Targeting Autophagy for Cancer Treatment and Tumor Chemosensitization
Abstract
:1. Introduction
2. Autophagy Process and Regulation
3. Dual Role of Autophagy in Cancer
4. Therapeutic Strategies Targeting Autophagy
4.1. Autophagy Stimulation for Cancer Treatment
4.1.1. mTOR Inhibitors
4.1.2. BH3 Mimetics
4.1.3. Cannabinoids
4.1.4. Histone Deacetylase Inhibitors (HDACIs)
4.1.5. Natural Products
4.1.6. Others
4.2. Autophagy Inhibition for Cancer Treatment
4.2.1. ULK Inhibitors
4.2.2. Pan PI3K Inhibitors
4.2.3. VPS34 (PI3KC3) Complex Inhibitors
4.2.4. ATG inhibitors
4.2.5. Autophagosome Formation Inhibition
4.2.6. Lysosome Inhibitors
5. Autophagy Modulation for Tumor Sensitization to Anticancer Therapies
5.1. Autophagy Modulation to Overcome Radio-Resistance
5.2. Autophagy Modulation to Overcome Chemoresistance
6. Combination Therapy in Clinical Trials
7. Conclusions
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
Abbreviations
ACD | autophagic cell death |
AMPK | AMP-activated protein kinase |
ATG | Autophagy-related proteins |
ATG16L1 | Autophagy-related 16-like protein 1 |
BafA | Bafilomycin A |
BH3 | Bcl-2 Homology 3 |
BRAF | v-Raf murine sarcoma viral oncogene homolog B |
CMA | Chaperone Mediated Autophagy |
CB1 y 2 | Cannabinoid receptor 1 y 2 |
CCI779 | Cell Cycle Inhibitor 779 |
CML | Chronic Myeloid Leukemia |
CQ | Chloroquine |
CSC | Cancer stem cell |
DCMI | Desmethylclomipramine |
DQ | Dimeric quinacrine |
EGFR | Epidermal growth factor receptors |
ER | Endoplasmic reticulum |
FIP200 | RB1-inducible coiled-coil protein 1 |
FKBP12 | FK506-binding protein 12 |
GABARAP | γ-aminobutiric acid receptor-associated proteins |
HCQ | Hydroxychloroquine |
HDAC | Histone deacetylase |
HDACIs | Histone deacetylase inhibitors |
LAMP2 | Lysosome-associated membrane protein 2 |
LC3 | Microtubule-associated protein light chain 3 |
MQ | Mefloquine |
mTORC1 | Mammalian target of rapamycin complex 1 |
mTORC2 | Mammalian target of rapamycin complex 2 |
PE | Phosphatidylethanolamine |
PI3K | Phosphoinositide 3-kinase |
PI3KC1 | The class I phosphatidylinositol 3-kinase |
PI3KC3 | The class III phosphatidylinositol 3-kinase |
PtdIns3P | Phosphatidylinositol 3-phosphate |
ROS | Reactive oxygen species |
SAHA | Suberoylanilide hydroxamic acid |
SNAP29 | Synaptosomal-associated protein 29 |
SNARE | Soluble N-ethylmaleimide-sensitive factor activating protein receptor |
STX17 | Syntaxin 17 |
THC | Δ9-Tetrahydrocannabinol |
TK | Tyrosin Kinase |
TOR | Target of rapamycin |
TRB3 | Telomere repeat binding factor 3 |
ULK | (Unc)-51–Like Kinase proteins |
VPS15 | Vacuolar Protein Sorting 15 |
VPS34 | Vacuolar Protein Sorting 34 |
References
- Deter, R.L.; Baudhuin, P.; Duve, C. de Participation of lysosomes in cellular autophagy induced in rat liver by glucagon. J. Cell Biol. 1967, 35, 11–16. [Google Scholar] [CrossRef] [PubMed]
- Mizushima, N. Autophagy: Process and function. Genes Dev. 2007, 21, 2861–2873. [Google Scholar] [CrossRef] [PubMed]
- Mizushima, N.; Levine, B.; Cuervo, A.M.; Klionsky, D.J. Autophagy fights disease through cellular self-digestion. Nature 2008, 451, 1069–1075. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Dikic, I.; Elazar, Z. Mechanism and medical implications of mammalian autophagy. Nat. Rev. Mol. Cell Biol. 2018, 19, 349–364. [Google Scholar] [CrossRef]
- Chude, C.I.; Amaravadi, R.K. Targeting autophagy in cancer: Update on clinical trials and novel inhibitors. Int. J. Mol. Sci. 2017, 18, 1279. [Google Scholar] [CrossRef]
- U.S. National Library of Medicine of Clinical Trials. Available online: https://clinicaltrials.gov/ (accessed on 10 September 2019).
