Antagonizing MDM2 Overexpression Induced by MDM4 Inhibitor CEP-1347 Effectively Reactivates Wild-Type p53 in Malignant Brain Tumor Cells
Abstract
Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Reagents and Antibodies
2.2. Cell Culture
2.3. Western Blot Analysis
2.4. Reverse Transcription (RT)-PCR Analysis
2.5. Gene Silencing by siRNA
2.6. Trypan Blue Dye Exclusion Assay
2.7. Colony Formation Assay
2.8. Statistical Analysis
3. Results
3.1. Marked Increase in the Expression of MDM2 after the CEP-1347 Treatment of Malignant Brain Tumor Cells with Wild-Type p53
3.2. CEP-1347-Induced MDM2 Overexpression Counteracts the CEP-1347-Induced Activation of p53
3.3. The MDM2 Antagonist RG7112 Concomitant with CEP-1347 Effectively Activates p53 and Inhibits the Growth of Malignant Brain Tumor Cells with Wild-Type p53
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Joerger, A.C.; Fersht, A.R. The p53 Pathway: Origins, Inactivation in Cancer, and Emerging Therapeutic Approaches. Annu. Rev. Biochem. 2016, 85, 375–404. [Google Scholar] [CrossRef] [PubMed]
- Levine, A.J. p53: 800 million years of evolution and 40 years of discovery. Nat. Rev. Cancer 2020, 20, 471–480. [Google Scholar] [CrossRef] [PubMed]
- Aguilar, A.; Wang, S. Therapeutic Strategies to Activate p53. Pharmaceuticals 2022, 16, 24. [Google Scholar] [CrossRef] [PubMed]
- Hassin, O.; Oren, M. Drugging p53 in cancer: One protein, many targets. Nat. Rev. Drug Discov. 2023, 22, 127–144. [Google Scholar] [CrossRef]
- Wang, S.; Chen, F.E. Small-molecule MDM2 inhibitors in clinical trials for cancer therapy. Eur. J. Med. Chem. 2022, 236, 114334. [Google Scholar] [CrossRef]
- Wade, M.; Li, Y.C.; Wahl, G.M. MDM2, MDMX and p53 in oncogenesis and cancer therapy. Nat. Rev. Cancer 2013, 13, 83–96. [Google Scholar] [CrossRef]
- Zhang, S.; Lou, J.; Li, Y.; Zhou, F.; Yan, Z.; Lyu, X.; Zhao, Y. Recent Progress and Clinical Development of Inhibitors that Block MDM4/p53 Protein-Protein Interactions. J. Med. Chem. 2021, 64, 10621–10640. [Google Scholar] [CrossRef]
- Sanz, G.; Singh, M.; Peuget, S.; Selivanova, G. Inhibition of p53 inhibitors: Progress, challenges and perspectives. J. Mol. Cell Biol. 2019, 11, 586–599. [Google Scholar] [CrossRef]
- Koo, N.; Sharma, A.K.; Narayan, S. Therapeutics Targeting p53-MDM2 Interaction to Induce Cancer Cell Death. Int. J. Mol. Sci. 2022, 23, 5005. [Google Scholar] [CrossRef]
- Yu, D.H.; Xu, Z.Y.; Mo, S.; Yuan, L.; Cheng, X.D.; Qin, J.J. Targeting MDMX for Cancer Therapy: Rationale, Strategies, and Challenges. Front. Oncol. 2020, 10, 1389. [Google Scholar] [CrossRef]
- Togashi, K.; Okada, M.; Suzuki, S.; Sanomachi, T.; Seino, S.; Yamamoto, M.; Yamashita, H.; Kitanaka, C. Inhibition of Retinoblastoma Cell Growth by CEP1347 Through Activation of the P53 Pathway. Anticancer Res. 2020, 40, 4961–4968. [Google Scholar] [CrossRef]
- Mitobe, Y.; Nakagawa-Saito, Y.; Togashi, K.; Suzuki, S.; Sugai, A.; Matsuda, K.I.; Sonoda, Y.; Kitanaka, C.; Okada, M. CEP-1347 Targets MDM4 Protein Expression to Activate p53 and Inhibit the Growth of Glioma Cells. Anticancer Res. 2022, 42, 4727–4733. [Google Scholar] [CrossRef] [PubMed]
- Mitobe, Y.; Suzuki, S.; Nakagawa-Saito, Y.; Togashi, K.; Sugai, A.; Sonoda, Y.; Kitanaka, C.; Okada, M. The Novel MDM4 Inhibitor CEP-1347 Activates the p53 Pathway and Blocks Malignant Meningioma Growth In Vitro and In Vivo. Biomedicines 2023, 11, 1967. [Google Scholar] [CrossRef]
- Parkinson Study Group PERCEPT Investigations. Mixed lineage kinase inhibitor CEP-1347 fails to delay disability in early Parkinson disease. Neurology 2007, 69, 1480–1490. [Google Scholar] [CrossRef] [PubMed]
- Kawai, H.; Lopez-Pajares, V.; Kim, M.M.; Wiederschain, D.; Yuan, Z.M. RING domain-mediated interaction is a requirement for MDM2’s E3 ligase activity. Cancer Res. 2007, 67, 6026–6030. [Google Scholar] [CrossRef]
- Dolezelova, P.; Cetkovska, K.; Vousden, K.H.; Uldrijan, S. Mutational analysis of Mdm2 C-terminal tail suggests an evolutionarily conserved role of its length in Mdm2 activity toward p53 and indicates structural differences between Mdm2 homodimers and Mdm2/MdmX heterodimers. Cell Cycle 2012, 11, 953–962. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Linares, L.K.; Hengstermann, A.; Ciechanover, A.; Müller, S.; Scheffner, M. HdmX stimulates Hdm2-mediated ubiquitination and degradation of p53. Proc. Natl. Acad. Sci. USA 2003, 100, 12009–12014. [Google Scholar] [CrossRef] [PubMed]
- Okada, M.; Nakagawa-Saito, Y.; Mitobe, Y.; Sugai, A.; Togashi, K.; Suzuki, S.; Kitanaka, C. Inhibition of the Phospholipase Cε-c-Jun N-Terminal Kinase Axis Suppresses Glioma Stem Cell Properties. Int. J. Mol. Sci. 2022, 23, 8785. [Google Scholar] [CrossRef]
- Kuramoto, K.; Yamamoto, M.; Suzuki, S.; Togashi, K.; Sanomachi, T.; Kitanaka, C.; Okada, M. Inhibition of the Lipid Droplet-Peroxisome Proliferator-Activated Receptor α Axis Suppresses Cancer Stem Cell Properties. Genes 2021, 12, 99. [Google Scholar] [CrossRef]
- Vu, B.; Wovkulich, P.; Pizzolato, G.; Lovey, A.; Ding, Q.; Jiang, N.; Liu, J.J.; Zhao, C.; Glenn, K.; Wen, Y.; et al. Discovery of RG7112: A Small-Molecule MDM2 Inhibitor in Clinical Development. ACS Med. Chem. Lett. 2013, 4, 466–469. [Google Scholar] [CrossRef]
- Verreault, M.; Schmitt, C.; Goldwirt, L.; Pelton, K.; Haidar, S.; Levasseur, C.; Guehennec, J.; Knoff, D.; Labussière, M.; Marie, Y.; et al. Preclinical Efficacy of the MDM2 Inhibitor RG7112 in MDM2-Amplified and TP53 Wild-type Glioblastomas. Clin. Cancer Res. 2016, 22, 1185–1196. [Google Scholar] [CrossRef] [PubMed]
- Andreeff, M.; Kelly, K.R.; Yee, K.; Assouline, S.; Strair, R.; Popplewell, L.; Bowen, D.; Martinelli, G.; Drummond, M.W.; Vyas, P.; et al. Results of the Phase I Trial of RG7112, a Small-Molecule MDM2 Antagonist in Leukemia. Clin. Cancer Res. 2016, 22, 868–876. [Google Scholar] [CrossRef]
- Wahl, G.M. Mouse bites dogma: How mouse models are changing our views of how P53 is regulated in vivo. Cell Death Differ. 2006, 13, 973–983. [Google Scholar] [CrossRef] [PubMed][Green Version]
- Wade, M.; Wong, E.T.; Tang, M.; Stommel, J.M.; Wahl, G.M. Hdmx modulates the outcome of p53 activation in human tumor cells. J. Biol. Chem. 2006, 281, 33036–33044. [Google Scholar] [CrossRef] [PubMed]
- Vaseva, A.V.; Yallowitz, A.R.; Marchenko, N.D.; Xu, S.; Moll, U.M. Blockade of Hsp90 by 17AAG antagonizes MDMX and synergizes with Nutlin to induce p53-mediated apoptosis in solid tumors. Cell Death Dis. 2011, 2, e156. [Google Scholar] [CrossRef]
- Wang, H.; Ma, X.; Ren, S.; Buolamwini, J.K.; Yan, C. A small-molecule inhibitor of MDMX activates p53 and induces apoptosis. Mol. Cancer Ther. 2011, 10, 69–79. [Google Scholar] [CrossRef]
- Ma, Q.; Gelbard, H.A.; Maggirwar, S.B.; Dewhurst, S.; Gendelman, H.E.; Peterson, D.R.; DiFrancesco, R.; Hochreiter, J.S.; Morse, G.D.; Schifitto, G. Pharmacokinetic interactions of CEP-1347 and atazanavir in HIV-infected patients. J. Neurovirol. 2013, 19, 254–260. [Google Scholar] [CrossRef]
- Ray-Coquard, I.; Blay, J.Y.; Italiano, A.; Le Cesne, A.; Penel, N.; Zhi, J.; Heil, F.; Rueger, R.; Graves, B.; Ding, M.; et al. Effect of the MDM2 antagonist RG7112 on the P53 pathway in patients with MDM2-amplified, well-differentiated or dedifferentiated liposarcoma: An exploratory proof-of-mechanism study. Lancet Oncol. 2012, 13, 1133–1140. [Google Scholar] [CrossRef]
- Patnaik, A.; Tolcher, A.; Beeram, M.; Nemunaitis, J.; Weiss, G.J.; Bhalla, K.; Agrawal, M.; Nichols, G.; Middleton, S.; Beryozkina, A.; et al. Clinical pharmacology characterization of RG7112, an MDM2 antagonist, in patients with advanced solid tumors. Cancer Chemother. Pharmacol. 2015, 76, 587–595. [Google Scholar] [CrossRef]
- Iancu-Rubin, C.; Mosoyan, G.; Glenn, K.; Gordon, R.E.; Nichols, G.L.; Hoffman, R. Activation of p53 by the MDM2 inhibitor RG7112 impairs thrombopoiesis. Exp. Hematol. 2014, 42, 137–145.e5. [Google Scholar] [CrossRef]
Gene Name | Forward | Reverse |
---|---|---|
MDM4 | AGGTACGACCAAAACTGCCG | CTGCACTTTGCTTCAGTTGGT |
MDM2 | GGTGCTGTAACCACCTCACA | TGAGTCCGATGATTCCTGCTG |
TP53 | ACAACGTTCTGTCCCCCTTG | CTCCGTCATGTGCTGTGACT |
CDKN1A | GGGATTTCTTCTGTTCAGGCG | TGGTAGAAATCTGTCATGCTGGT |
ACTB | CCCATGCCATCCTGCGTCTG | CGTCATACTCCTGCTTGCTG |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Mitobe, Y.; Suzuki, S.; Nakagawa-Saito, Y.; Togashi, K.; Sugai, A.; Sonoda, Y.; Kitanaka, C.; Okada, M. Antagonizing MDM2 Overexpression Induced by MDM4 Inhibitor CEP-1347 Effectively Reactivates Wild-Type p53 in Malignant Brain Tumor Cells. Cancers 2023, 15, 4326. https://doi.org/10.3390/cancers15174326
Mitobe Y, Suzuki S, Nakagawa-Saito Y, Togashi K, Sugai A, Sonoda Y, Kitanaka C, Okada M. Antagonizing MDM2 Overexpression Induced by MDM4 Inhibitor CEP-1347 Effectively Reactivates Wild-Type p53 in Malignant Brain Tumor Cells. Cancers. 2023; 15(17):4326. https://doi.org/10.3390/cancers15174326
Chicago/Turabian StyleMitobe, Yuta, Shuhei Suzuki, Yurika Nakagawa-Saito, Keita Togashi, Asuka Sugai, Yukihiko Sonoda, Chifumi Kitanaka, and Masashi Okada. 2023. "Antagonizing MDM2 Overexpression Induced by MDM4 Inhibitor CEP-1347 Effectively Reactivates Wild-Type p53 in Malignant Brain Tumor Cells" Cancers 15, no. 17: 4326. https://doi.org/10.3390/cancers15174326
APA StyleMitobe, Y., Suzuki, S., Nakagawa-Saito, Y., Togashi, K., Sugai, A., Sonoda, Y., Kitanaka, C., & Okada, M. (2023). Antagonizing MDM2 Overexpression Induced by MDM4 Inhibitor CEP-1347 Effectively Reactivates Wild-Type p53 in Malignant Brain Tumor Cells. Cancers, 15(17), 4326. https://doi.org/10.3390/cancers15174326