ro5 of Golden Nematode

The results of evaluation for resistance to pathotype Ro5 of G. rostochiensis of 33 potato cultivars (including controls) are shown in Table 4. The bio-test revealed differences among cultivars, but not between replications. Cultivars Damaris and Estrella used as resistant controls and cvs. Labella, Queen Anne and Red Lady used as susceptible controls showed the expected results in assessments (Table 4).
No cysts were detected on the roots of 10 tested cultivars (Alyj parus, Danaâ, Evraziâ, Gusar, Holmogorskij, Krepyš, Liga, Meteor, Naâda, Red Scarlet) and two resistant controls Damaris and Estrella. On the roots of four cultivars: Il’inskij, Sirenevyj tuman, Utro, Vympel a small number of cysts and larvae were formed, which corresponded to resistance. Eleven cultivars including controls were susceptible (score 1–4) to pathotype Ro5. Six cultivars (five Russian cvs. Antonina, Grand, Kolobok, Nakra, Samba and one foreign cv. Alouette) showed moderate level of resistance (score 5–6) in bio-test.
In total 16 of the 33 evaluated cultivars were characterized to be very highly resistant (score 9), six were moderately resistant (score 5–6) and 11 were susceptible (score 1–4) to pathotype Ro5 of G. rostochiensis (Table 4).
Three CAPS-markers associated with Grp1_QTL involved in the control of resistance to pathotype Ro5 of G. rostochiensis were tested on 33 cultivars (Table 4 and Supplementary Figures S2 and S4). The results showed that most cultivars that are highly resistant (score 9) to the Ro5 pathotype of G. rostochiensis exhibit the marker allele(s). Most (81,3%) of highly resistant cultivars possessed positive bands of markers TG432/RsaI and GP179/RsaI and 68,8% of resistant cultivars were positive for marker GP21/DraI (Table 4). At the same time positive bands of at least one of the three CAPS-markers were detected in many susceptible (score 1–4) cultivars (Table 4). Only one of 11 susceptible cultivars–Čaroit–was negative for all three markers of the Grp1_QTL. The Fisher’s exact test showed the absence of relations at significant level between the bioassay data and the presence/absence of the markers associated with the Grp1_QTL in the subset of 27 cultivars (16 highly resistant and 11 susceptible) when six moderately resistant cultivars were not counted.
A comparison of the results obtained for all three markers together allowed identifying six haplotypes in the studied subset. However, none of them were associated with phenotypic data for resistance to pathotype Ro5 of G. rostochiensis (Table 4).
The results of bioassay of 26 domestic cultivars for the pathotype Ro5 resistance were complemented with the official data [24] of state tests on resistance to Ro1 of G. rostochiensis and with declared resistance to Ro1 for foreign cultivars. Nine Russian cultivars (Danaâ, Evraziâ, Gusar, Holmogorskij, Krepyš, Liga, Meteor, Naâda, Vympel) and three foreign cultivars (Damaris, Estrella, Red Scarlet) possess multiple resistances to pathotypes Ro5 and Ro1 of golden nematode (Table 4).

3.2. Bio-Test for Resistance to Pathotype Pa3 of Pale Nematode (G. pallida)

Inoculation with pathotype Pa3 of pale nematode was performed on the smaller set of 19 cultivars. Only two of 16 tested cultivars Danaâ and Vympel showed high resistance (score 9) to the pathotype Pa3 of G. pallida. One cv. Samba was moderately resistant (score 6). All remaining cultivars including two susceptible controls were strongly affected by the pathotype Pa3 of pale nematode (Table 5).
Two cultivars resistant to pathotype Pa3 of pale nematode - Danaâ and Vympel (Table 5) were also resistant to Ro5 and Ro1 pathotypes of golden nematodes (Table 4). Cultivar Samba was moderately resistant to pathotype Pa3 of pale cyst nematode and pathotype of Ro5 of golden nematode and susceptible to pathotype Ro1 of G. rostochiensis (Table 4 and Table 5). Four domestic cultivars (Čaroit, Krasavčik, Lomonosovskij, Nevskij) showed susceptibility to all three PCN pathotypes–Pa3, Ro5, Ro1.

3.3. MAS with DNA Markers of Genes (QTLs) Conferring Resistance to Pathotype Pa3 of Pale Nematode (G. pallida)

Nine DNA markers associated with four loci involved in the control of resistance to Pa3 pathotype of G. pallida (Gpa2, Grp1_QTL, GpaVsspl_QTL and GpaVvrn_QTL) were used in molecular marker analysis of the whole set of 33 cultivars including controls (Supplementary Figures S1–S7). Data for 19 cultivars that took part in phenotyping are shown in Table 6.
Most markers did not have association with the phenotypic data. Thus, GpaVSspl_QTL defined by the CAPS-marker GP179/EcoRV was found in many susceptible cultivars and in one of the two resistant to pale cyst nematodes genotypes. Marker HC of the GpaVvrn_QTL was detected both in resistant and in susceptible cultivars; this marker was not taken in the total calculation of diagnostic value because the target band was unclear for the score in four cvs.: Antonina, Krasavčik, Naâda, Vympel (Table 6, Supplementary Figure S3).
Two markers Gpa2-1 and 77R/HaeIII of the Gpa2 gene were completely coinciding and showed relatively high but not significant concordance with bio-test data (a p-value lower than 10% according to the Fisher’s exact test). Although the subset of 19 cultivars participated in phenotyping and marker assay was small for statistical evaluation, both were highly resistant to pathotype Pa3 of G. pallida cultivars Danaâ and Vympel have two markers Gpa2-1 and 77R/HaeIII and 13 of 16 Pa3-susceptible cultivars were band-negative. At the same time diagnostic bands of these two markers were detected in three susceptible cvs. Alyj parus, Čaroit, Utro (Table 6).
The combination of four resistance-predictive alleles (three of the Gpa2 gene: Gpa2-1, 77R/HaeIII, GP34/TaqI-520 and one marker GP21/DraI of the Grp1_QTL) was detected only in two highly resistant to pathotype Pa3 cultivars Danaâ and Vympel (Table 6).