- White, E. The role for autophagy in cancer (White, 2015).pdf. J. Clin. Investig. 2015, 125, 42–46. [Google Scholar] [CrossRef]
- Galluzzi, L.; Baehrecke, E.H.; Ballabio, A.; Boya, P.; Bravo-San Pedro, J.M.; Cecconi, F.; Choi, A.M.; Chu, C.T.; Codogno, P.; Colombo, M.I.; et al. Molecular definitions of autophagy and related processes. EMBO J. 2017, 36, 1811–1836. [Google Scholar] [CrossRef]
- Li, W.W.; Li, J.; Bao, J.K. Microautophagy: Lesser-known self-eating. Cell. Mol. Life Sci. 2012, 69, 1125–1136. [Google Scholar] [CrossRef]
- Sahu, R.; Kaushik, S.; Clement, C.C.; Cannizzo, E.S.; Scharf, B.; Follenzi, A.; Potolicchio, I.; Nieves, E.; Cuervo, A.M.; Santambrogio, L. Microautophagy of Cytosolic Proteins by Late Endosomes. Dev. Cell 2011, 20, 131–139. [Google Scholar] [CrossRef] [Green Version]
- Kaushik, S.; Cuervo, A.M. Chaperone-mediated autophagy: A unique way to enter the lysosome world. Trends Cell Biol. 2012, 22, 407–417. [Google Scholar] [CrossRef]
- Xu, H.-M.; Hu, F. The role of autophagy and mitophagy in cancers. Arch. Physiol. Biochem. 2019, 1–9. [Google Scholar] [CrossRef] [PubMed]
- Tsukada, M.; Ohsumi, Y. Isolation and characterization of autophagy-defective mutants of Saccharomyces cerevisiae. FEBS 1993, 333, 169–174. [Google Scholar] [CrossRef]
- Zachari, M.; Ganley, I.G. The mammalian ULK1 complex and autophagy initiation. Essays Biochem. 2017, 61, 585–596. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Hosokawa, N.; Hara, T.; Kaizuka, T.; Kishi, C.; Takamura, A.; Miura, Y.; Iemura, S.; Natsume, T.; Takehana, K.; Yamada, N.; et al. Nutrient-dependent mTORC1 Association with the ULK1–Atg13–FIP200 Complex Required for Autophagy. Mol. Biol. Cell 2009, 20, 1981–1991. [Google Scholar] [CrossRef]
- Kim, J.; Kundu, M.; Viollet, B.; Guan, K.L. AMPK and mTOR regulate autophagy through direct phosphorylation of Ulk1. Nat. Cell Biol. 2011, 13, 132–141. [Google Scholar] [CrossRef] [Green Version]
- Noda, T.; Matsunaga, K.; Yoshimori, T. Atg14L recruits PtdIns 3-kinase to the ER for autophagosome formation. Autophagy 2011, 7, 438–439. [Google Scholar] [CrossRef] [Green Version]
- Lystad, A.H.; Carlsson, S.R.; de la Ballina, L.R.; Kauffman, K.J.; Nag, S.; Yoshimori, T.; Melia, T.J.; Simonsen, A. Distinct functions of ATG16L1 isoforms in membrane binding and LC3B lipidation in autophagy-related processes. Nat. Cell Biol. 2019, 21, 372–383. [Google Scholar] [CrossRef]
- Nguyen, T.N.; Padman, B.S.; Usher, J.; Oorschot, V.; Ramm, G.; Lazarou, M. Atg8 family LC3/GAB ARAP proteins are crucial for autophagosome-lysosome fusion but not autophagosome formation during PINK1/Parkin mitophagy and starvation. J. Cell Biol. 2016, 215, 857–874. [Google Scholar] [CrossRef]
