Hepatitis B Virus-Induced Resistance to Sorafenib and Lenvatinib in Hepatocellular Carcinoma Cells: Implications for Cell Viability and Signaling Pathways
Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Cell Lines and Treatments
2.2. Crystal Violet Cytotoxicity Assay
2.3. Alamar Blue Cell Viability Assay
2.4. Real-Time PCR
2.5. Cell Cycle Analysis by Flow Cytometry
2.6. Western Blot Analysis
2.7. Statistical Analysis
3. Results
3.1. Effects of Sorafenib and Lenvatinib on Cell Viability
3.2. Effects of Sorafenib and Lenvatinib on Cell Cycle
3.3. The Effect of Sorafenib and Lenvatinib on PERK Expression
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Llovet, J.M.; Kelley, R.K.; Villanueva, A.; Singal, A.G.; Pikarsky, E.; Roayaie, S.; Lencioni, R.; Koike, K.; Zucman-Rossi, J.; Finn, R.S. Hepatocellular carcinoma. Nat. Rev. Dis. Primers 2021, 7, 6. [Google Scholar] [CrossRef] [PubMed]
- Bray, F.; Ferlay, J.; Soerjomataram, I.; Siegel, R.L.; Torre, L.A.; Jemal, A. Global cancer statistics 2018: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries. CA Cancer J. Clin. 2018, 68, 394–424. [Google Scholar] [CrossRef] [PubMed]
- Fan, G.; Wei, X.; Xu, X. Is the era of sorafenib over? A review of the literature. Ther. Adv. Med. Oncol. 2020, 12, 1758835920927602. [Google Scholar] [CrossRef] [PubMed]
- Wilhelm, S.M.; Adnane, L.; Newell, P.; Villanueva, A.; Llovet, J.M.; Lynch, M. Preclinical overview of sorafenib, a multikinase inhibitor that targets both Raf and VEGF and PDGF receptor tyrosine kinase signaling. Mol. Cancer Ther. 2008, 7, 3129–3140. [Google Scholar] [CrossRef] [PubMed]
- Roberts, J.L.; Poklepovic, A.; Booth, L.; Dent, P. The multi-kinase inhibitor lenvatinib interacts with the HDAC inhibitor entinostat to kill liver cancer cells. Cell. Signal. 2020, 70, 109573. [Google Scholar] [CrossRef] [PubMed]
- Kudo, M.; Finn, R.S.; Qin, S.; Han, K.-H.; Ikeda, K.; Piscaglia, F.; Baron, A.; Park, J.-W.; Han, G.; Jassem, J.; et al. Lenvatinib versus sorafenib in first-line treatment of patients with unresectable hepatocellular carcinoma: A randomised phase 3 non-inferiority trial. Lancet 2018, 391, 1163–1173. [Google Scholar] [CrossRef]
- Dipasquale, A.; Marinello, A.; Santoro, A. A Comparison of Lenvatinib versus Sorafenib in the First-Line Treatment of Unresectable Hepatocellular Carcinoma: Selection Criteria to Guide Physician’s Choice in a New Therapeutic Scenario. J. Hepatocell. Carcinoma 2021, 8, 241–251. [Google Scholar] [CrossRef]
- Choi, N.R.; Kim, J.Y.; Hong, J.H.; Hur, M.H.; Cho, H.; Park, M.K.; Kim, J.; Lee, Y.B.; Cho, E.J.; Lee, J.-H.; et al. Comparison of the outcomes between sorafenib and lenvatinib as the first-line systemic treatment for HBV-associated hepatocellular carcinoma: A propensity score matching analysis. BMC Gastroenterol. 2022, 22, 135. [Google Scholar] [CrossRef]
- Cabral, L.K.D.; Tiribelli, C.; Sukowati, C.H.C. Sorafenib resistance in hepatocellular carcinoma: The relevance of genetic heterogeneity. Cancers 2020, 12, 1576. [Google Scholar] [CrossRef]
- Bo, W.; Chen, Y. Lenvatinib resistance mechanism and potential ways to conquer. Front. Pharmacol. 2023, 14, 1153991. [Google Scholar] [CrossRef]
- Guo, J.; Zhao, J.; Xu, Q.; Huang, D. Resistance of lenvatinib in hepatocellular carcinoma. Curr. Cancer Drug Targets 2022, 22, 865–878. [Google Scholar] [CrossRef] [PubMed]
- El-Serag, H.B. Epidemiology of viral hepatitis and hepatocellular carcinoma. Gastroenterology 2012, 142, 1264–1273.e1. [Google Scholar] [CrossRef] [PubMed]