4. Discussion

Currently, most of the nematode-resistant commercial cultivars grown in different countries are protected by the major H1 gene from clone CPC1673 of S. tuberosum ssp. andigena which provides for over 50 years durable resistance to the most widespread pathotype Ro1 of G. rostochiensis [15,76]. At the same time cultivation of varieties with resistance to only one pathotype and one PCN species should be done carefully to prevent emergence of new virulent pathotypes and the increase of G. pallida populations, which are more difficult to be controlled [77,78]. Several examples confirm the likelihood of such risks. A propagating population of G. rostochiensis was detected on cultivars carrying the H1 gene which has been remaining effective for many years against golden nematode in the state of New York, U.S., where populations of G. rostochiensis were considered to consist solely of pathotype Ro1; later it was identified as Ro2 [79,80]. The H1 gene is not effective against the pale potato cyst nematode. Widespread planting of cultivars resistant to only G. rostochiensis has led to an increase in G. pallida infestations which currently is the predominant species in the U.K. [77]. Practically, the best economically and environmentally friendly approach to prevent the spread of PCN is the planting of cultivars with multiple resistance against different pathotypes of both species—G. rostochiensis and G. pallida through pyramiding the R genes/QTLs in a single cultivar [15]. Therefore, information about the resistance loci presented within the cultivar gene pool is the basis for the development of new breeding material with multiple resistance to PCN.
In some countries, for example, in Russia, G. rostochiensis, pathotype Ro1 is the only detected species and pathotype. Therefore, new sources of resistance to PCN species may be in demand in the coming future. In the present study we report the results of bio-tests for resistance to pathotype Ro5 of G. rostochiensis and to G. pallida pathotype Pa3 which were conducted for the first time for Russian cultivars and successful finding of several domestic cultivars with multiple PCN resistance. Phenotypic assays revealed 13 domestic cultivars which are highly resistant to the pathotype Ro5 of golden nematode, nine of them (cvs. Danaâ, Evraziâ, Gusar, Holmogorskij, Krepyš, Liga, Meteor, Naâda, Vympel) are also resistant to pathotype Ro1 and two of them (cvs. Danaâ and Vympel) possess resistance both to the pathotypes Ro5 and Ro1 of G. rostochiensis and to G. pallida, pathotype Pa3.
The main sources of resistance to the pathotype Ro5 of golden nematode and to the Pa2/Pa3 of pale nematode are S. vernei [15,34,52] and S. tuberosum ssp. andigena [15,35,52], wherein most of the European resistant varieties are protected against G. pallida by the major GpaVvrn_QTL from S. vernei [34]. For Russian cultivars the sources of introgression of resistance to the pathotype Ro5 of golden nematode and to Pa3 of pale nematode are not clear because of their complex origin. Five of 13 highly resistant to Ro5 cultivars (Alyj parus, Liga, Naâda, Sirenevyj tuman, and Danaâ) have the same interspecific hybrids with S. tuberosum ssp. andigena and with S. vernei in their pedigrees [57]; these six cultivars were developed by the same breeders who probably used the common source of the Grp1 resistance. Two Russian cultivars Gusar and Evraziâ originated from crosses with resistant to Ro5 German cultivars Arosa and Barbara respectively. Source of PCN resistance of cv. Vympel is unknown. In the pedigrees of the rest six highly resistant to Ro5 cultivars there are indications about the involvement of S. tuberosum ssp. andigena and/or S. vernei in their origin.
Cultivars Danaâ and Vympel showing multiple PCN resistance are particularly interesting for national breeding programs directed on marker-assisted-gene pyramading of the R-genes/QRLs to different pests and diseases. For potatoes a successful stacking of the major R-genes involved in monogenic control of resistance to pathogens was reported in a number of papers [39,44,50,53,81]. Several studies demonstrate the potential of MAS for stacking of QTLs involved in the control of quantitative resistance to G. pallida, pathotype Pa2/Pa3 [45,82,83] as well as for pyramiding of QTLs conferring resistance to both PCN species—G. pallida, pathotype Pa2/3 and G. rostochiensis, pathotype Ro5 [41,43,44,45,46,47,48,49,50,51,52,53,54]. The efficiency of such breeding programs can be significantly improved using marker-assisted selection.
However, unlike the success with MAS for resistance to Ro1 conferring the major H1 gene, marker-assisted selection for durable resistance to the other pathotypes of G. rostochiensis as well as to G. pallida is much more complicated. Two aspects can be considered with regards to the efficiency of MAS for multiple PCN resistance: (1) diagnostic value of molecular markers which is dependent on the genetic background of the tested germplasms; (2) different scores for moderate resistant genotypes and stability of phenotyping data.
Many DNA markers associated with QRLs of PCN resistance have been developed but they are pedigree-specific since these molecular markers were designed using specific segregating populations. For example, CAPS-marker TG432/RsaI of the Grp1 locus conferring resistance to Ro5 pathotype of G. rostochiensis and HC marker linked to the GpaVvrn conferring resistance to G. pallida, Pa2/Pa3 demonstrated the high diagnostic value in Spanish [81] and Indian breeding programs [41,43,44]. At the same time D. Milczarek with colleagues [37] showed low predictive value of these markers for the detection of resistant and susceptible cultivars. The low diagnostic value of the HC marker linked with the GpaVvrn_QTL was shown by K. Asano with colleagues [39]. Our results demonstrated that in the genetic background of tested Russian cultivars, markers of the Gpa2, Grp1_QTL, GpaVSspl_QTL and the GpaVvrn lost their predictive value-none of the used markers was associated with the phenotypic data of resistance to pathotype Ro5 of G. rostochiensis or to Pa3 of G. pallida.
According to A. Barone with colleagues (1990) [84], a major dominant gene Gro1 confers resistance to all pathotypes of G. rostochiensis including Ro5. In our previous research it was shown the extremely low frequency of the Gro1-4 marker in the Russian cultivar genepool [42,56,57,58,59]. A few Gro1-4-positive cultivars were involved in the present study, however, any association with resistance to Ro5 pathotype was not detected. Similar results were obtained by D. Milczarek with colleagues (2011) for West-European potato cultivars [37]. It is also possible that selected in present study Russian cultivars originated from unknown sources of resistance to pathotype Ro5.
It should be mentioned that the diagnostic value of molecular marker can be dependent on by different scores. In our case, the diagnostic value of molecular marker was calculated for highly resistant genotypes (nine scores according to the EPPO scale). In Indian breeding programs, both highly resistant and moderately resistant genotypes are considered to have a desirable level of resistance [43]. In the case of counting moderately resistant cultivars as resistant genotypes the diagnostic value of the GP179/RsaI marker of the GrpI_QTL may increase significantly (Table 4). In the present study we selected six moderately resistant to Ro5 cultivars and one with a moderate level of resistance to pathotype Pa3 of G. pallida. At the same time, it should be kept in mind that the cultivation of moderately resistant varieties can lead to a rapid loss of resistance due to the selection of more adapted and productive populations of nematodes [85].
Results of the present study indicate that the combination of the marker-resistance alleles of the three loci—Gpa2, Grp1 and GpaVvrn_QTL can be more efficient against the pathotype Pa3 of G. pallida than a single locus. The most effective combination of five resistance-predictive alleles (Gpa2-1, 77R/HaeIII, GP34/TaqI-520–GP21/DraI–HC) improved resistance prediction. This haplotype was found only in two highly resistant cultivars Danaâ and Vympel and it was not detected in 17 cultivars which are susceptible to pathotype Pa3 of G. pallida. Three other Gpa2-1-positive cultivars (Alyj parus, Čaroit, Utro) are susceptible to G. pallida pathotype Pa3, they all are HC-negative, in addition cv. Čaroit lost marker-predictive allele of the Grp1_QTL. On the other side, several susceptible to pale cyst nematode cultivars were HC-positive and at the same time–Gpa2-1-negative. This relationship indicates the influence of epistatic effects between three QTLs (Gpa2, Grp1, GpaVvrn) on resistance to G. pallida. Nevertheless, the presence-predictive-haplotype should be verified on the bigger subsets and in segregating populations.
In conclusion, examples of successful application of molecular breeding for selection of genotypes which are resistant to both PCN species (G. pallida and G. rostochiensis) and to their different pathotypes (except Ro1) are still very limited. For today, selection of cultivars for multiple PCN resistance still needs the further development of more reliable and repeatable molecular markers for QTLs with different effects on resistance which could be applied in different genetic background. Recent progress in SNPs genotyping helped to improve the PCR markers [45] and to increase their diagnostic values. Our future studies will focus on the involvement of resistant cultivars selected in this study into the breeding and on the application of bio-tests and improved DNA markers in large scales of genotypes.