- Hamasaki, M.; Furuta, N.; Matsuda, A.; Nezu, A.; Yamamoto, A.; Fujita, N.; Oomori, H.; Noda, T.; Haraguchi, T.; Hiraoka, Y.; et al. Autophagosomes form at ER-mitochondria contact sites. Nature 2013, 495, 389–393. [Google Scholar] [CrossRef]
- Nascimbeni, A.C.; Giordano, F.; Dupont, N.; Grasso, D.; Vaccaro, M.I.; Codogno, P.; Morel, E. ER–plasma membrane contact sites contribute to autophagosome biogenesis by regulation of local PI3P synthesis. EMBO J. 2017, 36, 2018–2033. [Google Scholar] [CrossRef]
- Itakura, E.; Kishi-Itakura, C.; Mizushima, N. The hairpin-type tail-anchored SNARE syntaxin 17 targets to autophagosomes for fusion with endosomes/lysosomes. Cell 2012, 151, 1256–1269. [Google Scholar] [CrossRef] [PubMed]
- Hubert, V.; Peschel, A.; Langer, B.; Gröger, M.; Rees, A.; Kain, R. LAMP-2 is required for incorporating syntaxin-17 into autophagosomes and for their fusion with lysosomes. Biol. Open 2016, 5, 1516–1529. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Karantza-Wadsworth, V.; Patel, S.; Kravchuk, O.; Chen, G.; Mathew, R.; Jin, S.; White, E. Autophagy mitigates metabolic stress and genome damage in mammary tumorigenesis. Genes Dev. 2007, 21, 1621–1635. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Jin, S.; White, E. Tumor suppression by autophagy through the management of metabolic stress. Autophagy 2008, 4, 563–566. [Google Scholar] [CrossRef] [Green Version]
- Liang, X.H.; Jackson, S.; Seaman, M.; Brown, K.; Kempkes, B.; Hibshoosh, H.; Levine, B. Induction of autophagy and inhibition of tumorigenesis by beclin 1. Nature 1999, 402, 672–676. [Google Scholar] [CrossRef]
- Qu, X.; Yu, J.; Bhagat, G.; Furuya, N.; Hibshoosh, H.; Troxel, A.; Rosen, J.; Eskelinen, E.; Mizushima, N.; Ohsumi, Y.; et al. Promotion of tumorigenesis by heterozygous disruption of the beclin 1 autophagy gene. J. Clin. Investig. 2003, 112, 1809–1820. [Google Scholar] [CrossRef] [Green Version]
- Takamura, A.; Komatsu, M.; Hara, T.; Sakamoto, A.; Kishi, C.; Waguri, S.; Eishi, Y.; Hino, O.; Tanaka, K.; Mizushima, N. Autophagy-deficient mice develop multiple liver tumors. Genes Dev. 2011, 25, 795–800. [Google Scholar] [CrossRef] [Green Version]
- Fulda, S. Autophagy in Cancer Therapy. Front. Oncol. 2017, 7, 1–4. [Google Scholar] [CrossRef]
- Denton, D.; Kumar, S. Autophagy-dependent cell death. Cell Death Differ. 2019, 26, 605–616. [Google Scholar] [CrossRef]
- Shimizu, S. Autophagic Cell Death and Cancer Chemotherapeutics. In Innovative Medicine; Nakao, K., Minato, N., Uemoto, S., Eds.; Springer: Tokyo, Japan, 2015; pp. 219–226. ISBN 978-4-431-55650-3. [Google Scholar] [Green Version]
- Michaud, M.; Martins, I.; Sukkurwala, A.Q.; Adjemian, S.; Ma, Y.; Pellegatti, P.; Shen, S.; Kepp, O.; Scoazec, M.; Mignot, G.; et al. Autophagy-Dependent Anticancer Immune Responses Induced by Chemotherapeutic Agents in Mice. Science (80-.). 2011, 334, 1573–1578. [Google Scholar] [CrossRef]
