Bacillus velezensis PEA1 Inhibits Fusarium oxysporum Growth and Induces Systemic Resistance to Cucumber Mosaic Virus
Abstract
:1. Introduction
2. Materials and Methods
2.1. Viral Isolation and Molecular Characterization
2.2. Fungal Isolation and Identification
2.3. Bacillus Isolation, Biochemical Characterization, and 16 rRNA Amplification
2.4. Sequencing Analysis and Phylogenetic Construction
2.5. Analysis of Antagonistic Activities of Bacillus Isolate
2.6. Assays of Antiviral Activity
2.7. Plant Total RNA Extraction and cDNA Synthesis
2.8. qRT-PCR Assay and Data Analysis
2.9. GC–MS Fractionation of Bacterial Ethyl Acetate Extract
2.10. Statistical Analysis
3. Results and Discussion
3.1. Identification of Bacterial Strain PEA1, Fungal Strain Kh1, and Viral Strain Kh1
3.2. Inhibitory Effects of PEA1 against F. oxysporum Kh1
3.3. Inhibitory Effects of PEA1-CF against CMV
3.4. Effect of PEA1-CF on the Transcriptional Levels of Defense-Related Genes
3.5. Identification of Bioactive Metabolites of PEA1-CF
4. Conclusions
Author Contributions
Funding
Conflicts of Interest
References
- Abdelkhalek, A.; Hafez, E. Plant Viral Diseases in Egypt and Their Control. In Cottage Industry of Biocontrol Agents and Their Applications; Springer: Berlin, Germany, 2020; pp. 403–421. [Google Scholar]
- Nicaise, V. Crop immunity against viruses: Outcomes and future challenges. Front. Plant Sci. 2014, 5, 660. [Google Scholar] [CrossRef]
- Hančinský, R.; Mihálik, D.; Mrkvová, M.; Candresse, T.; Glasa, M. Plant Viruses Infecting Solanaceae Family Members in the Cultivated and Wild Environments: A Review. Plants 2020, 9, 667. [Google Scholar]
- Lamichhane, J.R.; Dürr, C.; Schwanck, A.A.; Robin, M.-H.; Sarthou, J.-P.; Cellier, V.; Messéan, A.; Aubertot, J.-N. Integrated management of damping-off diseases. A review. Agron. Sustain. Dev. 2017, 37, 10. [Google Scholar] [CrossRef]
- Saremi, H.; Okhovvat, S.M.; Ashrafi, S.J. Fusarium diseases as the main soil borne fungal pathogen on plants and their control management with soil solarization in Iran. Afr. J. Biotechnol. 2011, 10, 18391–18398. [Google Scholar] [CrossRef]
- Da Silva, J.C.; Bettiol, W. Potential of non-pathogenic Fusarium oxysporum isolates for control of Fusarium wilt of tomato. Fitopatol. Bras. 2005, 30, 409–412. [Google Scholar] [CrossRef] [Green Version]
- Scholthof, K.G.; Adkins, S.; Czosnek, H.; Palukaitis, P.; Jacquot, E.; Hohn, T.; Hohn, B.; Saunders, K.; Candresse, T.; Ahlquist, P. Top 10 plant viruses in molecular plant pathology. Mol. Plant Pathol. 2011, 12, 938–954. [Google Scholar] [CrossRef] [PubMed]
- Mochizuki, T.; Ohki, S.T. Cucumber mosaic virus: Viral genes as virulence determinants. Mol. Plant Pathol. 2012, 13, 217–225. [Google Scholar] [CrossRef] [PubMed]
- Murphy, J.F.; Reddy, M.S.; Ryu, C.-M.; Kloepper, J.W.; Li, R. Rhizobacteria-mediated growth promotion of tomato leads to protection against Cucumber mosaic virus. Phytopathology 2003, 93, 1301–1307. [Google Scholar] [CrossRef] [Green Version]
- Gray, E.J.; Smith, D.L. Intracellular and extracellular PGPR: Commonalities and distinctions in the plant–bacterium signaling processes. Soil Biol. Biochem. 2005, 37, 395–412. [Google Scholar] [CrossRef]
- Kandan, A.; Ramiah, M.; Vasanthi, V.J.; Radjacommare, R.; Nandakumar, R.; Ramanathan, A.; Samiyappan, R. Use of Pseudomonas fluorescens-based formulations for management of tomato spotted wilt virus (TSWV) and enhanced yield in tomato. Biocontrol Sci. Technol. 2005, 15, 553–569. [Google Scholar] [CrossRef]
