RETRACTED: Analysis of PMEPA1 Isoforms (a and b) as Selective Inhibitors of Androgen and TGF-β Signaling Reveals Distinct Biological and Prognostic Features in Prostate Cancer
Abstract
1. Introduction
2. Results
2.1. Structures, Expressions and Distinct Regulations of PMEPA1 Isoforms in Prostate Cancer Cells
2.2. PMEPA1-a and -b Isoform mRNA Levels as a Biomarker for Prostate Cancer Aggressiveness
2.3. The Increased Ratio between Transcripts of PMEPA1-a and PMEPA1-b Indicated a Higher Gleason Score and More Aggressive Prostate Cancer
2.4. PMEPA1-a Promoted the Growth of AR Negative Prostate Cancer Cells and Inhibited TGF-β Signaling
2.5. PMEPA1-b Inhibited the Growth of Hormone Dependent Prostate Cancer Cells through Facilitating AR Protein Degradation and Blocking Androgen Signaling
3. Discussion
4. Materials and Methods
4.1. Prostate Cancer Specimens and Clinico-Pathological Data
4.2. RNA Isolation and Quantitative RT-PCR
4.3. The TCGA RNA Sequencing (RNA Seq) Data Acquisition
4.4. Analyses of the Correlation between PMEPA1 Isoform Expression Levels and Clinical Outcome Including Gleason Scores in Prostate Cancer Patients from the TCGA Dataset
4.5. Cell Culture
4.6. Immunoblotting
4.7. Plasmids and siRNAs
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
DoD Disclaimer
References
- Siegel, R.L.; Miller, K.D.; Jemal, A. Cancer statistics, 2019. CA Cancer J. Clin. 2019, 69, 7–34. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Karantanos, T.; Corn, P.G.; Thompson, T.C. Prostate cancer progression after androgen deprivation therapy: Mechanism of castrate resistance and novel therapeutic approaches. Oncogene 2013, 32, 5501–5511. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Augello, M.A. AR function in promoting metastatic prostate cancer. Cancer Metastasis Rev. 2014, 33, 399–411. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Cao, Z.; Kyprianou, N. Mechanism navigating the TGF-β pathway in prostate cancer. Asian J. Urol. 2015, 2, 11–18. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Luo, J.; Attard, G.; Balk, S.P.; Bevan, C.; Burnstein, K.; Cato, L.; Cherkasov, A.; De Bono, J.S.; Dong, Y.; Gao, A.C.; et al. Role of androgen receptor variants in prostate cancer: Report from the 2017 mission androgen receptor variants meeting. Eur. Urol. 2018, 73, 715–723. [Google Scholar] [CrossRef] [Scilit]
- Fournier, P.G.; Juárez, P.; Jiang, G.; Clines, G.A.; Niewolna, M.; Kim, H.S.; Walton, H.W.; Peng, X.H.; Liu, Y.; Mohammad, K.S.; et al. The TGF-β Signaling Regulator PMEPA1 Suppresses Prostate Cancer Metastases to Bone. Cancer Cell 2015, 27, 809–821. [Google Scholar] [CrossRef] [Scilit]
- Xu, L.L.; Shanmugam, N.; Segawa, T.; Sesterhenn, I.A.; McLeod, D.G.; Moul, J.W.; Srivastava, S. A novel androgen-regulated gene, PMEPA1, located on chromosome 20q13 exhibits high level expression in prostate. Genomics 2000, 66, 257–263. [Google Scholar] [CrossRef] [Scilit]
- Xu, L.L.; Su, Y.P.; Labiche, R.; Segawa, T.; Shanmugam, N.; McLeod, D.C.; Moul, J.W.; Srivastava, S. Quantitative expression profile of androgen-regulated genes in prostate cancer cells and identification of prostate-specific genes. Int. J. Cancer 2001, 92, 322–328. [Google Scholar] [CrossRef] [Scilit]
- Masuda, K.; Werner, T.; Maheshwari, S.; Frisch, M.; Oh, S.; Petrovics, G.; May, K.; Srikantan, V.; Srivastava, S.; Dobi, A. Androgen receptor binding sites identified by a GREF-GATA model. J. Mol. Biol. 2005, 353, 763–771. [Google Scholar] [CrossRef] [Scilit]