Supplementary Materials

The following are available online at https://www.mdpi.com/article/10.3390/agronomy11122400/s1, Figure S1: Diagnostic bands of markers (indicated by an arrow) for identification of Gpa2 gene, Figure S2: Diagnostic bands (indicated by an arrow) of TG432/RsaI (A) and GP179/RsaI (B) markers for identification of Grp1_QTL, Figure S3: Diagnostic bands of HC marker for identification of GpaVvrn_QTL locus, Figure S4: Diagnostic band of GP21/DraI marker (indicated by the arrows) for identification of Grp1_QTL, Figure S5: Diagnostic bands of markers GP34/TaqI (indicated by the arrows) for identification of Gpa2 gene, Figure S6: Diagnostic bands (indicated by the arrows) of markers GP179/EcoRV for locus GpaVsspl_QTL, Figure S7: Restricted DraI- fragments of PCR-products amplified from potato cultivars’ DNA used primers TG432.

Author Contributions

Conceptualization, T.A.G. and O.S.A.; Methodology, A.V.K., O.Y.A., N.S.K. and N.A.F.; Investigation, T.A.G., O.S.A., A.V.K., O.Y.A. and N.S.K.; Resources, T.A.G.; Writing, T.A.G. and O.S.A.; Project Administration, T.A.G. and O.S.A. All authors have read and agreed to the published version of the manuscript.

Funding

The paper was prepared with assistance provided within the framework of R&D Topic No. 0662-2019-0004, State Registration No. AAAA-A19-119013090158-8, by a grant from the Russian Science Foundation (RSF)16–16-04073 and by the Topic No. 0481-2019-0002.