- Follo, C.; Cheng, Y.; Richards, W.G.; Bueno, R.; Broaddus, V.C. Autophagy facilitates the release of immunogenic signals following chemotherapy in 3D models of mesothelioma. Mol. Carcinog. 2019, 58, 1754–1769. [Google Scholar] [CrossRef] [PubMed]
- Shimgu, T.; Fujiwara, K.; Bogler, O.; Akiyama, Y.; Meritake, K.; Shinojima, N.; Tamacla, Y.; Yokoyama, T.; Kondo, S. Inhibition of autophagy at a late stage enhances imatinib-induced cytotoxicity In human malignant glioma cells. Int. J. Cancer 2009, 124, 1060–1071. [Google Scholar] [CrossRef] [PubMed]
- Liu, D.; Yang, Y.; Liu, Q.; Wang, J. Inhibition of autophagy by 3-MA potentiates cisplatin-induced apoptosis in esophageal squamous cell carcinoma cells. Med. Oncol. 2011, 28, 105–111. [Google Scholar] [CrossRef] [PubMed]
- Selvakumaran, M.; Amaravadi, R.K.; Vasilevskaya, I.A.; O’Dwyer, P.J. Autophagy inhibition sensitizes colon cancer cells to antiangiogenic and cytotoxic therapy. Clin. Cancer Res. 2013, 19, 2995–3007. [Google Scholar] [CrossRef] [PubMed]
- Zheng, L.; Li, H.; Mo, Y.; Qi, G.; Liu, B.; Zhao, J. Autophagy inhibition sensitizes LY3023414-induced anti-glioma cell activity in vitro and in vivo. Oncotarget 2017, 8, 98964–98973. [Google Scholar] [CrossRef] [PubMed]
- Guo, J.Y.; Xia, B.; White, E. Autophagy-Mediated tumor Promotion. Cell 2013, 155, 1216–1219. [Google Scholar] [CrossRef] [PubMed]
- Gammoh, N.; Fraser, J.; Puente, C.; Syred, H.M.; Kang, H.; Ozawa, T.; Lam, D.; Acosta, J.C.; Finch, A.J.; Holland, E.; et al. Suppression of autophagy impedes glioblastoma development and induces senescence. Autophagy 2016, 12, 1431–1439. [Google Scholar] [CrossRef]
- Guo, J.Y.; Chen, H.Y.; Mathew, R.; Fan, J.; Strohecker, A.M.; Karsli-Uzunbas, G.; Kamphorst, J.J.; Chen, G.; Lemons, J.M.S.; Karantza, V.; et al. Activated Ras requires autophagy to maintain oxidative metabolism and tumorigenesis. Genes Dev. 2011, 25, 460–470. [Google Scholar] [CrossRef] [Green Version]
- Yang, S.; Wang, X.; Contino, G.; Liesa, M.; Sahin, E.; Ying, H.; Bause, A.; Li, Y.; Stommel, J.M.; Dell’Antonio, G.; et al. Pancreatic cancers require autophagy for tumor growth. Genes Dev. 2011, 25, 717–729. [Google Scholar] [CrossRef] [Green Version]
- Vera-Ramirez, L.; Vodnala, S.K.; Nini, R.; Hunter, K.W.; Green, J.E. Autophagy promotes the survival of dormant breast cancer cells and metastatic tumour recurrence. Nat. Commun. 2018, 9. [Google Scholar] [CrossRef]
- Shi, H.; Zhang, L.; Zhang, C.; Hao, Y.; Zhao, X. Rapamycin may inhibit murine S180 sarcoma growth by regulating the pathways associated with autophagy and cancer stem cells. J. Cancer Res. Ther. 2019, 15, 398–403. [Google Scholar] [PubMed]
- Lin, X.; Han, L.; Weng, J.; Wang, K.; Chen, T. Rapamycin inhibits proliferation and induces autophagy in human neuroblastoma cells. Biosci. Rep. 2018, 38, 1–8. [Google Scholar] [CrossRef] [PubMed]