- Ahmad, A.-G.M.; Attia, A.-Z.G.; Mohamed, M.S.; Elsayed, H.E. Fermentation, formulation and evaluation of PGPR Bacillus subtilis isolate as a bioagent for reducing occurrence of peanut soil-borne diseases. J. Integr. Agric. 2019, 18, 2080–2092. [Google Scholar] [CrossRef]
- Fira, D.; Dimkić, I.; Berić, T.; Lozo, J.; Stanković, S. Biological control of plant pathogens by Bacillus species. J. Biotechnol. 2018, 285, 44–55. [Google Scholar] [CrossRef] [PubMed]
- Stein, T. Bacillus subtilis antibiotics: Structures, syntheses and specific functions. Mol. Microbiol. 2005, 56, 845–857. [Google Scholar] [CrossRef] [PubMed]
- Sansinenea, E.; Ortiz, A. Secondary metabolites of soil Bacillus spp. Biotechnol. Lett. 2011, 33, 1523–1538. [Google Scholar] [CrossRef] [PubMed]
- Shoman, S.A.; Abd-Allah, N.A.; El-Baz, A.F. Induction of resistance to Tobacco necrosis virus in bean plants by certain microbial isolates. Egypt. J. Biol. 2003, 5, 10–18. [Google Scholar]
- Zhong, Y.; Peng, J.; Chen, Z.; Xie, H.; Luo, D.; Dai, J.; Yan, F.; Wang, J.; Dong, H.; Chen, S. Dry mycelium of Penicillium chrysogenum activates defense responses and restricts the spread of Tobacco Mosaic Virus in tobacco. Physiol. Mol. Plant Pathol. 2015, 92, 28–37. [Google Scholar] [CrossRef]
- Rahman, A.; Uddin, W.; Wenner, N.G. Induced systemic resistance responses in perennial ryegrass against Magnaporthe oryzae elicited by semi-purified surfactin lipopeptides and live cells of Bacillus amyloliquefaciens. Mol. Plant Pathol. 2015, 16, 546–558. [Google Scholar] [CrossRef]
- Murphy, J.F.; Zehnder, G.W.; Schuster, D.J.; Sikora, E.J.; Polston, J.E.; Kloepper, J.W. Plant growth-promoting rhizobacterial mediated protection in tomato against Tomato mottle virus. Plant Dis. 2000, 84, 779–784. [Google Scholar] [CrossRef] [Green Version]
- El-Borollosy, A.M.; Oraby, M.M. Induced systemic resistance against Cucumber mosaic cucumovirus and promotion of cucumber growth by some plant growth-promoting rhizobacteria. Ann. Agric. Sci. 2012, 57, 91–97. [Google Scholar] [CrossRef] [Green Version]
- Park, K.; Paul, D.; Ryu, K.R.; Kim, E.Y.; Kim, Y.K. Bacillus vallismortis strain EXTN-1 mediated systemic resistance against potato virus Y and X in the field. Plant Pathol. J. 2006, 22, 360. [Google Scholar] [CrossRef] [Green Version]
- Zehnder, G.W.; Yao, C.; Murphy, J.F.; Sikora, E.R.; Kloepper, J.W. Induction of resistance in tomato against cucumber mosaic cucumovirus by plant growth-promoting rhizobacteria. Biocontrol 2000, 45, 127–137. [Google Scholar] [CrossRef]
- Wang, S.; Wu, H.; Qiao, J.; Ma, L.; Liu, J.; Xia, Y.; Gao, X. Molecular mechanism of plant growth promotion and induced systemic resistance to tobacco mosaic virus by Bacillus spp. J. Microbiol. Biotechnol. 2009, 19, 1250–1258. [Google Scholar] [CrossRef] [PubMed]
- Wang, C.; Zhao, D.; Qi, G.; Mao, Z.; Hu, X.; Du, B.; Liu, K.; Ding, Y. Effects of Bacillus velezensis FKM10 for Promoting the Growth of Malus hupehensis Rehd. and Inhibiting Fusarium verticillioides. Front. Microbiol. 2020, 10, 2889. [Google Scholar] [CrossRef] [PubMed]
- Ruiz-Garcia, C.; Bejar, V.; Martinez-Checa, F.; Llamas, I.; Quesada, E. Bacillus velezensis sp. nov., a surfactant-producing bacterium isolated from the river Velez in Malaga, southern Spain. Int. J. Syst. Evol. Microbiol. 2005, 55, 191–195. [Google Scholar] [CrossRef] [Green Version]
- Chowdhury, S.P.; Dietel, K.; Rändler, M.; Schmid, M.; Junge, H.; Borriss, R.; Hartmann, A.; Grosch, R. Effects of Bacillus amyloliquefaciens FZB42 on lettuce growth and health under pathogen pressure and its impact on the rhizosphere bacterial community. PLoS ONE 2013, 8, e68818. [Google Scholar] [CrossRef] [Green Version]