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Acknowledgments

The authors express their deep gratitude to V. Zheltova and D. Rybakov for technical assistance and to L. Novikova for her kind help with statistical data.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. FAO. Available online: http://www.fao.org/faostat/en/#data/QCL (accessed on 30 September 2021).
  2. Moens, M.; Perry, R.N.; Jones, J.T. Cyst nematodes—Life cycle and economic importance. In Cyst Nematodes; Moens, M., Perry, R.N., Jones, T.J., Eds.; CABI: Wallingford, UK, 2018; pp. 1–26. [Google Scholar] [CrossRef] [Scilit]
  3. EPPO. Globodera Rostochiensis. Distribution; EPPO Global Database. Available online: https://gd.eppo.int/taxon/HETDRO/distribution (accessed on 30 September 2021).
  4. EPPO. Globodera Pallida. Distribution; EPPO Global Database. Available online: https://gd.eppo.int/taxon/HETDPA/distribution (accessed on 30 September 2021).
  5. EPPO. EPPO Global Database. Available online: https://gd.eppo.int (accessed on 30 September 2021).
  6. Turner, S.J.; Evans, K. The origins, global distribution and biology of potato cyst nematodes (Globodera rostochiensis Woll. and Globodera pallida Stone). In Potato Cyst Nematodes, Biology, Distribution and Control, 2nd ed.; Marks, R.J., Brodie, B.B., Eds.; CABI: Wallingford, UK, 1998; pp. 7–26. [Google Scholar]
  7. Turner, S.J.; Subbotin, S.A. Cyst nematodes. In Plant Nematology; Perry, R.N., Moens, M., Eds.; CABI: Wallingford, UK, 2013; pp. 109–143. [Google Scholar] [CrossRef] [Scilit]
  8. Evans, K.; Stone, A.R. A Review of the Distribution and Biology of the Potato Cyst-Nematodes Globodera rostochiensis and G. pallida. Pans 1977, 23, 178–189. [Google Scholar] [CrossRef] [Scilit]
  9. Noling, J.W. Movement and Toxicity of Nematicides in the Plant Root Zone; University of Florida: Gainesville, FL, USA, 2019; Available online: https://edis.ifas.ufl.edu/publication/NG002 (accessed on 30 September 2021).
  10. Jones, R.K. Nematode control and nematicides: Developments since 1982 and future trends. In Nematology in South Africa: A View From the 21st Century; Fourie, H., Spaull, V.W., Jones, R.K., Daneel, M.S., Waele, D.D., Eds.; Springer: New York, NY, USA, 2017; pp. 129–150. [Google Scholar]
  11. CABI. Globodera Pallida (White Potato Cyst Nematode). Invasive Species Compendium. Available online: https://www.cabi.org/isc/datasheet/27033 (accessed on 30 September 2021).
  12. CABI. Globodera rostochiensis (Yellow Potato Cyst Nematode). Invasive Species Compendium. Available online: https://www.cabi.org/isc/datasheet/27034 (accessed on 30 September 2021).
  13. Kort, J.; Ross, H.; Rumpenhorst, H.J.; Stone, A.R. An International Scheme for Identifying and Classifying Pathotypes of Potato Cyst-Nematodes Globodera Rostochiensis and G. Pallida. Nematologica 1977, 23, 333–339. [Google Scholar] [CrossRef] [Scilit]
  14. Nijboer, H.; Parlevliet, J.E. Pathotype-specificity in potato cyst nematodes, a reconsideration. Euphytica 1990, 49, 39–47. [Google Scholar] [CrossRef] [Scilit]
  15. Gartner, U.; Hein, I.; Brown, L.H.; Chen, X.; Mantelin, S.; Sharma, S.K.; Dandurand, L.-M.; Kuhl, J.C.; Jones, J.T.; Bryan, G.J.; et al. Resisting Potato Cyst Nematodes With Resistance. Front. Plant Sci. 2021, 12, 661194. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  16. Afonin, A.N.; Greene, S.L.; Dzyubenko, N.I.; Frolov, A.N. Interactive Agricultural Ecological Atlas of Russia and Neighboring Countries. Economic Plants and their Diseases, Pests and Weeds. 2008. Available online: http://www.agroatlas.ru (accessed on 30 September 2021).
  17. Limantseva, L.; Mironenko, N.; Shuvalov, O.; Antonova, O.; Khiutti, A.; Novikova, L.; Afanasenko, O.; Spooner, D.; Gavrilenko, T. Characterization of resistance to Globodera rostochiensis pathotype Ro1 in cultivated and wild potato species accessions from the Vavilov Institute of Plant Industry. Plant Breed. 2014, 133, 660–665. [Google Scholar] [CrossRef] [Scilit]
  18. Khiutti, A.V.; Antonova, O.Y.; Mironenko, N.V.; Gavrilenko, T.A.; Afanasenko, O.S. Potato Resistance to Quarantine Diseases. Russ. J. Genet. 2017, 7, 833–844. [Google Scholar] [CrossRef] [Scilit]
  19. Federal Service for Veterinary and Phytosanitary Surveillance of Russian Ministry of Agriculture. National Report on the Quarantine Status on the Territory of the Russian Federation in 2018; Ministry of Agriculture: Moscow, Russia, 2019. Available online: https://fsvps.gov.ru/fsvps-docs/ru/usefulinf/files/nd2019.pdf (accessed on 30 September 2021). (In Russian)
  20. Federal Service for Veterinary and Phytosanitary Surveillance of Russian Ministry of Agriculture. National Report on the Quarantine Status on the Territory of the Russian Federation in 2019; Ministry of Agriculture: Moscow, Russia, 2020. Available online: https://fsvps.gov.ru/fsvps-docs/ru/usefulinf/files/nd2020.pdf (accessed on 30 September 2021). (In Russian)
  21. Federal Service for Veterinary and Phytosanitary Surveillance of Russian Ministry of Agriculture. National Report on the Quarantine Status on the Territory of the Russian Federation in 2020; Ministry of Agriculture: Moscow, Russia, 2021. Available online: https://fsvps.gov.ru/fsvps-docs/ru/usefulinf/files/nd2021.pdf (accessed on 30 September 2021). (In Russian)
  22. Gossortommission. State Register for Selection Achievements Admitted for Usage. The Federal State Budgetery Institution “State Commission of the Russian Federation for Selection Achievements Test and Protection”. Available online: https://reestr.gossortrf.ru/ (accessed on 30 September 2021).
  23. Heikkilä, J.; Tiilikkala, K. Globodera rostochiensis (Woll.) Behrens (Tylenchida, Heteroderidae), the only potato cyst nematode species found in Finland. Agric. Food Sci. 1992, 1, 519–525. [Google Scholar] [CrossRef] [Scilit]
  24. Magnusson, C.; Hammeraas, B. Potetcystenematodenes (PCN) biologi, smitteveier og bekjempelse. FAGINFO/NLH-Fagtjeneste 1994, 4, 112–127. [Google Scholar]
  25. Przetakiewicz, A. Distribution of PCN pathotypes in Poland. Plant Breed. Seed Sci. 2019, 79, 3–8. [Google Scholar] [CrossRef] [Scilit]
  26. EPPO. Situation of Globodera Pallida in Finland in 2011; EPPO Reporting Service, John Wiley & Sons, Inc.: New York, NY, USA; Available online: https://gd.eppo.int/reporting/article-1900 (accessed on 30 September 2021).
  27. EPPO. First Report of Globodera Pallida in Estonia; EPPO Reporting Service, John Wiley & Sons, Inc.: New York, NY, USA. Available online: https://gd.eppo.int/reporting/article-6467 (accessed on 30 September 2021).
  28. Holgado, R.; Magnusson, C. Nematodes as a Limiting Factor in Potato Production in Scandinavia. Potato Res. 2012, 55, 269–278. [Google Scholar] [CrossRef] [Scilit]
  29. Pylypenko, L.A.; Uehara, T.; Phillips, M.S.; Sigareva, D.D.; Blok, V.C. Identification of Globodera rostochiensis and G. pallida in the Ukraine by PCR. Eur. J. Plant Pathol. 2005, 111, 39–46. [Google Scholar] [CrossRef] [Scilit]
  30. Karnkowski, W.; Kcazmarek, A.; Dobosz, R.; Wieczorek, P.; Obrepalska-Steplowska, A. Occurrence of the white potato nematode Globodera pallida (Stone, 1973) Behrens, 1975 (Nematoda: Heteroderidae) on the territory of Poland. Prog. Plant Prot. 2012, 51, 1087–1092. [Google Scholar]