- Zhang, S.; Li, N.; Sheng, Y.; Chen, W.; Ma, Q.; Yu, X.; Lian, J.; Zeng, J.; Yang, Y.; Yan, J. Hepatitis B virus induces sorafenib resistance in liver cancer via upregulation of cIAP2 expression. Infect. Agents Cancer 2021, 16, 20. [Google Scholar] [CrossRef] [PubMed]
- Witt-Kehati, D.; Fridkin, A.; Alaluf, M.B.; Zemel, R.; Shlomai, A. Inhibition of pMAPK14 Overcomes Resistance to Sorafenib in Hepatoma Cells with Hepatitis B Virus. Transl. Oncol. 2018, 11, 511–517. [Google Scholar] [CrossRef] [PubMed]
- Liu, L.; Lv, Z.; Wang, M.; Zhang, D.; Liu, D.; Zhu, F. HBV Enhances Sorafenib Resistance in Hepatocellular Carcinoma by Reducing Ferroptosis via SRSF2-Mediated Abnormal PCLAF Splicing. Int. J. Mol. Sci. 2023, 24, 3263. [Google Scholar] [CrossRef]
- Sells, M.A.; Chen, M.L.; Acs, G. Production of hepatitis B virus particles in Hep G2 cells transfected with cloned hepatitis B virus DNA. Proc. Natl. Acad. Sci. USA 1987, 84, 1005–1009. [Google Scholar] [CrossRef]
- Zhai, B.; Hu, F.; Jiang, X.; Xu, J.; Zhao, D.; Liu, B.; Pan, S.; Dong, X.; Tan, G.; Wei, Z.; et al. Inhibition of Akt reverses the acquired resistance to sorafenib by switching protective autophagy to autophagic cell death in hepatocellular carcinoma. Mol. Cancer Ther. 2014, 13, 1589–1598. [Google Scholar] [CrossRef]
- Bhullar, K.S.; Lagarón, N.O.; McGowan, E.M.; Parmar, I.; Jha, A.; Hubbard, B.P.; Rupasinghe, H.P.V. Kinase-targeted cancer therapies: Progress, challenges and future directions. Mol. Cancer 2018, 17, 48. [Google Scholar] [CrossRef]
- Rudalska, R.; Dauch, D.; Longerich, T.; McJunkin, K.; Wuestefeld, T.; Kang, T.-W.; Hohmeyer, A.; Pesic, M.; Leibold, J.; von Thun, A.; et al. In vivo RNAi screening identifies a mechanism of sorafenib resistance in liver cancer. Nat. Med. 2014, 20, 1138–1146. [Google Scholar] [CrossRef]
- Lu, Y.; Shen, H.; Huang, W.; He, S.; Chen, J.; Zhang, D.; Shen, Y.; Sun, Y. Genome-scale CRISPR-Cas9 knockout screening in hepatocellular carcinoma with lenvatinib resistance. Cell Death Discov. 2021, 7, 359. [Google Scholar] [CrossRef]
- Guo, J.; Zhu, P.; Ye, Z.; Wang, M.; Yang, H.; Huang, S.; Shu, Y.; Zhang, W.; Zhou, H.; Li, Q. YRDC mediates the resistance of lenvatinib in hepatocarcinoma cells via modulating the translation of KRAS. Front. Pharmacol. 2021, 12, 744578. [Google Scholar] [CrossRef] [PubMed]
- He, X.; Hikiba, Y.; Suzuki, Y.; Nakamori, Y.; Kanemaru, Y.; Sugimori, M.; Sato, T.; Nozaki, A.; Chuma, M.; Maeda, S. EGFR inhibition reverses resistance to lenvatinib in hepatocellular carcinoma cells. Sci. Rep. 2022, 12, 8007. [Google Scholar] [CrossRef] [PubMed]
- Fu, R.; Jiang, S.; Li, J.; Chen, H.; Zhang, X. Activation of the HGF/c-MET axis promotes lenvatinib resistance in hepatocellular carcinoma cells with high c-MET expression. Med. Oncol. 2020, 37, 24. [Google Scholar] [CrossRef] [PubMed]
- Buttell, A.; Qiu, W. The action and resistance mechanisms of Lenvatinib in liver cancer. Mol. Carcinog. 2023, 62, 1918–1934. [Google Scholar] [CrossRef] [PubMed]
- Tao, M.; Han, J.; Shi, J.; Liao, H.; Wen, K.; Wang, W.; Mui, S.; Li, H.; Yan, Y.; Xiao, Z. Application and Resistance Mechanisms of Lenvatinib in Patients with Advanced Hepatocellular Carcinoma. J. Hepatocell. Carcinoma 2023, 10, 1069–1083. [Google Scholar] [CrossRef]
- Facciorusso, A.; Tartaglia, N.; Villani, R.; Serviddio, G.; Ramai, D.; Mohan, B.P.; Chandan, S.; Abd El Aziz, M.A.; Evangelista, J.; Cotsoglou, C.; et al. Lenvatinib versus sorafenib as first-line therapy of advanced hepatocellular carcinoma: A systematic review and meta-analysis. Am. J. Transl. Res. 2021, 13, 2379–2387. [Google Scholar]