- Jiang, R.Y.; Pei, H.L.; Gu, W.D.; Huang, J.; Wang, Z.G. Autophagic inhibitor attenuates rapamycin-induced inhibition of proliferation in cultured A549 lung cancer cells. Eur. Rev. Med. Pharmacol. Sci. 2014, 18, 806–810. [Google Scholar] [PubMed]
- Xie, Z.G.; Xie, Y.; Dong, Q.R. Inhibition of the mammalian target of rapamycin leads to autophagy activation and cell death of MG63 osteosarcoma cells. Oncol. Lett. 2013, 6, 1465–1469. [Google Scholar] [CrossRef] [PubMed]
- Liu, W.; Huang, S.; Chen, Z.; Wang, H.; Wu, H.; Zhang, D. Temsirolimus, the mTOR inhibitor, induces autophagy in adenoid cystic carcinoma: In vitro and in vivo. Pathol. Res. Pract. 2014, 210, 764–769. [Google Scholar] [CrossRef] [PubMed]
- Singla, M.; Bhattacharyya, S. Autophagy as a potential therapeutic target during epithelial to mesenchymal transition in renal cell carcinoma: An in vitro study. Biomed. Pharmacother. 2017, 94, 332–340. [Google Scholar] [CrossRef]
- Chen, G.; Ding, X.-F.; Bouamar, H.; Pressley, K.; Sun, L.-Z. Everolimus induces G 1 cell cycle arrest through autophagy-mediated protein degradation of cyclin D1 in breast cancer cells. Am. J. Physiol. Physiol. 2019, 317, C244–C252. [Google Scholar] [CrossRef]
- Lui, A.; New, J.; Ogony, J.; Thomas, S.; Lewis-Wambi, J. Everolimus downregulates estrogen receptor and induces autophagy in aromatase inhibitor-resistant breast cancer cells. BMC Cancer 2016, 16, 1–15. [Google Scholar] [CrossRef] [Green Version]
- Chresta, C.M.; Davies, B.R.; Hickson, I.; Harding, T.; Cosulich, S.; Critchlow, S.E.; Vincent, J.P.; Ellston, R.; Jones, D.; Sini, P.; et al. AZD8055 is a potent, selective, and orally bioavailable ATP-competitive mammalian target of rapamycin kinase inhibitor with in vitro and in vivo antitumor activity. Cancer Res. 2010, 70, 288–298. [Google Scholar] [CrossRef]
- Hu, M.; Huang, H.; Zhao, R.; Li, P.; Li, M.; Miao, H.; Chen, N.; Chen, M. AZD8055 induces cell death associated with autophagy and activation of AMPK in hepatocellular carcinoma. Oncol. Rep. 2014, 31, 649–656. [Google Scholar] [CrossRef]
- Benvenuto, M.; Mattera, R.; Masuelli, L.; Taffera, G.; Andracchio, O.; Tresoldi, I.; Lido, P.; Giganti, M.G.; Godos, J.; Modesti, A.; et al. (±)-Gossypol induces apoptosis and autophagy in head and neck carcinoma cell lines and inhibits the growth of transplanted salivary gland cancer cells in BALB/c mice. Int. J. Food Sci. Nutr. 2017, 68, 298–312. [Google Scholar] [CrossRef] [PubMed]
- Benvenuto, M.; Mattera, R.; Sticca, J.I.; Rossi, P.; Cipriani, C.; Giganti, M.G.; Volpi, A.; Modesti, A.; Masuelli, L.; Bei, R. Effect of the BH3 mimetic polyphenol (-)-Gossypol (AT-101) on the in vitro and in vivo growth of malignant mesothelioma. Front. Pharmacol. 2018, 9, 1–13. [Google Scholar] [CrossRef] [PubMed]