  31. Price, J.A.; Coyne, D.; Blok, V.C.; Jones, J.T. Potato cyst nematodes Globodera rostochiensis and G. pallida. Mol. Plant Pathol. 2021, 22, 495–507. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  32. van der Voort, R.J.; Lindeman, W.; Folkertsma, R.; Hutten, R.; Overmars, H.; van der Vossen, E.; Jacobsen, E.; Bakker, J. A QTL for broad-spectrum resistance to cyst nematode species (Globodera spp.) maps to a resistance gene cluster in potato. Theor. Appl. Genet. 1998, 96, 654–661. [Google Scholar] [CrossRef] [Scilit]
  33. Finkers-Tomczak, A.; Danan, S.; van Dijk, T.; Beyene, A.; Bouwman, L.; Overmars, H.; van Eck, H.; Goverse, A.; Bakker, J.; Bakker, E. A high-resolution map of the Grp1 locus on chromosome V of potato harbouring broadspectrum resistance to the cyst nematode species Globodera pallida and Globodera rostochiensis. Theor. Appl. Genet. 2009, 119, 165–173. [Google Scholar] [CrossRef] [Scilit]
  34. Sattarzadeh, A.; Achenbach, U.; Lübeck, J.; Strahwald, J.; Tacke, E.; Hofferbert, H.-R.; Rothsteyn, T.; Gebhardt, C. Single nucleotide polymorphism (SNP) genotyping as basis for developing a PCR based marker highly diagnostic for potato varieties with high resistance to Globodera pallida pathotype Pa2/3. Mol. Breed. 2006, 18, 301–312. [Google Scholar] [CrossRef] [Scilit]
  35. Moloney, C.; Griffin, D.; Jones, P.W.; Bryan, G.J.; McLean, K.; Bradshaw, J.E.; Milbourne, D. Development of diagnostic markers for use in breeding potatoes resistant to Globodera pallida pathotype Pa2/3 using germplasm derived from Solanum tuberosum ssp. andigena CPC 2802. Theor. Appl. Genet. 2010, 120, 679–689. [Google Scholar] [CrossRef] [Scilit]
  36. Galek, R.; Rurek, M.; De Jong, W.S.; Pietkiewicz, G.; Augustyniak, H.; Sawicka-Sienkiewicz, E. Application of DNA markers linked to the potato H1 gene conferring resistance to pathotype Ro1 of Globodera rostochiensis. J. Appl. Genet. 2011, 52, 407–411. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  37. Milczarek, D.; Flis, B.; Przetakiewicz, A. Suitability of molecular markers for selection of potatoes resistant to Globodera spp. Am. J. Pot. Res. 2011, 88, 245–255. [Google Scholar] [CrossRef] [Scilit]
  38. Milczarek, D.; Przetakiewicz, A.; Kamiński, P.; Flis, B. Early selection of potato clones with the H1 resistance gene—the relation of nematode resistance to quality characteristics. Czech J. Genet. Plant Breed. 2014, 50, 278–284. [Google Scholar] [CrossRef] [Scilit]
  39. Asano, K.; Kobayashi, A.; Tsuda, S.; Nishinaka, M.; Tamiya, S. DNA marker-assisted evaluation of potato genotypes for potential resistance to potato cyst nematode pathotypes not yet invading into Japan. Breed. Sci. 2012, 62, 142–150. [Google Scholar] [CrossRef] [Scilit]
  40. Schultz, L.; Cogan, N.O.I.; McLean, K.; Dale, M.F.B.; Bryan, G.J.; Forster, J.W.; Salter, A.T. Evaluation and implementation of a potential diagnostic molecular marker for H1-conferred potato cyst nematode resistance in potato (Solanum tuberosum L.). Plant Breed. 2012, 131, 315–321. [Google Scholar] [CrossRef] [Scilit]
  41. Sharma, R.; Bhardwaj, V.; Dalamu, D.; Kaushik, S.K.; Singh, B.P.; Sharma, S.; Umamaheshwari, R.; Baswaraj, R.; Kumar, V.; Gebhardte, C. Identification of elite potato genotypes possessing multiple disease resistance genes through molecular approaches. Sci. Hortic. 2014, 179, 204–211. [Google Scholar] [CrossRef] [Scilit]
  42. Antonova, O.Y.; Shvachko, N.A.; Novikova, L.Y.; Shuvalov, O.Y.; Kostina, L.I.; Klimenko, N.S.; Shuvalova, A.R.; Gavrilenko, T.A. Genetic diversity of potato varieties bred in Russia and near-abroad countries based on polymorphism of SSR-loci and markers associated with resistance R-genes. Vavilov J. Genet. Breed. 2016, 20, 596–606, (In Russian, with English abstract). [Google Scholar] [CrossRef] [Scilit]
  43. Sudha, R.; Mhatre, P.H.; Lekshmanan, D.K.; Venkatasalam, E.P.; Bairwa, A.; Bhardwaj, V.; Dalamu; Sharma, R. Phenotypic and molecular characterization of potato germplasm for potato cyst nematode resistance. Indian J. Genet. Plant Breed. 2019, 79, 394–403. [Google Scholar] [CrossRef] [Scilit]
  44. Bhardwaj, V.; Soos, S.; Kumar, A.; Vanishree, G.; Sharma, S.; Sundaresha, S.; Raigond, B.; Kumar, R.; Bairwa, A.; Lal, M.; et al. Efficiency and reliability of marker assisted selection for resistance to major biotic stresses in potato. Potato J. 2019, 46, 56–66. [Google Scholar]
  45. Asano, K.; Shimosaka, E.; Yamashita, Y.; Narabu, T.; Aiba, S.; Sakata, I.; Akai, K.; Okamoto, S.; Tamiya, S. Improvement of diagnostic markers for resistance to Globodera pallida and application for selection of resistant germplasms in potato breeding. Breed. Sci. 2021, 71, 354–364. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  46. Bryan, G.J.; McLean, K.; Bradshaw, J.E.; De Jong, W.S.; Phillips, M.; Castelli, L.; Waugh, R. Mapping QTLs for resistance to the cyst nematode Globodera pallida derived from the wild potato species Solanum vernei. Theor. Appl. Genet. 2002, 105, 68–77. [Google Scholar] [CrossRef] [Scilit]
  47. Nunziata, A.; Ruggieri, V.; Greco, N.; Frusciante, L.; Barone, A. Genetic Diversity within Wild Potato Species (Solanum spp.) Revealed by AFLP and SCAR Markers. Am. J. Plant Sci. 2010, 1, 95–103. [Google Scholar] [CrossRef]
  48. Whitworth, J.L.; Novy, R.G.; Zasada, I.A.; Wang, X.; Dandurand, L.-M.; Kuhl, J.C. Resistance of Potato Breeding Clones and Cultivars to Three Species of Potato Cyst Nematode. Plant Dis. 2018, 102, 2120–2128. [Google Scholar] [CrossRef] [Scilit]
  49. Hospital, F. Challenges for effective marker-assisted selection in plants. Genetica 2009, 136, 303–310. [Google Scholar] [CrossRef] [Scilit]
  50. Gebhardt, C. Bridging the gap between genome analysis and precision breeding in potato. Trends Genet. 2013, 29, 248–256. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  51. Platten, J.D.; Cobb, J.N.; Zantua, R.E. Criteria for evaluating molecular markers: Comprehensive quality metrics to improve marker assisted selection. PLoS ONE 2019, 14, e0210529. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  52. Dalamu, V.B.; Umamaheshwari, R.; Sharma, R.; Kaushik, S.; Joseph, T.; Singh, B.; Gebhardt, C. Potato cyst nematode (PCN) resistance: Genes, genotypes and markers—An update. SABRAO J. Breed. Genet. 2012, 44, 202–228. [Google Scholar]
  53. Mori, K.; Mukojima, N.; Nakao, T.; Tamiya, S.; Sakamoto, Y.; Sohbaru, N.; Hayashi, K.; Watanuki, H.; Nara, K.; Yamazaki, K.; et al. Germplasm Release: Saikai 35, a Male and Female Fertile Breeding Line Carrying Solanum Phureja-Derived Cytoplasm and Potato Cyst Nematode Resistance (H1) and Potato Virus Y Resistance (Ry chc) Genes. Am. J. Potato Res. 2012, 89, 63–72. [Google Scholar] [CrossRef] [Scilit]
  54. Sudha, R.; Venkatasalam, E.P.; Bairwa, A.; Bhardwaj, V.; Dalamu; Sharma, R. Identification of potato cyst nematode resistant genotypes using molecular markers. Sci. Hortic. 2016, 198, 21–26. [Google Scholar] [CrossRef] [Scilit]
  55. Biryukova, V.A.; Zhuravlev, A.A.; Abrosimova, S.B.; Kostina, L.I.; Khromova, L.M.; Shmyglya, I.V.; Morozova, N.N.; Kirsanova, S.N. Use of molecular markers of potato golden nematode resistance genes H1 and GRO1. Russ. Agric. Sci. 2008, 34, 365–368. [Google Scholar] [CrossRef] [Scilit]
  56. Klimenko, N.S.; Antonova, O.Y.; Kostina, L.I.; Mamadbokirova, F.T.; Gavrilenko, T.A. Marker-associated selection of Russian potato varieties with using markers of resistance genes to the golden potato cyst nematode (pathotype Ro1). Proc. Appl. Bot. Genet. Breed. 2017, 178, 66–75. (In Russian) [Google Scholar] [CrossRef] [Scilit]