- Li, H.; Xu, L.L.; Masuda, K.; Raymundo, E.; McLeod, D.G.; Dobi, A.; Srivastava, S. A feedback loop between the androgen receptor and a NEDD4-binding protein, PMEPA1, in prostate cancer cells. J. Biol. Chem. 2008, 283, 28988–28995. [Google Scholar] [CrossRef] [Scilit]
- Brunschwig, E.B.; Wilson, K.; Mack, D.; Dawson, D.; Lawrence, E.; Willson, J.K.; Lu, S.; Nosrati, A.; Rerko, R.M.; Swinler, S.; et al. PMEPA1, a transforming growth factor-beta-induced marker of terminal colonocyte differentiation whose expression is maintained in primary and metastatic colon cancer. Cancer Res. 2003, 63, 1568–1575. [Google Scholar]
- Itoh, S.; Thorikay, M.; Kowanetz, M.; Moustakas, A.; Itoh, F.; Heldin, C.H.; ten Dijke, P. Elucidation of Smad requirement in transforming growth factor-beta type I receptor-induced responses. J. Biol. Chem. 2003, 278, 3751–3761. [Google Scholar] [CrossRef] [Scilit]
- Watanabe, Y.; Itoh, S.; Goto, T.; Ohnishi, E.; Inamitsu, M.; Itoh, F.; Satoh, K.; Wiercinska, E.; Yang, W.; Shi, L.; et al. TMEPAI, A transmembrane TGF-beta-inducible protein, sequesters Smad proteins from active participation in TGF-beta signaling. Mol. Cell 2010, 37, 123–134. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Singha, P.K.; Pandeswara, S.; Geng, H.; Lan, R.; Venkatachalam, M.A.; Saikumar, P. TGF-β induced TMEPAI/PMEPA1 inhibits canonical Smad signaling through R-Smad sequestration and promotes non-canonical PI3K/Akt signaling by reducing PTEN in triple negative breast cancer. Genes Cancer 2014, 5, 320–336. [Google Scholar] [PubMed]
- Itoh, S.; Itoh, F. TMEPAI family: Involvement in regulation of multiple signaling pathways. J. Biochem. 2018, 164, 195–204. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Xu, L.L.; Shi, Y.; Petrovics, G.; Sun, C.; Makarem, M.; Zhang, W.; Sesterhenn, I.A.; McLeod, D.G.; Sun, C.; Moul, J.W.; et al. PMEPA1, an androgen-regulated NEDD4-binding protein, exhibits cell growth inhibitory function and decreased expression during prostate cancer progression. Cancer Res. 2003, 63, 4299–4304. [Google Scholar]
- Richter, E.; Masuda, K.; Cook, C.; Ehrich, M.; Tadese, A.Y.; Li, H.; Owusu, A.; Srivastava, S.; Dobi, A. A role for DNA methylation in regulating the growth suppressor PMEPA1 gene in prostate cancer. Epigenetics 2007, 2, 100–109. [Google Scholar] [CrossRef] [Scilit]
- Sharad, S.; Ravindranath, L.; Haffner, M.C.; Li, H.; Yan, W.; Sesterhenn, I.A.; Chen, Y.; Ali, A.; Srinivasan, A.; McLeod, D.G.; et al. Methylation of the PMEPA1 gene, a negative regulator of the androgen receptor in prostate cancer. Epigenetics 2014, 9, 918–927. [Google Scholar] [CrossRef] [Scilit]
- Li, H.; Mohamed, A.A.; Sharad, S.; Umeda, E.; Song, Y.; Young, D.; Petrovics, G.; McLeod, D.G.; Sesterhenn, I.A.; Sreenath, T.; et al. Silencing of PMEPA1 accelerates the growth of prostate cancer cells through AR, NEDD4 and PTEN. Oncotarget 2015, 6, 15137–15149. [Google Scholar] [CrossRef] [Scilit]
- Liu, R.; Zhou, Z.; Huang, J.; Chen, C. PMEPA1 promotes androgen receptor-negative prostate cell proliferation through suppressing the Smad3/4-c-Myc-p21 Cip1 signaling pathway. J. Pathol. 2011, 223, 683–694. [Google Scholar] [CrossRef] [Scilit]