- Gao, Y.; Fan, X.; Li, N.; Du, C.; Yang, B.; Qin, W.; Fu, J.; Markowitz, G.J.; Wang, H.; Ma, J.; et al. CCL22 signaling contributes to sorafenib resistance in hepatitis B virus-associated hepatocellular carcinoma. Pharmacol. Res. 2020, 157, 104800. [Google Scholar] [CrossRef]
- Chin, R.; Earnest-Silveira, L.; Koeberlein, B.; Franz, S.; Zentgraf, H.; Dong, X.; Gowans, E.; Bock, C.-T.; Torresi, J. Modulation of MAPK pathways and cell cycle by replicating hepatitis B virus: Factors contributing to hepatocarcinogenesis. J. Hepatol. 2007, 47, 325–337. [Google Scholar] [CrossRef]
- Xia, Y.; Cheng, X.; Li, Y.; Valdez, K.; Chen, W.; Liang, T.J. Hepatitis B virus deregulates the cell cycle to promote viral replication and a premalignant phenotype. J. Virol. 2018, 92, 10–1128. [Google Scholar] [CrossRef]
- Lin, Z.-Y.; Yeh, M.-L.; Liang, P.-C.; Hsu, P.-Y.; Huang, C.-F.; Huang, J.-F.; Dai, C.-Y.; Yu, M.-L.; Chuang, W.-L. Dose Consideration of Lenvatinib’s Anti-Cancer Effect on Hepatocellular Carcinoma and the Potential Benefit of Combined Colchicine Therapy. Cancers 2023, 15, 5097. [Google Scholar] [CrossRef]
- Mai, H.; Huang, J.; Zhang, Y.; Qu, N.; Qu, H.; Mei, G.-H.; Liu, J.; Xu, X.; Chen, L. In-vivo relation between plasma concentration of sorafenib and its safety in Chinese patients with metastatic renal cell carcinoma: A single-center clinical study. Oncotarget 2017, 8, 43458–43469. [Google Scholar] [CrossRef] [PubMed]
Accession Number | Gene Name | Sequence (5′ → 3′) | Product Size (bp) |
---|---|---|---|
NM_001786.5 | CDK1 | CCTGGTCAGTACATGGATTCTT | 150 |
AGCCAGTTTAATTGTTCCTTTGTC | |||
NM_001798.5 | CDK2 | AGAAACAAGTTGACGGGAGAG | 136 |
GCAGCTTGACAATATTAGGATGG | |||
NM_001145306.1 | CDK6 | CCGAAGTCTTGCTCCAGTC | 149 |
GAGTCCAATCACGTCCAAGAT | |||
NM_031966.4 | CCNB1 | GGCTTTCTCTGATGTAATTCTTGC | 142 |
GTATTTTGGTCTGACTGCTTGC | |||
NM_004701.4 | CCNB2 | GGCTGGTACAAGTCCACTCC | 107 |
CTTCTTCCGGGAAACTGGCT | |||
NM_053056.3 | CCND1 | CATCTACACCGACAACTCCATC | 135 |
TCTGGCATTTTGGAGAGGAAG | |||
NM_001759.4 | CCND2 | ACTTGTGATGCCCTGACTG | 141 |
ACTTGGATCCGTCACGTTG | |||
NM_001015.5 | RPS11 | CTACAAGAACATCGGTCTGGG | 150 |
ATGGTCCTCTGCATCTTCATC |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Esmael, N.; Lubin, I.; Tur-Kaspa, R.; Zemel, R. Hepatitis B Virus-Induced Resistance to Sorafenib and Lenvatinib in Hepatocellular Carcinoma Cells: Implications for Cell Viability and Signaling Pathways. Cancers 2024, 16, 3763. https://doi.org/10.3390/cancers16223763
Esmael N, Lubin I, Tur-Kaspa R, Zemel R. Hepatitis B Virus-Induced Resistance to Sorafenib and Lenvatinib in Hepatocellular Carcinoma Cells: Implications for Cell Viability and Signaling Pathways. Cancers. 2024; 16(22):3763. https://doi.org/10.3390/cancers16223763
Chicago/Turabian StyleEsmael, Narmen, Ido Lubin, Ran Tur-Kaspa, and Romy Zemel. 2024. "Hepatitis B Virus-Induced Resistance to Sorafenib and Lenvatinib in Hepatocellular Carcinoma Cells: Implications for Cell Viability and Signaling Pathways" Cancers 16, no. 22: 3763. https://doi.org/10.3390/cancers16223763
APA StyleEsmael, N., Lubin, I., Tur-Kaspa, R., & Zemel, R. (2024). Hepatitis B Virus-Induced Resistance to Sorafenib and Lenvatinib in Hepatocellular Carcinoma Cells: Implications for Cell Viability and Signaling Pathways. Cancers, 16(22), 3763. https://doi.org/10.3390/cancers16223763