  57. Klimenko, N.S.; Gavrilenko, T.A.; Chukhina, I.G.; Gadzhiev, N.M.; Evdokimova, Z.Z.; Lebedeva, V.A. Nomenclatural standards and genetic passports of potato cultivars bred at the Leningrad Research Institute for Agriculture “Belogorka”. Plant Biotech. Breed. 2020, 3, 18–54. (In Russian) [Google Scholar] [CrossRef] [Scilit]
  58. Rybakov, D.A.; Antonova, O.Y.; Chukhina, I.G.; Fomina, N.A.; Klimenko, N.S.; Zheltova, V.V.; Meleshin, A.A.; Kochieva, E.Z.; Oves, E.V.; Apshev, K.K.; et al. Nomenclatural standards and genetic passports of potato cultivars bred in the A.G. Lorkh All-Russian Potato Research Institute of Potato Farming. Plant Biotech. Breed. 2020, 3, 5–52. (In Russian) [Google Scholar] [CrossRef] [Scilit]
  59. Fomina, N.A.; Antonova, O.Y.; Chukhina, I.G.; Rybakov, D.A.; Safonova, A.D.; Meleshin, A.A.; Gavrilenko, T.A. Nomenclatural standards, voucher specimens and genetic passports of potato cultivars created in the Siberian and Ural breeding centers. Plant Biotech. Breed. 2020, 3, 53–76. (In Russian) [Google Scholar] [CrossRef] [Scilit]
  60. Caromel, B.; Mugniéry, D.; Kerlan, M.-C.; Andrzejewski, S.; Palloix, A.; Ellisseche, D.; Rousselle-Bourgeois, F.; Lefebvre, V. Resistance quantitative trait loci originating from Solanum sparsipilum act independently on the sex ratio of Globodera pallida and together for developing a necrotic reaction. Mol. Plant-Microbe Interact. 2005, 18, 1186–1194. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  61. Klimenko, N.S.; Gavrilenko, T.A.; Kostina, L.I.; Mamadbokirova, F.T.; Antonova, O.Y. Search for resistance sources to Globodera pallida and potato virus X in the collection of potato varieties using molecular markers. Plant Biotech. Breed. 2019, 2, 42–48. (In Russian) [Google Scholar] [CrossRef] [Scilit]
  62. Brickell, C.D.; Alexander, C.; Cubey, J.J.; David, J.C.; Hoffman, M.H.A.; Leslie, A.C.; Malécot, V.; Jin, X. International Code of Nomenclature for Cultivated Plants, 9th ed.; Scripta Horticulturae: Leuven, Belgium, 2016. [Google Scholar]
  63. European and Mediterranean Plant Protection Organization/Organisation Européenne et Méditerranéenne pour la Protection des Plantes/(OEPP/EPPO). Testing of Potato Varieties to Assess Resistance to Globodera rostochiensis and G. pallida; OEPP/EPPO Bulletin; John Wiley & Sons, Inc.: New York, NY, USA, 2006; Volume 36, pp. 419–420. [Google Scholar]
  64. Julius Kühn-Institut Bundesforschungsinstitut für Kulturpflanzen. Bekanntmachung von Kartoffelsorten mit Resistenz gegen Kartoffelkrebs (Synchytrium endobioticum) und Kartoffelzystennematoden (Globodera rostochiensis und Globodera pallida). Bundesministerium der Justiz und für verbraucherschutz. 2014. Available online: https://www.julius-kuehn.de/media/Veroeffentlichungen/Bekanntmachungen/014_BAnz_AT_18.06.2014_B6_Kartoffelkrebs.pdf (accessed on 30 September 2021).
  65. Potato Variety Database. Available online: https://varieties.ahdb.org.uk/ (accessed on 30 September 2021).
  66. SOLANA GmbH. Available online: www.solana.de (accessed on 30 September 2021).
  67. Gavrilenko, T.; Antonova, O.; Shuvalova, A.; Krylova, E.; Alpatyeva, N.; Spooner, D.M.; Novikova, L. Genetic diversity and origin of cultivated potatoes based on plastid microsatellite polymorphism. Genet. Resour. Crop Evol. 2013, 60, 1997–2015. [Google Scholar] [CrossRef] [Scilit]
  68. van der Voort, R.J.; Wolters, P.; Folkertsma, R.; Hutten, R.; van Zandvoort, P.; Vinke, H.; Kanyuka, K.; Bendahmane, A.; Jacobsen, E.; Janssen, R.; et al. Mapping of the cyst nematode resistance locus Gpa2 in potato using a strategy based on comigrating AFLP markers. Theor. Appl. Genet. 1997, 95, 874–880. [Google Scholar] [CrossRef] [Scilit]
  69. Bendahmane, A.; Kanyuka, K.; Baulcombe, D. High-resolution genetical and physical mapping of the Rx gene for extreme resistance to potato virus X in tetraploid potato. Theor. Appl. Genet. 1997, 95, 153–162. [Google Scholar] [CrossRef] [Scilit]
  70. van der Voort, R.J.; Kanyuka, K.; van der Vossen, E.; Bendahmane, A.; Mooijman, P.; Klein-Lankhorst, R.; Stiekema, W.; Baulcombe, D.; Bakker, J. Tight Physical Linkage of the Nematode Resistance Gene Gpa2 and the Virus Resistance Gene Rx on a Single Segment Introgressed from the Wild Species Solanum tuberosum subsp. Andigena CPC 1673 into Cultivated Potato. Mol. Plant Microbe Interact. 1999, 12, 197–206. [Google Scholar] [CrossRef] [Scilit]
  71. Meksem, K.; Leister, D.; Peleman, J.; Zabeau, M.; Salamini, F.; Gebhardt, C. A high-resolution map of the vicinity of the R1 locus on chromosome V of potato based on RFLP and AFLP markers. Mol. Gen. Genet. 1995, 249, 74–81. [Google Scholar] [CrossRef] [Scilit]
  72. van der Voort, R.J.; van der Vossen, E.; Bakker, E.; Overmars, H.; van Zandvoort, P.; Hutten, R.; Klein Lankhorst, R.; Bakker, J. Two additive QTLs conferring broad-spectrum resistance in potato to Globodera pallida are localized on resistance gene clusters. Theor. App. Genet. 2000, 101, 1122–1130. [Google Scholar] [CrossRef] [Scilit]
  73. Dialat Ltd. Available online: http://dialat.ru (accessed on 30 September 2021).
  74. Evrogen. Available online: https://evrogen.ru/ (accessed on 30 September 2021).
  75. SibEnzyme. Available online: www.russia.sibenzyme.com (accessed on 30 September 2021).
  76. Ellenby, C. Resistance to the Potato Root Eelworm, Heterodera rostochiensis Wollenweber. Nature 1952, 170, 1016. [Google Scholar] [CrossRef] [Scilit]
  77. Minnis, S.T.; Haydock, P.P.J.; Ibrahim, S.K.; Grove, I.G.; Evans, K.; Russell, M.D. Potato cyst nematodes in England and Wales—occurrence and distribution. Ann. Appl. Biol. 2002, 140, 187–195. [Google Scholar] [CrossRef] [Scilit]
  78. Camacho, M.J.; de Andrade, E.; Mota, M.; Nobrega, F.; Vicente, C.; Rusinque, L.; Inácio, M.L. Potato Cyst Nematodes: Geographical Distribution, Phylogenetic Relationships and Integrated Pest Management Outcomes in Portugal. Front. Plant Sci. 2020, 11, 606178. [Google Scholar] [CrossRef] [Scilit]
  79. Brodie, B.B. The occurrence of a second pathotype of potato cyst nematodes in New York. J. Nematol. 1995, 27, 493–494. [Google Scholar]
  80. Brodie, B.B. The identification and distribution of a second pathotype of potato cyst nematodes in the United States. Nematropica 1996, 26, 246. [Google Scholar]
  81. Lopez-Pardo, R.; Barandalla, L.; Ritter, E.; de Galarreta, R.J.I. Validation of molecular markers for pathogen resistance in potato. Plant Breed. 2013, 132, 246–251. [Google Scholar] [CrossRef] [Scilit]
  82. Dalton, E.; Griffin, D.; Gallagher, T.F.; de Vetten, N.; Milbourne, D. The effect of pyramiding two potato cyst nematode resistance loci to Globodera pallida Pa2/3 in potato. Mol. Breed. 2013, 31, 921–930. [Google Scholar] [CrossRef] [Scilit]
  83. Rigney, B.; Blok, V.C.; Griffin, D.; Dalton, E.; Milbourne, D. Consistent action of two partially effective loci conferring resistance to Globodera pallida Pa2/3 across multiple nematode field populations. Plant Pathol. 2017, 66, 1031–1040. [Google Scholar] [CrossRef] [Scilit]
  84. Barone, A.; Ritter, E.; Schachtschabel, U.; Debener, T.; Salamini, F.; Gebhardt, C. Localization by restriction fragment length polymorphism mapping in potato of a major dominant gene conferring resistance to the potato cyst nematode Globodera rostochiensis. Mol. Gen. Genet. 1990, 224, 177–182. [Google Scholar] [CrossRef] [Scilit]
  85. Turner, S.J.; Fleming, C.C. Multiple Selection of Potato Cyst Nematode Globodera pallida Virulence on a Range of Potato Species. I. Serial Selection on Solanum-hybrids. Eur. J. Plant Pathol. 2002, 108, 461–467. [Google Scholar] [CrossRef] [Scilit]