- Xu, T.; Zhu, T.; Li, S. β-1, 3-1, 4-glucanase gene from Bacillus velezensis ZJ20 exerts antifungal effect on plant pathogenic fungi. World J. Microbiol. Biotechnol. 2016, 32, 26. [Google Scholar] [CrossRef]
- Cao, Y.; Pi, H.; Chandrangsu, P.; Li, Y.; Wang, Y.; Zhou, H.; Xiong, H.; Helmann, J.D.; Cai, Y. Antagonism of two plant-growth promoting Bacillus velezensis isolates against Ralstonia solanacearum and Fusarium oxysporum. Sci. Rep. 2018, 8, 1–14. [Google Scholar] [CrossRef]
- Chen, L.; Shi, H.; Heng, J.; Wang, D.; Bian, K. Antimicrobial, plant growth-promoting and genomic properties of the peanut endophyte Bacillus velezensis LDO2. Microbiol. Res. 2019, 218, 41–48. [Google Scholar] [CrossRef]
- Clark, M.F.; Adams, A.N. Characteristics of the microplate method of enzyme linked immunosorbent assay for the detection of plant viruses. J. Gen. Virol. 1977, 34, 475–483. [Google Scholar] [CrossRef]
- Hafez, E.E.; El-Morsi, A.A.; El-Shahaby, O.A.; Abdelkhalek, A.A. Occurrence of iris yellow spot virus from onion crops in Egypt. VirusDisease 2014, 25, 455–459. [Google Scholar] [CrossRef] [Green Version]
- Booth, C. The Genus Fusarium; International Mycological Institute: Kew Surrey, UK, 1971; p. 237. [Google Scholar]
- Leslie, J.F.; Summerell, B.A. The Fusarium Laboratory Manual; John Wiley & Sons: Hoboken, NJ, USA, 2008; ISBN 0470276460. [Google Scholar]
- Geiser, D.M.; del Mar Jiménez-Gasco, M.; Kang, S.; Makalowska, I.; Veeraraghavan, N.; Ward, T.J.; Zhang, N.; Kuldau, G.A.; O’donnell, K. FUSARIUM-ID v. 1.0: A DNA sequence database for identifying Fusarium. Eur. J. Plant Pathol. 2004, 110, 473–479. [Google Scholar] [CrossRef]
- Kadyan, S.; Panghal, M.; Singh, K.; Yadav, J.P. Development of a PCR based marker system for easy identification and classification of aerobic endospore forming bacilli. Springerplus 2013, 2, 596. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kubo, S.; Ikeda, T.; Imaizumi, S.; Takanami, Y.; Mikami, Y. A potent plant virus inhibitor found in Mirabilis jalapa L. Jpn. J. Phytopathol. 1990, 56, 481–487. [Google Scholar] [CrossRef]
- Abdelkhalek, A.; Al-Askar, A.A. Green Synthesized ZnO Nanoparticles Mediated by Mentha Spicata Extract Induce Plant Systemic Resistance against Tobacco Mosaic Virus. Appl. Sci. 2020, 10, 5054. [Google Scholar] [CrossRef]
- Abdelkhalek, A.; Ismail, I.A.; Dessoky, E.S.; El-Hallous, E.I.; Hafez, E. A tomato kinesin-like protein is associated with Tobacco mosaic virus infection. Biotechnol. Biotechnol. Equip. 2019, 33, 1424–1433. [Google Scholar] [CrossRef] [Green Version]
- Abdelkhalek, A. Expression of tomato pathogenesis related genes in response to Tobacco mosaic virus. JAPS J. Anim. Plant Sci. 2019, 29, 1596–1602. [Google Scholar]
- Abdelkhalek, A.; Qari, S.H.; Hafez, E. Iris yellow spot virus–induced chloroplast malformation results in male sterility. J. Biosci. 2019, 44, 142. [Google Scholar] [CrossRef]
- Behiry, S.I.; Ashmawy, N.A.; Abdelkhalek, A.A.; Younes, H.A.; Khaled, A.E.; Hafez, E.E. Compatible- and incompatible-type interactions related to defense genes in potato elucidation by Pectobacterium carotovorum. J. Plant Dis. Prot. 2018, 125, 197–204. [Google Scholar] [CrossRef]
- Abdelkhalek, A.; Al-Askar, A.A.; Hafez, E. Differential induction and suppression of the potato innate immune system in response to Alfalfa mosaic virus infection. Physiol. Mol. Plant Pathol. 2020, 110, 101485. [Google Scholar] [CrossRef]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2− ΔΔCT method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef]