- Rae, F.K.; Hooper, J.D.; Nicol, D.L.; Clements, J.A. Characterization of a novel gene, STAG1/PMEPA1, upregulated in renal cell carcinoma and other solid tumors. Mol. Carcinog. Publ. Coop. Univ. Tex. MD Anderson Cancer Cent. 2001, 32, 44–53. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Giannini, G.; Ambrosini, M.I.; Di Marcotullio, L.; Cerignoli, F.; Zani, M.; MacKay, A.R.; Screpanti, I.; Frati, L.; Gulino, A. EGF and cell-cycle-regulated STAG1/PMEPA1/ERG1.2 belongs to a conserved gene family and is overexpressed and amplified in breast and ovarian cancer. Mol. Carcinog. Publ. Coop. Univ. Tex. MD Anderson Cancer Cent. 2003, 38, 188–200. [Google Scholar]
- Azami, S.; Vo Nguyen, T.T.; Watanabe, Y.; Kato, M. Cooperative induction of transmembrane prostate androgen induced protein TMEPAI/PMEPA1 by transforming growth factor-β and epidermal growth factor signaling. Biochem. Biophys. Res. Commun. 2015, 456, 580–585. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Singha, P.K.; Yeh, I.T.; Venkatachalam, M.A.; Saikumar, P. Transforming growth factor-beta (TGF-beta)-inducible gene TMEPAI converts TGF-beta from a tumor suppressor to a tumor promoter in breast cancer. Cancer Res. 2010, 70, 6377–6383. [Google Scholar] [CrossRef] [Scilit]
- Hu, Y.; He, K.; Wang, D.; Yuan, X.; Liu, Y.; Ji, H.; Song, J. TMEPAI regulates EMT in lung cancer cells by modulating the ROS and IRS-1 signaling pathways. Carcinogenesis 2013, 34, 1764–1772. [Google Scholar] [CrossRef] [Scilit]
- Vo Nguyen, T.T.; Watanabe, Y.; Shiba, A.; Noguchi, M.; Itoh, S.; Kato, M. TMEPAI/PMEPA1 enhances tumorigenic activities in lung cancer cells. Cancer Sci. 2014, 105, 334–341. [Google Scholar] [CrossRef] [Scilit]
- Li, Y.; Guo, A.; Feng, Y.; Zhang, Y.; Wang, J.; Jing, L.; Liu, Z.; Ma, L.; Diao, A. Sp1 transfection factor promotes TMEPAI gene expression and contributes to cell proliferation. Cell Prolif. 2016, 49, 710–719. [Google Scholar] [CrossRef] [Scilit]
- Nie, Z.; Wang, C.; Zhou, Z.; Chen, C.; Liu, R.; Wang, D. Transforming growth factor-beta increases breast cancer stem cell population partially through upregulating PMEPA1 expression. Acta Biochim. Biophys. Sin. 2016, 48, 194–201. [Google Scholar] [CrossRef] [Scilit]
- Feng, S.; Zhu, X.; Fan, B.; Xie, D.; Li, T.; Zhang, X. MiR 19a 3p targets PMEPA1 and induces prostate cancer cell proliferation, migration and invasion. Mol. Med. Rep. 2016, 13, 4030–4038. [Google Scholar] [CrossRef] [Scilit]
- Koido, M.; Sakurai, J.; Tsukahara, S.; Tani, Y.; Tomida, A. PMEPA1, a TGF-β- and hypoxia-inducible gene that participates in hypoxic gene expression networks in solid tumors. Biochem. Biophys. Res. Commun. 2016, 479, 615–621. [Google Scholar] [CrossRef] [Scilit]
- Karbyshev, M.S.; Grigoryeva, E.S.; Volkomorov, V.V.; Kremmer, E.; Huber, A.; Mitrofanova, I.V.; Kaigorodova, E.V.; Zavyalova, M.V.; Kzhyshkowska, J.G.; Cherdyntseva, N.V.; et al. Development of Novel Monoclonal Antibodies for Evaluation of Transmembrane Prostate Androgen-Induced Protein 1 (TMEPAI) Expression Patterns in Gastric Cancer. Pathol. Oncol. Res. 2018, 24, 427–438. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Abdelaziz, M.; Watanabe, Y.; Kato, M. PMEPA1/TMEPAI knockout impairs tumour growth and lung metastasis in MDA-MB-231 cells without changing monolayer culture cell growth. J. Biochem. 2019, 165, 411–414. [Google Scholar] [CrossRef] [Scilit]
- Amalia, R.; Abdelaziz, M.; Puteri, M.U.; Hwang, J.; Anwar, F.; Watanabe, Y.; Kato, M. TMEPAI/PMEPA1 inhibits Wnt signaling by regulating β-catenin stability and nuclear accumulation in triple negative breast cancer cells. Cell. Signal. 2019, 59, 24–33. [Google Scholar] [CrossRef] [Scilit]
- Zhang, L.; Wang, X.; Lai, C.; Zhang, H.; Lai, M. PMEPA1 induces EMT via a non-canonical TGF-β signaling in colorectal cancer. J. Cell. Mol. Med. 2019, 23, 3603–3615. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Li, Y.; Wang, J.; Song, N.; Zeng, F.; Zhao, M.; Wang, A.; Chen, Y.; Jing, L.; Yu, P.; Diao, A. 2-(2-nitrobenzylidene) indolin-3-one compound inhibits transmembrane prostate androgen-induced protein (TMEPAI) expression and cancer cell proliferation. Cell Prolif. 2018, 51, e12469. [Google Scholar] [CrossRef] [Scilit] [PubMed]







| PMEPA1-a | Forward | 5′-GCAACTG CAAACGCTCTTTGT-3′ |
| PMEPA1-a | Reverse | 5′-GGACCGTGCAGACAGCTTGTA-3′ |
| PMEPA1-a | probe | 6FAM-CATGGAGAT CACGGAGC-TAMRA |
| PMEPA1-b | Forward | 5′-CATCATCCCCGAGCTGCT-3′ |
| PMEPA1-b | Reverse | 5′- TGATCTGAACAAACTCCAGCTCC-3′ |
| PMEPA1-b | probe | 6FAM-AGGCGGACAGTCTCCTGCGAAA-TAMRA |
| KLK3/(PSA) | Forward | 5′-CCC ACT GCA TCA GGA ACA AA-3′ |
| KLK3/(PSA) | Reverse | 5′- GAG CGG GTG TGG GAA GCT-3′ |
| KLK3/(PSA) | probe | 6FAM- ACA CAG GCC AGG TAT TTC AGG TCA GCC -TAMRA |
| AR | Forward | 5′- GGTGTCACTATGGAGCTCTCACAT -3′ |
| AR | Reverse | 5′- GCAATCATTTCTGCTGGCG -3′ |
| AR | probe | FAM- CTTCAAAAGAGCCGCTGAAGGGAAACAG –TAMRA |
| NEDD9 | Forward | 5′-ATCAGCTGAGCCAGTTCCAG-3′ |
| NEDD9 | Reverse | 5′-TGGGTCTCACATTGGTCAT-3′ |
| NEDD9 | probe | 6FAM-AAGCCCTCTCAGAGCCTACC–TAMRA |
| COLA1 | Forward | 5′-CAGGTCTCGGTCATGGTACCT-3′ |
| COLA1 | Reverse | 5′-GTCGAGGGCCAAGACGAA-3′ |
| COLA1 | probe | 6FAM-CATCCCACCAATCACCTGCGTACAGA-TAMRA |
| THBS1 | Forward | 5′-TTGTCTTTGGAACCACACCA-3′ |
| THBS1 | Reverse | 5′-TTGTCAAGGGTGAGGAGGAC-3′ |
| THBS1 | probe | 6FAM-TGCAGCTATCAACAGTCCATTCCTCG -TAMRA |
© 2019 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Sharad, S.; Sztupinszki, Z.M.; Chen, Y.; Kuo, C.; Ravindranath, L.; Szallasi, Z.; Petrovics, G.; Sreenath, T.L.; Dobi, A.; Rosner, I.L.; et al. RETRACTED: Analysis of PMEPA1 Isoforms (a and b) as Selective Inhibitors of Androgen and TGF-β Signaling Reveals Distinct Biological and Prognostic Features in Prostate Cancer. Cancers 2019, 11, 1995. https://doi.org/10.3390/cancers11121995
Sharad S, Sztupinszki ZM, Chen Y, Kuo C, Ravindranath L, Szallasi Z, Petrovics G, Sreenath TL, Dobi A, Rosner IL, et al. RETRACTED: Analysis of PMEPA1 Isoforms (a and b) as Selective Inhibitors of Androgen and TGF-β Signaling Reveals Distinct Biological and Prognostic Features in Prostate Cancer. Cancers. 2019; 11(12):1995. https://doi.org/10.3390/cancers11121995
Chicago/Turabian StyleSharad, Shashwat, Zsófia M. Sztupinszki, Yongmei Chen, Claire Kuo, Lakshmi Ravindranath, Zoltan Szallasi, Gyorgy Petrovics, Taduru L. Sreenath, Albert Dobi, Inger L. Rosner, and et al. 2019. "RETRACTED: Analysis of PMEPA1 Isoforms (a and b) as Selective Inhibitors of Androgen and TGF-β Signaling Reveals Distinct Biological and Prognostic Features in Prostate Cancer" Cancers 11, no. 12: 1995. https://doi.org/10.3390/cancers11121995
APA StyleSharad, S., Sztupinszki, Z. M., Chen, Y., Kuo, C., Ravindranath, L., Szallasi, Z., Petrovics, G., Sreenath, T. L., Dobi, A., Rosner, I. L., Srinivasan, A., Srivastava, S., Cullen, J., & Li, H. (2019). RETRACTED: Analysis of PMEPA1 Isoforms (a and b) as Selective Inhibitors of Androgen and TGF-β Signaling Reveals Distinct Biological and Prognostic Features in Prostate Cancer. Cancers, 11(12), 1995. https://doi.org/10.3390/cancers11121995