Table 1. EPPO scale for accounting the infestation rate of potato cultivars by G. rostochiensis and G. pallida.
Table 1. EPPO scale for accounting the infestation rate of potato cultivars by G. rostochiensis and G. pallida.
Relative Susceptibility
(% of Eggs and Larvae to Susceptible Control)
ScoreResistance
<19Very high
1.1–38High/very high
3.1–57High
5.1–106Moderate/high
10.1–155Moderate
15.1–254Moderate/low
25.1–503Low
50.1–1002Low/very low
>1001Very low
Table 2. Potato cultivars used as controls in PCN resistance evaluation.
Table 2. Potato cultivars used as controls in PCN resistance evaluation.
CultivarRo5Pa3Ro1
AlouetteSR
DamarisRR
EstrellaRR
LabellaSSR
Queen AnneSSR
Red LadySSR
Red ScarlettR
“–” no data.
Table 3. DNA markers associated with genes (QTLs) conferring PCN resistance used in this study.
Table 3. DNA markers associated with genes (QTLs) conferring PCN resistance used in this study.
Gene/QTLChromosomeSource of Introgressed Gene (QTL) 1PathotypeMarkerPrimer SequenceAnnealing
Temperature
References for Primer- and Marker-Developers
Gpa2XIIadgPa2,3Gpa2-1F: TTTAGCACGGAATGTGGGGA60[39]
R: GTTTCCCCATCAAAACTCAC
GP34/TaqIF: CGTTGCTAGGTAAGCATGAAGAAG62[68,69]
R: GTTATCGTTGATTTCTCGTTCCG
77R/HaeIIIF: CTCGAGGGATTGAATCCAAATTAT57[70]
R: GGAAGCAGAATACTCCTGACTACT
GpaVsspl_ QTLVsplPa2,3TG432/DraIF: GGACAGTCATCAGATTGTGG66[60]
R: GTACTCCTGCTTGAGCCATT
GP179/EcoRVF: GGTTTTAGTGATTGTGCTGC55[60,71]
R: AATTTCAGACGAGTAGGCACT
Grp1_QTLVvrn, opl, adg, tubRo5; Pa2,3TG432/RsaIF: GGACAGTCATCAGATTGTGG66[33]
R: GTACTCCTGCTTGAGCCATT
Grp1_QTLVvrn, opl, adg, tbrRo5; Pa2,3GP21/DraIF: GGTTGGTGGCCTATTAGCCA55[32,71]
Gpa5_QTLVvrnPa2,3R: GCTCCAACACGGAAGGTTTTC
Grp1_QTLVvrn, opl, adg, tubRo5; Pa2,3GP179/RsaIF: GGTTTTAGTGATTGTGCTGC55[32,71,72]
Gpa5_QTLVvrnPa2,3R: AATTTCAGACGAGTAGGCACT
Gpa5_QTLVvrnPa2,3SPUD1636F: GTGCGCACAGGGTAAAACC65 → 60[46]
R: ACCTTAGCGGATGAAAGCC
GpaVvrn_QTLVvrnPa2,3HCF: ACACCACCTGTTTGATAAAAAACT65 → 60[34]
R: GCCTTACTTCCCTGCTGAAG
1adg—S. tuberosum ssp. andigena, vrn—S. vernei, spl—S. sparsipilum, opl—S. oplocense, tbr—S. tuberosum ssp. tuberosum.
Table 4. Resistance of potato cultivars to G. rostochiensis pathotype Ro5 and data of molecular marker analysis with three markers of the Grp1_QTL. Resistance group: R—resistant, MR—moderately resistant, S—susceptible. “+”—fragment presents, “−”—fragment absents.
Table 4. Resistance of potato cultivars to G. rostochiensis pathotype Ro5 and data of molecular marker analysis with three markers of the Grp1_QTL. Resistance group: R—resistant, MR—moderately resistant, S—susceptible. “+”—fragment presents, “−”—fragment absents.
CultivarAverage Number of Cysts in 500 cm3 of SoilAverage Number of Eggs and Larvae per 500 cm3 of SoilRelative
Susceptibility
Cultivar Response (1–9 EPPO Scale)Resistance Group for Pathotype Ro5 of Golden NematodeResults of Molecular Screening with MarkersDeclared Resistance Group for Pathotype Ro1 of Golden NematodePresence of the Gro1-4 Marker **
TG432/
RsaI
GP179/
RsaI
GP21/
DraI
Domestic cultivars
1Alyj parus0.00.00.09R++ *
2Antonina9.07683.47.76MR++
3Čaroit16.615,530.115.74SS
4Danaâ0.00.00.09R++S
5Evraziâ0.00.00.09R++R
6Grand7.810,536.010.65MR++R+
7Gusar0.00.00.09R++R
8Holmogorskij0.50.00.09R+++R
9Il’inskij2.11060.61.09R+++S
10Kolobok13.611,772.811.95MR++S
11Krasavčik58.569,024.069.82S+++S
12Krepyš0.00.00.09R+++R
13Liga0.00.00.09R+++R
14Lomonosovskij32.823,557.823.84S+++S
15Lûbava98.959,435.560.12S+++S
16Meteor0.00.00.09R+++R
17Naâda0.00.00.09R++R
18Nakra10.05294.55.36MR+++S
19Nevskij80.898,775.1100.01S+S
20Plamâ50.664,727.865.52S+++R+
21Samba9.010,544.510.65MR+++S+
22Sirenevyj tuman4.0540.20.59R++S
23Tango22.828,137.728.43S++− *
24Utro6.5789.40.79R++S
25Varâg19.919,098.319.34S+++S
26Vympel1.5259.80.29R+++R
Foreign cultivars
27Alouette20.424,383.224.65MR++R
28Red Scarlett0.00.00.09R++R
Controls
29Damaris0.00.00.09R++R+
30Estrella0.00.00.09R+R+
31Labella19.023,524.623.84S+R
32Queen Anne59.077,158.578.12S+R
33Red Lady41.145,225.045.73S+++R
Totally estimated cultivars (N) including: N = 33: 16 R (score 9), 6 MR (score 5–6), 11 S (score 1–4)
No. (%) of highly resistant (score 9) cultivars with the marker13 of 16
(81.3%)
13 of 16
(81.3%)
11 of 16
(68.8%)
No. (%) of highly resistant (score 9) cultivars without the marker3 of 16
(18.7%)
3 of 16
(18.7%)
5 of 16
(31.2%)
No. (%) of susceptible (score 1–4) cultivars with marker9 of 11
(81.8%)
7 of 11
(63.6%)
7 of 11
(63.6%)
No. (%) of susceptible (score 1–4) cultivars without the marker2 of 11
(18.2%)
4 of 11
(36.4%)
4 of 11
(36.4%)
No. of moderately resistant (score 5–6) cultivars with marker3 of 66 of 65 of 6
No. of moderately resistant (score 5–6) cultivars without marker3 of 60 of 61 of 6
* These two cultivars not yet included in the National List, so data of the State bio-testing for resistance to Ro1 are not yet available; ** data about presence of the Gro 1–4 marker were obtained from our previous research [42,56,57,58].
Table 5. Resistance of potato cultivars to G. pallida pathotype Pa3.
Table 5. Resistance of potato cultivars to G. pallida pathotype Pa3.
CultivarsAverage Number of Cysts in 500 cm3 of SoilAverage Number of Eggs and Larvae per 500 cm3 of SoilRelative
Susceptibility
Cultivar Response (1–9 Scale)
Domestic cultivars
1Alyj parus15.521,142.666.02
2Antonina23.524,157.175.42
3Čaroit14.720,856.065.12
4Danaâ0.00.00.09
5Grand7.55060.415.84
6Gusar81.4117,851.5367.91
7Krasavčik7.56370.819.84
8Krepyš52.166,204.5206.71
9Lomonosovskij123.0129,119.7403.11
10Naâda74.259,727.8186.51
11Nevskij27.732,025.0100.01
12Plamâ44.656,282.6175.71
13Samba7.22705.88.46
14Tango131.032,517.1101.51
15Utro24.118,682.558.32
16Vympel0.00.00.09
Foreign cultivar
17Red Scarlett19.016,810.352.42
Controls
18Alouette33.638,369.6119.81
19Red Lady32.340,028.1124.91
Table 6. Molecular marker analysis of potato cultivars with DNA markers associated with QTLs conferring resistance to G. pallida pathotype Pa3. “+”—diagnostic fragments present, “−”—diagnostic fragments absent. Resistance group: R—resistant, MR—moderately resistant, S—susceptible.
Table 6. Molecular marker analysis of potato cultivars with DNA markers associated with QTLs conferring resistance to G. pallida pathotype Pa3. “+”—diagnostic fragments present, “−”—diagnostic fragments absent. Resistance group: R—resistant, MR—moderately resistant, S—susceptible.
CultivarCultivar
Response (1–9 Scale) for Pa3
Resistance GroupQTLs/Markers
Gpa2Grp1_QTLGpaVSspl_QTLGpaVvrn_QTL
Gpa2-177R/
HaeIII
GP34/
TaqI-520 bp
GP34/
TaqI-550 bp
TG432/ RsaIGP21/
DraI
GP179/RsaIGP179/EcoRVHC
1Alyj parus2S+++++++
2Antonina2S+++++*
3Čaroit2S++
4Danaâ9R++++++
5Grand4S+++++
6Gusar1S++++
7Krasavčik4S+++++*
8Krepyš1S++++++
9Lomonosovskij1S+++++++
10Naâda1S++++*
11Nevskij1S++
12Plamâ1S++++++
13Samba6MR+++++
14Tango1S++++
15Utro2S++++
16Vympel9R++++++++*
Controls
17Alouette1S++++
18Red Lady1S+++++
19Red Scarlett2S++++++
Totally estimated cultivars (N) including: N = 19: 2 R (score 9), 1 MR (score 6), 16 S (score 1–4)
No. of resistant (score 9) cultivars with the marker2 of 22 of 22 of 21 of 22 of 22 of 21 of 21 of 2
No. of resistant (score 9) cultivars without the marker0001 of 2001 of 21 of 2
No. of susceptible (score 1–4) cultivars with marker3 of 163 of 1610 of 169 of 1610 of 1611 of 1613 of 1613 of 16
No. (%) of susceptible (score 1–4) cultivars without the marker13 of 16 (81.3%)13 of 16
(81.3%)
6 of 16
(37.5%)
7 of 16
(43.8%)
6 of 16 (37.5%)5 of 16
(31.3%)
3 of 16
(18.8%)
3 of 16
(18.8%)
* unclear to score.
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Share and Cite