- Lan, L.; Appelman, C.; Smith, A.R.; Yu, J.; Larsen, S.; Marquez, R.T.; Liu, H.; Wu, X.; Gao, P.; Roy, A.; et al. Natural product (-)-gossypol inhibits colon cancer cell growth by targeting RNA-binding protein Musashi-1. Mol. Oncol. 2015, 9, 1406–1420. [Google Scholar] [CrossRef] [PubMed]
- Voss, V.; Senft, C.; Lang, V.; Ronellenfitsch, M.W.; Steinbach, J.P.; Seifert, V.; Kögel, D. The pan-Bcl-2 inhibitor (-)-gossypol triggers autophagic cell death in malignant glioma. Mol. Cancer Res. 2010, 8, 1002–1016. [Google Scholar] [CrossRef]
- Sulkshane, P.; Teni, T. BH3 mimetic Obatoclax (GX15-070) mediates mitochondrial stress predominantly via MCL-1 inhibition and induces autophagy-dependent necroptosis in human oral cancer cells. Oncotarget 2017, 8, 60060–60079. [Google Scholar] [CrossRef]
- Basit, F.; Cristofanon, S.; Fulda, S. Obatoclax (GX15-070) triggers necroptosis by promoting the assembly of the necrosome on autophagosomal membranes. Cell Death Differ. 2013, 20, 1161–1173. [Google Scholar] [CrossRef] [Green Version]
- Bonapace, L.; Bornhauser, B.C.; Schmitz, M.; Cario, G.; Ziegler, U.; Niggli, F.K.; Schäfer, B.W.; Schrappe, M.; Stanulla, M.; Bourquin, J.P. Induction of autophagy-dependent necroptosis is required for childhood acute lymphoblastic leukemia cells to overcome glucocorticoid resistance. J. Clin. Investig. 2010, 120, 1310–1323. [Google Scholar] [CrossRef] [Green Version]
- Yao, X.; Li, X.; Zhang, D.; Xie, Y.; Sun, B.; Li, H.; Sun, L.; Zhang, X. B-cell lymphoma 2 inhibitor ABT-737 induces Beclin1- and reactive oxygen species-dependent autophagy in Adriamycin-resistant human hepatocellular carcinoma cells. Tumor Biol. 2017, 39, 1–12. [Google Scholar] [CrossRef]
- Armstrong, J.L.; Hill, D.S.; McKee, C.S.; Hernandez-Tiedra, S.; Lorente, M.; Lopez-Valero, I.; Anagnostou, M.E.; Babatunde, F.; Corazzari, M.; Redfern, C.P.F.; et al. Exploiting cannabinoid-induced cytotoxic autophagy to drive melanoma cell death. J. Investig. Dermatol. 2015, 135, 1629–1637. [Google Scholar] [CrossRef]
- Hernández-Tiedra, S.; Fabriàs, G.; Dávila, D.; Salanueva, Í.J.; Casas, J.; Montes, L.R.; Antón, Z.; García-Taboada, E.; Salazar-Roa, M.; Lorente, M.; et al. Dihydroceramide accumulation mediates cytotoxic autophagy of cancer cells via autolysosome destabilization. Autophagy 2016, 12, 2213–2229. [Google Scholar] [CrossRef] [Green Version]
- Salazar, M.; Carracedo, A.; Salanueva, Í.J.; Hernández-Tiedra, S.; Lorente, M.; Egia, A.; Vázquez, P.; Blázquez, C.; Torres, S.; García, S.; et al. Cannabinoid action induces autophagy-mediated cell death through stimulation of ER stress in human glioma cells. J. Clin. Investig. 2009, 119, 1359–1372. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Vara, D.; Salazar, M.; Olea-Herrero, N.; Guzmán, M.; Velasco, G.; Díaz-Laviada, I. Anti-tumoral action of cannabinoids on hepatocellular carcinoma: Role of AMPK-dependent activation of autophagy. Cell Death Differ. 2011, 18, 1099–1111. [Google Scholar] [CrossRef] [PubMed]
- Han, H.; Li, J.; Feng, X.; Zhou, H.; Guo, S.; Zhou, W. Autophagy-related genes are induced by histone deacetylase inhibitor suberoylanilide hydroxamic acid via the activation of cathepsin B in human breast cancer cells. Oncotarget 2017, 8, 53352–53365. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- De, U.; Son, J.Y.; Sachan, R.; Park, Y.J.; Kang, D.; Yoon, K.; Lee, B.M.; Kim, I.S.; Moon, H.R.; Kim, H.S. A new synthetic histone deacetylase inhibitor, MHY2256, induces apoptosis and autophagy cell death in endometrial cancer cells via p53 acetylation. Int. J. Mol. Sci. 2018, 19, 2743. [Google Scholar] [CrossRef]
- Zhou, H.; Luo, W.; Zeng, C.; Zhang, Y.; Wang, L.; Yao, W.; Nie, C. PP2A mediates apoptosis or autophagic cell death in multiple myeloma cell lines. Oncotarget 2017, 8, 80770–80789. [Google Scholar] [CrossRef] [Green Version]
- Fu, Y.; Chang, H.; Peng, X.; Bai, Q.; Yi, L.; Zhou, Y.; Zhu, J.; Mi, M. Resveratrol inhibits breast cancer stem-like cells and induces autophagy via suppressing Wnt/β-catenin signaling pathway. PLoS ONE 2014, 9, e102535. [Google Scholar] [CrossRef]
- Fontana, F.; Moretti, R.M.; Raimondi, M.; Marzagalli, M.; Beretta, G.; Procacci, P.; Sartori, P.; Montagnani Marelli, M.; Limonta, P. δ-Tocotrienol induces apoptosis, involving endoplasmic reticulum stress and autophagy, and paraptosis in prostate cancer cells. Cell Prolif. 2019, 52, 1–15. [Google Scholar] [CrossRef]
- Deng, Q.; Liang, L.; Liu, Q.; Duan, W.; Jiang, Y.; Zhang, L. Autophagy is a major mechanism for the dual effects of curcumin on renal cell carcinoma cells. Eur. J. Pharmacol. 2018, 826, 24–30. [Google Scholar] [CrossRef]
- Chen, Y.J.; Chi, C.W.; Su, W.C.; Huang, H.L. Lapatinib induces autophagic cell death and inhibits growth of human hepatocellular carcinoma. Oncotarget 2014, 5, 4845–4854. [Google Scholar] [CrossRef] [Green Version]
- Chen, Y.J.; Fang, L.W.; Su, W.C.; Hsu, W.Y.; Yang, K.C.; Huang, H.L. Lapatinib induces autophagic cell death and differentiation in acute myeloblastic leukemia. Onco. Targets. Ther. 2016, 9, 4453–4464. [Google Scholar]
- Ginet, V.; Puyal, J.; Rummel, C.; Aubry, D.; Breton, C.; Cloux, A.J.; Majjigapu, S.R.; Sordat, B.; Vogel, P.; Bruzzone, S.; et al. A critical role of autophagy in antileukemia/lymphoma effects of APO866, an inhibitor of NAD biosynthesis. Autophagy 2014, 10, 603–617. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Hua, H.; Kong, Q.; Zhang, H.; Wang, J.; Luo, T.; Jiang, Y. Targeting mTOR for cancer therapy. J. Hematol. Oncol. 2019, 12, 71. [Google Scholar] [CrossRef] [PubMed]