- Ahmed, A.A. Production of antimicrobial agent by Streptomyces violachromogenes. Saudi J. Biol. Sci. 2007, 14, 7–16. [Google Scholar]
- Jaffuel, G.; Imperiali, N.; Shelby, K.; Campos-Herrera, R.; Geisert, R.; Maurhofer, M.; Loper, J.; Keel, C.; Turlings, T.C.J.; Hibbard, B.E. Protecting maize from rootworm damage with the combined application of arbuscular mycorrhizal fungi, Pseudomonas bacteria and Entomopathogenic nematodes. Sci. Rep. 2019, 9, 1–12. [Google Scholar] [CrossRef] [PubMed]
- Pal, K.K.; Tilak, K.; Saxena, A.K.; Dey, R.; Singh, C.S. Antifungal characteristics of a fluorescent Pseudomonas strain involved in the biological control of Rhizoctonia solani. Microbiol. Res. 2000, 155, 233–242. [Google Scholar] [CrossRef]
- Ongena, M.; Jacques, P. Bacillus lipopeptides: Versatile weapons for plant disease biocontrol. Trends Microbiol. 2008, 16, 115–125. [Google Scholar] [CrossRef] [PubMed]
- Nguyen, P.-A.; Strub, C.; Fontana, A.; Schorr-Galindo, S. Crop molds and mycotoxins: Alternative management using biocontrol. Biol. Control 2017, 104, 10–27. [Google Scholar] [CrossRef]
- Guo, Q.; Li, Y.; Lou, Y.; Shi, M.; Jiang, Y.; Zhou, J.; Sun, Y.; Xue, Q.; Lai, H. Bacillus amyloliquefaciens Ba13 induces plant systemic resistance and improves rhizosphere microecology against tomato yellow leaf curl virus disease. Appl. Soil Ecol. 2019, 137, 154–166. [Google Scholar] [CrossRef]
- Rabbee, M.F.; Ali, M.; Choi, J.; Hwang, B.S.; Jeong, S.C.; Baek, K. Bacillus velezensis: A valuable member of bioactive molecules within plant microbiomes. Molecules 2019, 24, 1046. [Google Scholar] [CrossRef] [Green Version]
- Jiang, C.-H.; Liao, M.-J.; Wang, H.-K.; Zheng, M.-Z.; Xu, J.-J.; Guo, J.-H. Bacillus velezensis, a potential and efficient biocontrol agent in control of pepper gray mold caused by Botrytis cinerea. Biol. Control 2018, 126, 147–157. [Google Scholar] [CrossRef]
- Gordon, T.R.; Martyn, R.D. The evolutionary biology of Fusarium oxysporum. Annu. Rev. Phytopathol. 1997, 35, 111–128. [Google Scholar] [CrossRef] [Green Version]
- Chittem, K.; Mathew, F.M.; Gregoire, M.; Lamppa, R.S.; Chang, Y.W.; Markell, S.G.; Bradley, C.A.; Barasubiye, T.; Goswami, R.S. Identification and characterization of Fusarium spp. associated with root rots of field pea in North Dakota. Eur. J. Plant Pathol. 2015, 143, 641–649. [Google Scholar] [CrossRef]
- Hwang, S.F.; Chang, K.F. Incidence and severity of root rot disease complex of field pea in northeastern Alberta in 1988. Can. Plant Dis. Surv. 1989, 69, 139–141. [Google Scholar]
- Persson, L.; Bødker, L.; Larsson-Wikström, M. Prevalence and pathogenicity of foot and root rot pathogens of pea in Southern Scandinavia. Plant Dis. 1997, 81, 171–174. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Skovgaard, K.; Bødker, L.; Rosendahl, S. Population structure and pathogenicity of members of the Fusarium oxysporum complex isolated from soil and root necrosis of pea (Pisum sativum L.). FEMS Microbiol. Ecol. 2002, 42, 367–374. [Google Scholar] [CrossRef] [PubMed]
- Chen, X.H.; Koumoutsi, A.; Scholz, R.; Eisenreich, A.; Schneider, K.; Heinemeyer, I.; Morgenstern, B.; Voss, B.; Hess, W.R.; Reva, O. Comparative analysis of the complete genome sequence of the plant growth–promoting bacterium Bacillus amyloliquefaciens FZB42. Nat. Biotechnol. 2007, 25, 1007–1014. [Google Scholar] [CrossRef] [Green Version]
- Meng, Q.; Jiang, H.; Hao, J.J. Effects of Bacillus velezensis strain BAC03 in promoting plant growth. Biol. Control 2016, 98, 18–26. [Google Scholar] [CrossRef]
- Kim, S.Y.; Song, H.; Sang, M.K.; Weon, H.-Y.; Song, J. The complete genome sequence of Bacillus velezensis strain GH1-13 reveals agriculturally beneficial properties and a unique plasmid. J. Biotechnol. 2017, 259, 221–227. [Google Scholar] [CrossRef]
- Adeniji, A.A.; Loots, D.T.; Babalola, O.O. Bacillus velezensis: Phylogeny, useful applications, and avenues for exploitation. Appl. Microbiol. Biotechnol. 2019, 103, 3669–3682. [Google Scholar] [CrossRef]
- Chowdhury, S.P.; Hartmann, A.; Gao, X.; Borriss, R. Biocontrol mechanism by root-associated Bacillus amyloliquefaciens FZB42–a review. Front. Microbiol. 2015, 6, 780. [Google Scholar] [CrossRef] [Green Version]
- Kröber, M.; Wibberg, D.; Grosch, R.; Eikmeyer, F.; Verwaaijen, B.; Chowdhury, S.P.; Hartmann, A.; Pühler, A.; Schlüter, A. Effect of the strain Bacillus amyloliquefaciens FZB42 on the microbial community in the rhizosphere of lettuce under field conditions analyzed by whole metagenome sequencing. Front. Microbiol. 2014, 5, 252. [Google Scholar]
- Chen, L.; Heng, J.; Qin, S.; Bian, K. A comprehensive understanding of the biocontrol potential of Bacillus velezensis LM2303 against Fusarium head blight. PLoS ONE 2018, 13, e0198560. [Google Scholar] [CrossRef] [Green Version]
- Lee, G.H.; Ryu, C.-M. Spraying of leaf-colonizing Bacillus amyloliquefaciens protects pepper from Cucumber mosaic virus. Plant Dis. 2016, 100, 2099–2105. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Pieterse, C.M.J.; Zamioudis, C.; Berendsen, R.L.; Weller, D.M.; Van Wees, S.C.M.; Bakker, P.A.H.M. Induced systemic resistance by beneficial microbes. Annu. Rev. Phytopathol. 2014, 52, 347–375. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Van Loon, L.C.; Rep, M.; Pieterse, C.M.J. Significance of inducible defense-related proteins in infected plants. Annu. Rev. Phytopathol. 2006, 44, 135–162. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Shoresh, M.; Yedidia, I.; Chet, I. Involvement of jasmonic acid/ethylene signaling pathway in the systemic resistance induced in cucumber by Trichoderma asperellum T203. Phytopathology 2005, 95, 76–84. [Google Scholar] [CrossRef] [Green Version]
- Alazem, M.; Lin, N. Roles of plant hormones in the regulation of host–virus interactions. Mol. Plant Pathol. 2015, 16, 529–540. [Google Scholar] [CrossRef]
- Shang, J.; Xi, D.-H.; Xu, F.; Wang, S.-D.; Cao, S.; Xu, M.-Y.; Zhao, P.-P.; Wang, J.-H.; Jia, S.-D.; Zhang, Z.-W. A broad-spectrum, efficient and nontransgenic approach to control plant viruses by application of salicylic acid and jasmonic acid. Planta 2011, 233, 299–308. [Google Scholar] [CrossRef]
- Mierziak, J.; Kostyn, K.; Kulma, A. Flavonoids as important molecules of plant interactions with the environment. Molecules 2014, 19, 16240–16265. [Google Scholar] [CrossRef]
- Akyol, H.; Riciputi, Y.; Capanoglu, E.; Caboni, M.; Verardo, V. Phenolic compounds in the potato and its byproducts: An overview. Int. J. Mol. Sci. 2016, 17, 835. [Google Scholar] [CrossRef]
- Abdelkhalek, A.; Salem, M.Z.M.; Ali, H.M.; Kordy, A.M.; Salem, A.Z.M.; Behiry, S.I. Antiviral, antifungal, and insecticidal activities of Eucalyptus bark extract: HPLC analysis of polyphenolic compounds. Microb. Pathog. 2020, 147, 104383. [Google Scholar] [CrossRef]
- André, C.M.; Schafleitner, R.; Legay, S.; Lefèvre, I.; Aliaga, C.A.A.; Nomberto, G.; Hoffmann, L.; Hausman, J.-F.; Larondelle, Y.; Evers, D. Gene expression changes related to the production of phenolic compounds in potato tubers grown under drought stress. Phytochemistry 2009, 70, 1107–1116. [Google Scholar] [CrossRef]
- Huang, J.; Gu, M.; Lai, Z.; Fan, B.; Shi, K.; Zhou, Y.-H.; Yu, J.-Q.; Chen, Z. Functional analysis of the Arabidopsis PAL gene family in plant growth, development, and response to environmental stress. Plant Physiol. 2010, 153, 1526–1538. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Su, H.; Song, S.; Yan, X.; Fang, L.; Zeng, B.; Zhu, Y. Endogenous salicylic acid shows different correlation with baicalin and baicalein in the medicinal plant Scutellaria baicalensis Georgi subjected to stress and exogenous salicylic acid. PLoS ONE 2018, 13, e0192114. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Abdelkhalek, A.; Dessoky, E.S.; Hafez, E. Polyphenolic genes expression pattern and their role in viral resistance in tomato plant infected with Tobacco mosaic virus. Biosci. Res. 2018, 15, 3349–3356. [Google Scholar]
- Niggeweg, R.; Michael, A.J.; Martin, C. Engineering plants with increased levels of the antioxidant chlorogenic acid. Nat. Biotechnol. 2004, 22, 746. [Google Scholar] [CrossRef] [PubMed]
- Tsao, R.; Marvin, C.H.; Broadbent, A.B.; Friesen, M.; Allen, W.R.; Mcgarvey, B.D. Evidence for an isobutylamide associated with host-plant resistance to western flower thrips, Frankliniella occidentalis, in chrysanthemum. J. Chem. Ecol. 2005, 31, 103–110. [Google Scholar] [CrossRef] [PubMed]
- Leiss, K.A.; Maltese, F.; Choi, Y.H.; Verpoorte, R.; Klinkhamer, P.G.L. Identification of chlorogenic acid as a resistance factor for thrips in chrysanthemum. Plant Physiol. 2009, 150, 1567–1575. [Google Scholar] [CrossRef] [Green Version]
- Marais, J.P.J.; Deavours, B.; Dixon, R.A.; Ferreira, D. The stereochemistry of flavonoids. In The Science of Flavonoids; Springer: Berlin, Germany, 2006; pp. 1–46. [Google Scholar]
- Kang, J.-H.; McRoberts, J.; Shi, F.; Moreno, J.E.; Jones, A.D.; Howe, G.A. The flavonoid biosynthetic enzyme chalcone isomerase modulates terpenoid production in glandular trichomes of tomato. Plant Physiol. 2014, 164, 1161–1174. [Google Scholar] [CrossRef] [Green Version]
- Hoegen, E.; Strömberg, A.; Pihlgren, U.; Kombrink, E. Primary structure and tissue-specific expression of the pathogenesis-related protein PR-1b in potato. Mol. Plant Pathol. 2002, 3, 329–345. [Google Scholar] [CrossRef]
- Pellegrini, L.; Rohfritsch, O.; Fritig, B.; Legrand, M. Phenylalanine ammonia-lyase in tobacco (molecular cloning and gene expression during the hypersensitive reaction to tobacco mosaic virus and the response to a fungal elicitor). Plant Physiol. 1994, 106, 877–886. [Google Scholar] [CrossRef] [Green Version]
- Mauch-Mani, B.; Slusarenko, A.J. Production of salicylic acid precursors is a major function of phenylalanine ammonia-lyase in the resistance of Arabidopsis to Peronospora parasitica. Plant Cell 1996, 8, 203–212. [Google Scholar] [CrossRef]
- Dempsey, D.A.; Shah, J.; Klessig, D.F. Salicylic acid and disease resistance in plants. CRC Crit. Rev. Plant Sci. 1999, 18, 547–575. [Google Scholar] [CrossRef]
- Nawrath, C.; Métraux, J.-P. Salicylic acid induction–deficient mutants of Arabidopsis express PR-2 and PR-5 and accumulate high levels of camalexin after pathogen inoculation. Plant Cell 1999, 11, 1393–1404. [Google Scholar] [PubMed] [Green Version]
- Apel, K.; Hirt, H. Reactive oxygen species: Metabolism, oxidative stress, and signal transduction. Annu. Rev. Plant Biol. 2004, 55, 373–399. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Bindschedler, L.V.; Dewdney, J.; Blee, K.A.; Stone, J.M.; Asai, T.; Plotnikov, J.; Denoux, C.; Hayes, T.; Gerrish, C.; Davies, D.R. Peroxidase-dependent apoplastic oxidative burst in Arabidopsis required for pathogen resistance. Plant J. 2006, 47, 851–863. [Google Scholar] [CrossRef] [Green Version]
- Chamnongpol, S.; Willekens, H.; Moeder, W.; Langebartels, C.; Sandermann, H.; Van Montagu, M.; Inzé, D.; Van Camp, W. Defense activation and enhanced pathogen tolerance induced by H2O2 in transgenic tobacco. Proc. Natl. Acad. Sci. USA 1998, 95, 5818–5823. [Google Scholar] [CrossRef] [Green Version]
- Wu, G.; Shortt, B.J.; Lawrence, E.B.; Leon, J.; Fitzsimmons, K.C.; Levine, E.B.; Raskin, I.; Shah, D.M. Activation of host defense mechanisms by elevated production of H2O2 in transgenic plants. Plant Physiol. 1997, 115, 427–435. [Google Scholar] [CrossRef] [Green Version]
- Han, Y.; Luo, Y.; Qin, S.; Xi, L.; Wan, B.; Du, L. Induction of systemic resistance against tobacco mosaic virus by Ningnanmycin in tobacco. Pestic. Biochem. Physiol. 2014, 111, 14–18. [Google Scholar] [CrossRef]
- Venkatesan, S.; Radjacommare, R.; Nakkeeran, S.; Chandrasekaran, A. Effect of biocontrol agent, plant extracts and safe chemicals in suppression of mungbean yellow mosaic virus (MYMV) in black gram (Vigna mungo). Arch. Phytopathol. Plant Prot. 2010, 43, 59–72. [Google Scholar] [CrossRef]
- Li, Z.; Shi, J.; Hu, D.; Song, B. A polysaccharide found in Dendrobium nobile Lindl stimulates calcium signaling pathway and enhances tobacco defense against TMV. Int. J. Biol. Macromol. 2019, 137, 1286–1297. [Google Scholar] [CrossRef]
- Pollak, F.C.; Berger, R.G. Geosmin and Related Volatiles in Bioreactor-Cultured Streptomyces citreus CBS 109.60. Appl. Environ. Microbiol. 1996, 62, 1295–1299. [Google Scholar] [CrossRef] [Green Version]
- Sudha, S.; Masilamani, S.M. Characterization of cytotoxic compound from marine sediment derived actinomycete Streptomyces avidinii strain SU4. Asian Pac. J. Trop. Biomed. 2012, 2, 770–773. [Google Scholar] [CrossRef] [Green Version]
- Jog, R.; Pandya, M.; Nareshkumar, G.; Rajkumar, S. Mechanism of phosphate solubilization and antifungal activity of Streptomyces spp. isolated from wheat roots and rhizosphere and their application in improving plant growth. Microbiology 2014, 160, 778–788. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Bhardwaj, V.; Gumber, D.; Abbot, V.; Dhiman, S.; Sharma, P. Pyrrole: A resourceful small molecule in key medicinal hetero-aromatics. RSC Adv. 2015, 5, 15233–15266. [Google Scholar] [CrossRef]
- Kumari, N.; Menghani, E.; Mithal, R. GCMS analysis of compounds extracted from actinomycetes AIA6 isolates and study of its antimicrobial efficacy. Indian J. Chem. Technol. 2019, 26, 362–370. [Google Scholar]
- Jimtha, J.C.; Jishma, P.; Arathy, G.B.; Anisha, C.; Radhakrishnan, E.K. Identification of plant growth promoting Rhizosphere Bacillus sp. WG4 antagonistic to Pythium myriotylum and its enhanced antifungal effect in association with Trichoderma. J. Soil Sci. Plant Nutr. 2016, 16, 578–590. [Google Scholar] [CrossRef]
- Ser, H.-L.; Palanisamy, U.D.; Yin, W.-F.; Abd Malek, S.N.; Chan, K.-G.; Goh, B.-H.; Lee, L.-H. Presence of antioxidative agent, Pyrrolo [1, 2-a] pyrazine-1, 4-dione, hexahydro-in newly isolated Streptomyces mangrovisoli sp. nov. Front. Microbiol. 2015, 6, 854. [Google Scholar] [CrossRef] [Green Version]
- Sanjenbam, P.; Gopal, J.V.; Kannabiran, K. Isolation and identification of anticandidal compound from Streptomyces sp. VITPK9. Appl. Biochem. Microbiol. 2014, 50, 492–499. [Google Scholar] [CrossRef]
- Li, Z.; Geng, M.; Yang, H. Algicidal activity of Bacillus sp. Lzh-5 and its algicidal compounds against Microcystis aeruginosa. Appl. Microbiol. Biotechnol. 2015, 99, 981–990. [Google Scholar] [CrossRef]
- Wurz, R.P.; Charette, A.B. Doubly activated cyclopropanes as synthetic precursors for the preparation of 4-nitro-and 4-cyano-dihydropyrroles and pyrroles. Org. Lett. 2005, 7, 2313–2316. [Google Scholar] [CrossRef]
- Piliego, C.; Holcombe, T.W.; Douglas, J.D.; Woo, C.H.; Beaujuge, P.M.; Fréchet, J.M.J. Synthetic control of structural order in N-alkylthieno [3, 4-c] pyrrole-4, 6-dione-based polymers for efficient solar cells. J. Am. Chem. Soc. 2010, 132, 7595–7597. [Google Scholar] [CrossRef]
- Pooja, S.; Aditi, T.; Naine, S.J.; Devi, C.S. Bioactive compounds from marine Streptomyces sp. VITPSA as therapeutics. Front. Biol. 2017, 12, 280–289. [Google Scholar] [CrossRef]
Primer Name | Abbreviation | Direction | Sequence (5′‒3′) |
---|---|---|---|
Phenylalanine ammonia-lyase | PAL | Forward | GTTATGCTCTTAGAACGTCGCCC |
Reverse | CCGTGTAATGCCTTGTTTCTTGA | ||
Chalcone synthase | CHS | Forward | CACCGTGGAGGAGTATCGTAAGGC |
Reverse | TGATCAACACAGTTGGAAGGCG | ||
Hydroxycinnamoyl Co A quinate hydroxycinnamoyl transferase | HQT | Forward | CCCAATGGCTGGAAGATTAGCTA |
Reverse | CATGAATCACTTTCAGCCTCAACAA | ||
Pathogenesis-related protein 1 | PR-1 | Forward | GTCCATACTAATTGAAACGACC |
Reverse | CCACTTCAGAGGATTACATATA | ||
Peroxidase | POD | Forward | TGGAGGTCCAACATGGCAAGTTCT |
Reverse | TGCCACATCTTGCCCTTCCAAATG | ||
Beta-actin | β-actin | Forward | GGGTTTGCTGGAGATGATGCT |
Reverse | GCTTCGTCACCAACATATGCAT | ||
Cucumber mosaic virus-movement protein | CMV-MP | Forward | ATGGCTTTCCAAGGTACCATG |
Reverse | TCTGTTGAAAGGCAGTACTAG | ||
Cucumber mosaic virus-coat protein | CMV-CP | Forward | GTAGACATCTGTGACGCGATGCCG |
Reverse | TCGCGGAGAAGCATCCATGAGAAAG | ||
18S ribosomal RNA | 18S rRNA | Forward | GTAGTCATATGCTTGTCTC |
Reverse | CTTCCGTCAATTCCTTTAAG | ||
16S ribosomal RNA | 16S rRNA | Forward | AGAGTTTGATCCTGGCTCAG |
Reverse | GGTTACCTTGTTACGACTT |
Characteristics | ||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Bacterial Isolate | Shape (rods) | Gram Staining | Motility | Anaerobic Growth | Spore Formation | Growth at 30–55 °C | Oxidase | Hydrolysis of Tween 20 | Hydrolysis of Tween 80 | Catalase Production | Urease Production | Growth in 7% NaCl | Growth on SkimMed Milk | Indole Production | Gelatin Decomposition | Melibiose | Dulcitol | Arginine Dihydrolase | L-alanine | D-galacturonic Acid | Glycogen | Lactose | Methyl α-D-Glycoside | D-Raffinose | Fructose | Raffinose | Manitol | Galactose |
Bacillus velezensis | + | + | + | + | + | + | + | − | − | + | + | + | + | − | + | − | − | − | − | − | a | a | a | a | a | a | a | a |
Peak | Retention Time (min) | Area % | Detected Compounds | Probability | Chemical Formula | Molecular Weight (g/mol) |
---|---|---|---|---|---|---|
1 | 35.79 | 9.50 | Pyrrolo[1,2-a]pyrazine-1,4-dione | 91.05 | C11H18N2O2 | 210 |
2 | 41.31 | 1.79 | 2,5-Piperazinedione,3,6-bis(2-methylpropyl) | 71.80 | C12H22N2O2 | 226 |
3 | 49.64 | 1.60 | Pyrrolo[1,2-a]pyrazine-1,4-dione,hexahydro-3 (phenylmethyl)- | 69.18 | C14H16N2O2 | 244 |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Abdelkhalek, A.; Behiry, S.I.; Al-Askar, A.A. Bacillus velezensis PEA1 Inhibits Fusarium oxysporum Growth and Induces Systemic Resistance to Cucumber Mosaic Virus. Agronomy 2020, 10, 1312. https://doi.org/10.3390/agronomy10091312
Abdelkhalek A, Behiry SI, Al-Askar AA. Bacillus velezensis PEA1 Inhibits Fusarium oxysporum Growth and Induces Systemic Resistance to Cucumber Mosaic Virus. Agronomy. 2020; 10(9):1312. https://doi.org/10.3390/agronomy10091312
Chicago/Turabian StyleAbdelkhalek, Ahmed, Said I. Behiry, and Abdulaziz A. Al-Askar. 2020. "Bacillus velezensis PEA1 Inhibits Fusarium oxysporum Growth and Induces Systemic Resistance to Cucumber Mosaic Virus" Agronomy 10, no. 9: 1312. https://doi.org/10.3390/agronomy10091312