MDPI and ACS Style

Gavrilenko, T.A.; Khiutti, A.V.; Klimenko, N.S.; Antonova, O.Y.; Fomina, N.A.; Afanasenko, O.S. Phenotypic and DNA Marker-Assisted Characterization of Russian Potato Cultivars for Resistance to Potato Cyst Nematodes. Agronomy 2021, 11, 2400. https://doi.org/10.3390/agronomy11122400

AMA Style

Gavrilenko TA, Khiutti AV, Klimenko NS, Antonova OY, Fomina NA, Afanasenko OS. Phenotypic and DNA Marker-Assisted Characterization of Russian Potato Cultivars for Resistance to Potato Cyst Nematodes. Agronomy. 2021; 11(12):2400. https://doi.org/10.3390/agronomy11122400

Chicago/Turabian Style

Gavrilenko, Tatjana A., Aleksander V. Khiutti, Natalia S. Klimenko, Olga Y. Antonova, Natalia A. Fomina, and Olga S. Afanasenko. 2021. "Phenotypic and DNA Marker-Assisted Characterization of Russian Potato Cultivars for Resistance to Potato Cyst Nematodes" Agronomy 11, no. 12: 2400. https://doi.org/10.3390/agronomy11122400

APA Style

Gavrilenko, T. A., Khiutti, A. V., Klimenko, N. S., Antonova, O. Y., Fomina, N. A., & Afanasenko, O. S. (2021). Phenotypic and DNA Marker-Assisted Characterization of Russian Potato Cultivars for Resistance to Potato Cyst Nematodes. Agronomy, 11(12), 2400. https://doi.org/10.3390/agronomy11122400

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop