Establishment of Novel Neuroendocrine Carcinoma Patient-Derived Xenograft Models for Receptor Peptide-Targeted Therapy
Abstract
:Simple Summary
Abstract
1. Introduction
2. Methods
2.1. Patient-Derived Xenograft Models and Cell Lines
2.2. Histology and Immunohistochemistry
2.3. Quantitative PCR
2.4. Immunofluorescence
2.5. Genomic DNA Analyses
2.6. Imaging of Patient-Derived Xenograft Mouse Model with Bilateral Tumors
3. Results
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Dasari, A.; Shen, C.; Halperin, D.; Zhao, B.; Zhou, S.; Xu, Y.; Shih, T.; Yao, J.C. Trends in the Incidence, Prevalence, and Survival Outcomes in Patients with Neuroendocrine Tumors in the United States. JAMA Oncol. 2017, 3, 1335–1342. [Google Scholar] [CrossRef]
- Panzuto, F.; Boninsegna, L.; Fazio, N.; Campana, D.; Pia Brizzi, M.; Capurso, G.; Scarpa, A.; De Braud, F.; Dogliotti, L.; Tomassetti, P.; et al. Metastatic and locally advanced pancreatic endocrine carcinomas: Analysis of factors associated with disease progression. J. Clin. Oncol. 2011, 29, 2372–2377. [Google Scholar] [CrossRef] [PubMed]
- Pavel, M.; O’Toole, D.; Costa, F.; Capdevila, J.; Gross, D.; Kianmanesh, R.; Krenning, E.; Knigge, U.; Salazar, R.; Pape, U.F.; et al. ENETS Consensus Guidelines Update for the Management of Distant Metastatic Disease of Intestinal, Pancreatic, Bronchial Neuroendocrine Neoplasms (NEN) and NEN of Unknown Primary Site. Neuroendocrinology 2016, 103, 172–185. [Google Scholar] [CrossRef] [PubMed]
- Dasari, A.; Mehta, K.; Byers, L.A.; Sorbye, H.; Yao, J.C. Comparative study of lung and extrapulmonary poorly differentiated neuroendocrine carcinomas: A SEER database analysis of 162,983 cases. Cancer 2018, 124, 807–815. [Google Scholar] [CrossRef] [PubMed]
- Nagtegaal, I.D.; Odze, R.D.; Klimstra, D.; Paradis, V.; Rugge, M.; Schirmacher, P.; Washington, K.M.; Carneiro, F.; Cree, I.A.; WHO Classification of Tumors Editorial Board. The 2019 WHO classification of tumours of the digestive system. Histopathology 2020, 76, 182–188. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Venizelos, A.; Elvebakken, H.; Perren, A.; Nikolaienko, O.; Deng, W.; Lothe, I.M.B.; Couvelard, A.; Hjortland, G.O.; Sundlov, A.; Svensson, J.; et al. The molecular characteristics of high-grade gastroenteropancreatic neuroendocrine neoplasms. Endocr. Relat. Cancer 2021, 29, 1–14. [Google Scholar] [CrossRef] [PubMed]
- Yachida, S.; Totoki, Y.; Noe, M.; Nakatani, Y.; Horie, M.; Kawasaki, K.; Nakamura, H.; Saito-Adachi, M.; Suzuki, M.; Takai, E.; et al. Comprehensive Genomic Profiling of Neuroendocrine Carcinomas of the Gastrointestinal System. Cancer Discov. 2021, 12, 692–711. [Google Scholar] [CrossRef]
- Korse, C.M.; Taal, B.G.; van Velthuysen, M.L.; Visser, O. Incidence and survival of neuroendocrine tumours in the Netherlands according to histological grade: Experience of two decades of cancer registry. Eur. J. Cancer 2013, 49, 1975–1983. [Google Scholar] [CrossRef]
- Shah, M.H.; Goldner, W.S.; Benson, A.B.; Bergsland, E.; Blaszkowsky, L.S.; Brock, P.; Chan, J.; Das, S.; Dickson, P.V.; Fanta, P.; et al. Neuroendocrine and Adrenal Tumors, Version 2.2021, NCCN Clinical Practice Guidelines in Oncology. J. Natl. Compr. Cancer Netw. 2021, 19, 839–868. [Google Scholar] [CrossRef]
- Sorbye, H.; Strosberg, J.; Baudin, E.; Klimstra, D.S.; Yao, J.C. Gastroenteropancreatic high-grade neuroendocrine carcinoma. Cancer 2014, 120, 2814–2823. [Google Scholar] [CrossRef]
- Walenkamp, A.M.; Sonke, G.S.; Sleijfer, D.T. Clinical and therapeutic aspects of extrapulmonary small cell carcinoma. Cancer Treat. Rev. 2009, 35, 228–236. [Google Scholar] [CrossRef] [PubMed]
- Brennan, S.M.; Gregory, D.L.; Stillie, A.; Herschtal, A.; Mac Manus, M.; Ball, D.L. Should extrapulmonary small cell cancer be managed like small cell lung cancer? Cancer 2010, 116, 888–895. [Google Scholar] [CrossRef] [PubMed]
- Conte, B.; George, B.; Overman, M.; Estrella, J.; Jiang, Z.Q.; Mehrvarz Sarshekeh, A.; Ferrarotto, R.; Hoff, P.M.; Rashid, A.; Yao, J.C.; et al. High-Grade Neuroendocrine Colorectal Carcinomas: A Retrospective Study of 100 Patients. Clin. Colorectal Cancer 2016, 15, e1–e7. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Terashima, T.; Morizane, C.; Hiraoka, N.; Tsuda, H.; Tamura, T.; Shimada, Y.; Kaneko, S.; Kushima, R.; Ueno, H.; Kondo, S.; et al. Comparison of chemotherapeutic treatment outcomes of advanced extrapulmonary neuroendocrine carcinomas and advanced small-cell lung carcinoma. Neuroendocrinology 2012, 96, 324–332. [Google Scholar] [CrossRef]
- Sorbye, H.; Welin, S.; Langer, S.W.; Vestermark, L.W.; Holt, N.; Osterlund, P.; Dueland, S.; Hofsli, E.; Guren, M.G.; Ohrling, K.; et al. Predictive and prognostic factors for treatment and survival in 305 patients with advanced gastrointestinal neuroendocrine carcinoma (WHO G3): The NORDIC NEC study. Ann. Oncol. 2013, 24, 152–160. [Google Scholar] [CrossRef]
- Phan, A.T.; Kunz, P.L.; Reidy-Lagunes, D.L. New and Emerging Treatment Options for Gastroenteropancreatic Neuroendocrine Tumors. Clin. Adv. Hematol. Oncol. 2015, 13, 1–18. [Google Scholar]
- Cives, M.; Strosberg, J. Treatment Strategies for Metastatic Neuroendocrine Tumors of the Gastrointestinal Tract. Curr. Treat. Options Oncol. 2017, 18, 14. [Google Scholar] [CrossRef]
- Perez, K.; Chan, J. Treatment of Gastroenteropancreatic Neuroendocrine Tumors. Surg. Pathol. Clin. 2019, 12, 1045–1053. [Google Scholar] [CrossRef]
- Ear, P.H.; Li, G.; Wu, M.; Abusada, E.; Bellizzi, A.M.; Howe, J.R. Establishment and Characterization of Small Bowel Neuroendocrine Tumor Spheroids. J. Vis. Exp. 2019, 152, e60303. [Google Scholar] [CrossRef]
- Tillotson, L.G.; Lodestro, C.; Hocker, M.; Wiedenmann, B.; Newcomer, C.E.; Reid, L.M. Isolation, maintenance, and characterization of human pancreatic islet tumor cells expressing vasoactive intestinal peptide. Pancreas 2001, 22, 91–98. [Google Scholar] [CrossRef]
- Fujii, M.; Shimokawa, M.; Date, S.; Takano, A.; Matano, M.; Nanki, K.; Ohta, Y.; Toshimitsu, K.; Nakazato, Y.; Kawasaki, K.; et al. A Colorectal Tumor Organoid Library Demonstrates Progressive Loss of Niche Factor Requirements during Tumorigenesis. Cell Stem Cell 2016, 18, 827–838. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Evers, B.M.; Townsend, C.M., Jr.; Upp, J.R.; Allen, E.; Hurlbut, S.C.; Kim, S.W.; Rajaraman, S.; Singh, P.; Reubi, J.C.; Thompson, J.C. Establishment and characterization of a human carcinoid in nude mice and effect of various agents on tumor growth. Gastroenterology 1991, 101, 303–311. [Google Scholar] [CrossRef]
- Iguchi, H.; Hayashi, I.; Kono, A. A somatostatin-secreting cell line established from a human pancreatic islet cell carcinoma (somatostatinoma): Release experiment and immunohistochemical study. Cancer Res. 1990, 50, 3691–3693. [Google Scholar] [PubMed]
- Benten, D.; Behrang, Y.; Unrau, L.; Weissmann, V.; Wolters-Eisfeld, G.; Burdak-Rothkamm, S.; Stahl, F.R.; Anlauf, M.; Grabowski, P.; Mobs, M.; et al. Establishment of the First Well-differentiated Human Pancreatic Neuroendocrine Tumor Model. Mol. Cancer Res. 2018, 16, 496–507. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Hofving, T.; Arvidsson, Y.; Almobarak, B.; Inge, L.; Pfragner, R.; Persson, M.; Stenman, G.; Kristiansson, E.; Johanson, V.; Nilsson, O. The neuroendocrine phenotype, genomic profile and therapeutic sensitivity of GEPNET cell lines. Endocr. Relat. Cancer 2018, 25, 367–380. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Parekh, D.; Ishizuka, J.; Townsend, C.M., Jr.; Haber, B.; Beauchamp, R.D.; Karp, G.; Kim, S.W.; Rajaraman, S.; Greeley, G., Jr.; Thompson, J.C. Characterization of a human pancreatic carcinoid in vitro: Morphology, amine and peptide storage, and secretion. Pancreas 1994, 9, 83–90. [Google Scholar] [CrossRef] [PubMed]
- Pfragner, R.; Behmel, A.; Hoger, H.; Beham, A.; Ingolic, E.; Stelzer, I.; Svejda, B.; Moser, V.A.; Obenauf, A.C.; Siegl, V.; et al. Establishment and characterization of three novel cell lines -P-STS, L-STS, H-STS- derived from a human metastatic midgut carcinoid. Anticancer Res. 2009, 29, 1951–1961. [Google Scholar]
- Hernandez Vargas, S.; Kossatz, S.; Voss, J.; Ghosh, S.C.; Tran Cao, H.S.; Simien, J.; Reiner, T.; Dhingra, S.; Fisher, W.E.; Azhdarinia, A. Specific Targeting of Somatostatin Receptor Subtype-2 for Fluorescence-Guided Surgery. Clin. Cancer Res. 2019, 25, 4332–4342. [Google Scholar] [CrossRef] [Green Version]
- Herrera-Martinez, A.D.; Feelders, R.A.; Van den Dungen, R.; Dogan-Oruc, F.; van Koetsveld, P.M.; Castano, J.P.; de Herder, W.W.; Hofland, L.J. Effect of the Tryptophan Hydroxylase Inhibitor Telotristat on Growth and Serotonin Secretion in 2D and 3D Cultured Pancreatic Neuroendocrine Tumor Cells. Neuroendocrinology 2020, 110, 351–363. [Google Scholar] [CrossRef]
- Hernandez Vargas, S.; Lin, C.; Voss, J.; Ghosh, S.C.; Halperin, D.M.; AghaAmiri, S.; Cao, H.S.T.; Ikoma, N.; Uselmann, A.J.; Azhdarinia, A. Development of a drug-device combination for fluorescence-guided surgery in neuroendocrine tumors. J. Biomed. Opt. 2020, 25, 126002. [Google Scholar] [CrossRef]
- Grozinsky-Glasberg, S.; Shimon, I.; Rubinfeld, H. The role of cell lines in the study of neuroendocrine tumors. Neuroendocrinology 2012, 96, 173–187. [Google Scholar] [CrossRef] [PubMed]
- Kolby, L.; Bernhardt, P.; Ahlman, H.; Wangberg, B.; Johanson, V.; Wigander, A.; Forssell-Aronsson, E.; Karlsson, S.; Ahren, B.; Stenman, G.; et al. A transplantable human carcinoid as model for somatostatin receptor-mediated and amine transporter-mediated radionuclide uptake. Am. J. Pathol. 2001, 158, 745–755. [Google Scholar] [CrossRef] [Green Version]
- Chamberlain, C.E.; German, M.S.; Yang, K.; Wang, J.; VanBrocklin, H.; Regan, M.; Shokat, K.M.; Ducker, G.S.; Kim, G.E.; Hann, B.; et al. A Patient-derived Xenograft Model of Pancreatic Neuroendocrine Tumors Identifies Sapanisertib as a Possible New Treatment for Everolimus-resistant Tumors. Mol. Cancer Ther. 2018, 17, 2702–2709. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Yachida, S.; Vakiani, E.; White, C.M.; Zhong, Y.; Saunders, T.; Morgan, R.; de Wilde, R.F.; Maitra, A.; Hicks, J.; Demarzo, A.M.; et al. Small cell and large cell neuroendocrine carcinomas of the pancreas are genetically similar and distinct from well-differentiated pancreatic neuroendocrine tumors. Am. J. Surg. Pathol. 2012, 36, 173–184. [Google Scholar] [CrossRef]
- Kawasaki, K.; Toshimitsu, K.; Matano, M.; Fujita, M.; Fujii, M.; Togasaki, K.; Ebisudani, T.; Shimokawa, M.; Takano, A.; Takahashi, S.; et al. An Organoid Biobank of Neuroendocrine Neoplasms Enables Genotype-Phenotype Mapping. Cell 2020, 183, 1420–1435.e21. [Google Scholar] [CrossRef]
- Pettengill, O.S.; Sorenson, G.D.; Wurster-Hill, D.H.; Curphey, T.J.; Noll, W.W.; Cate, C.C.; Maurer, L.H. Isolation and growth characteristics of continuous cell lines from small-cell carcinoma of the lung. Cancer 1980, 45, 906–918. [Google Scholar] [CrossRef]
- Baillie-Johnson, H.; Twentyman, P.R.; Fox, N.E.; Walls, G.A.; Workman, P.; Watson, J.V.; Johnson, N.; Reeve, J.G.; Bleehen, N.M. Establishment and characterisation of cell lines from patients with lung cancer (predominantly small cell carcinoma). Br. J. Cancer 1985, 52, 495–504. [Google Scholar] [CrossRef] [Green Version]
- Gock, M.; Mullins, C.S.; Harnack, C.; Prall, F.; Ramer, R.; Goder, A.; Kramer, O.H.; Klar, E.; Linnebacher, M. Establishment, functional and genetic characterization of a colon derived large cell neuroendocrine carcinoma cell line. World J. Gastroenterol. 2018, 24, 3749–3759. [Google Scholar] [CrossRef]
- Detjen, K.; Hammerich, L.; Ozdirik, B.; Demir, M.; Wiedenmann, B.; Tacke, F.; Jann, H.; Roderburg, C. Models of Gastroenteropancreatic Neuroendocrine Neoplasms: Current Status and Future Directions. Neuroendocrinology 2021, 111, 217–236. [Google Scholar] [CrossRef]
- Krieg, A.; Mersch, S.; Boeck, I.; Dizdar, L.; Weihe, E.; Hilal, Z.; Krausch, M.; Mohlendick, B.; Topp, S.A.; Piekorz, R.P.; et al. New model for gastroenteropancreatic large-cell neuroendocrine carcinoma: Establishment of two clinically relevant cell lines. PLoS ONE 2014, 9, e88713. [Google Scholar] [CrossRef] [Green Version]
- Li, M.; Sagastume, E.A.; Lee, D.; McAlister, D.; DeGraffenreid, A.J.; Olewine, K.R.; Graves, S.; Copping, R.; Mirzadeh, S.; Zimmerman, B.E.; et al. (203/212)Pb Theranostic Radiopharmaceuticals for Image-guided Radionuclide Therapy for Cancer. Curr. Med. Chem. 2020, 27, 7003–7031. [Google Scholar] [CrossRef] [PubMed]
- Kaemmerer, D.; Reimann, C.; Specht, E.; Wirtz, R.M.; Sayeg, M.; Baum, R.P.; Schulz, S.; Lupp, A. Differential expression and prognostic value of the chemokine receptor CXCR4 in bronchopulmonary neuroendocrine neoplasms. Oncotarget 2015, 6, 3346–3358. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Werner, R.A.; Kircher, S.; Higuchi, T.; Kircher, M.; Schirbel, A.; Wester, H.J.; Buck, A.K.; Pomper, M.G.; Rowe, S.P.; Lapa, C. CXCR4-Directed Imaging in Solid Tumors. Front. Oncol. 2019, 9, 770. [Google Scholar] [CrossRef] [PubMed] [Green Version]
Gene Symbol | Forward | Reverse |
---|---|---|
GAPDH | GGAGCGAGATCCCTCCAAAAT | GGCTGTTGTCATACTTCTCATGG |
CGA | TAAAGGGGATACCGAGGTGATG | TCGGAGTGTCTCAAAACATTCC |
SYP | CTCGGCTTTGTGAAGGTGCT | CTGAGGTCACTCTCGGTCTTG |
SSTR1 | GCGCCATCCTGATCTCTTTCA | AACGTGGAGGTGACTAGGAAG |
SSTR2 | TGGCTATCCATTCCATTTGACC | AGGACTGCATTGCTTGTCAGG |
SSTR3 | AGAACCTGAGAATGCCTCCTC | GCCGCAGGACCACATAGATG |
SSTR4 | GCATGGTCGCTATCCAGTG | GCGAAGGATCACGAAGATGAC |
SSTR5 | GTGATCCTTCGCTACGCCAA | CACGGTGAGACAGAAGACGC |
CXCR4 | ACGCCACCAACAGTCAGAG | AGTCGGGAATAGTCAGCAGGA |
Patient Tumor ID Number | Classification of Tumor | WHO Terminology | Differentiation | Tumor Grade | Ki67 (%) | Establishment of PDX |
---|---|---|---|---|---|---|
PNET459 | Pancreatic NET | NET Grade 2 | Well differentiated | Intermediate | 7 | no |
PNET560 | Pancreatic NET | NET Grade 2 | Well differentiated | Intermediate | 8.4 | no |
PNET1164 | Pancreatic NET | NET Grade 2 | Well differentiated | Intermediate | 13 | no |
SBNET1063 | Small bowel NET | NET Grade 3 | Well differentiated | High | 80 | no |
NEC913 | Ampullary NEC | NEC, small and large-cell types | Poorly differentiated | High | 80–90 | yes |
NEC1452 | Rectal NEC | NEC, large-cell type | Poorly differentiated | High | 80–90 | yes |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Tran, C.G.; Borbon, L.C.; Mudd, J.L.; Abusada, E.; AghaAmiri, S.; Ghosh, S.C.; Vargas, S.H.; Li, G.; Beyer, G.V.; McDonough, M.; et al. Establishment of Novel Neuroendocrine Carcinoma Patient-Derived Xenograft Models for Receptor Peptide-Targeted Therapy. Cancers 2022, 14, 1910. https://doi.org/10.3390/cancers14081910
Tran CG, Borbon LC, Mudd JL, Abusada E, AghaAmiri S, Ghosh SC, Vargas SH, Li G, Beyer GV, McDonough M, et al. Establishment of Novel Neuroendocrine Carcinoma Patient-Derived Xenograft Models for Receptor Peptide-Targeted Therapy. Cancers. 2022; 14(8):1910. https://doi.org/10.3390/cancers14081910
Chicago/Turabian StyleTran, Catherine G., Luis C. Borbon, Jacqueline L. Mudd, Ellen Abusada, Solmaz AghaAmiri, Sukhen C. Ghosh, Servando Hernandez Vargas, Guiying Li, Gabriella V. Beyer, Mary McDonough, and et al. 2022. "Establishment of Novel Neuroendocrine Carcinoma Patient-Derived Xenograft Models for Receptor Peptide-Targeted Therapy" Cancers 14, no. 8: 1910. https://doi.org/10.3390/cancers14081910
APA StyleTran, C. G., Borbon, L. C., Mudd, J. L., Abusada, E., AghaAmiri, S., Ghosh, S. C., Vargas, S. H., Li, G., Beyer, G. V., McDonough, M., Li, R., Chan, C. H. F., Walsh, S. A., Wadas, T. J., O’Dorisio, T., O’Dorisio, M. S., Govindan, R., Cliften, P. F., Azhdarinia, A., ... Ear, P. H. (2022). Establishment of Novel Neuroendocrine Carcinoma Patient-Derived Xenograft Models for Receptor Peptide-Targeted Therapy. Cancers, 14(8), 1910. https://doi.org/10.3390/cancers14081910