- Noda, T.; Ohsumi, Y. Tor, a phosphatidylinositol kinase homologue, controls autophagy in yeast. J. Biol. Chem. 1998, 273, 3963–3966. [Google Scholar] [CrossRef]
- Sehgal, S.N.; Baker, H.; Vézina, C. Rapamycin (Ay-22,989), a New Antifungal Antibiotic. II. Fermentation, Isolation and Characterization. J. Antibiot. (Tokyo). 1975, 28, 727–732. [Google Scholar] [CrossRef] [PubMed]
- Vézina, C.; Kudelski, A.; Sehgal, S.N. Rapamycin (AY 22,989) A NEW ANTIFUNGAL ANTIBIOTIC. J. Antibiot. (Tokyo). 1975, 28, 721–726. [Google Scholar] [CrossRef]
- Pattingre, S.; Espert, L.; Biard-Piechaczyk, M.; Codogno, P. Regulation of macroautophagy by mTOR and Beclin 1 complexes. Biochimie 2008, 90, 313–323. [Google Scholar] [CrossRef]
- Benjamin, D.; Colombi, M.; Moroni, C.; Hall, M.N. Rapamycin passes the torch: A new generation of mTOR inhibitors. Nat. Rev. Drug Discov. 2011, 10, 868–880. [Google Scholar] [CrossRef]
- Chiarini, F.; Evangelisti, C.; Lattanzi, G.; McCubrey, J.A.; Martelli, A.M. Advances in understanding the mechanisms of evasive and innate resistance to mTOR inhibition in cancer cells. Biochim. Biophys. Acta. Mol. Cell Res. 2019, 1866, 1322–1337. [Google Scholar] [CrossRef]
- Mao, B.; Gao, S.; Weng, Y.; Zhang, L.; Zhang, L. Design, synthesis, and biological evaluation of imidazo[1,2-b]pyridazine derivatives as mTOR inhibitors. Eur. J. Med. Chem. 2017, 129, 135–150. [Google Scholar] [CrossRef]
- Chen, Y.; Lee, C.H.; Tseng, B.Y.; Tsai, Y.H.; Tsai, H.W.; Yao, C.L.; Tseng, S.H. AZD8055 exerts antitumor effects on colon cancer cells by inhibiting mTOR and cell-cycle progression. Anticancer Res. 2018, 38, 1445–1454. [Google Scholar]
- Carew, J.S.; Kelly, K.R.; Nawrocki, S.T. Mechanisms of mTOR inhibitor resistance in cancer therapy. Target. Oncol. 2011, 6, 17–27. [Google Scholar] [CrossRef] [PubMed]
- Merino, D.; Kelly, G.L.; Lessene, G.; Wei, A.H.; Roberts, A.W.; Strasser, A. BH3-Mimetic Drugs: Blazing the Trail for New Cancer Medicines. Cancer Cell 2018, 34, 879–891. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Opydo-Chanek, M.; Gonzalo, O.; Marzo, I. Multifaceted anticancer activity of BH3 mimetics: Current evidence and future prospects. Biochem. Pharmacol. 2017, 136, 12–23. [Google Scholar] [CrossRef] [PubMed]
- Czabotar, P.E.; Lessene, G.; Strasser, A.; Adams, J.M. Control of apoptosis by the BCL-2 protein family: Implications for physiology and therapy. Nat. Rev. Mol. Cell Biol. 2014, 15, 49–63. [Google Scholar] [CrossRef]
- Liang, L.Z.; Ma, B.; Liang, Y.J.; Liu, H.C.; Zhang, T.H.; Zheng, G.S.; Su, Y.X.; Liao, G.Q. Obatoclax induces Beclin 1- and ATG5-dependent apoptosis and autophagy in adenoid cystic carcinoma cells. Oral Dis. 2015, 21, 470–477. [Google Scholar] [CrossRef]
- Koehler, B.C.; Jassowicz, A.; Scherr, A.L.; Lorenz, S.; Radhakrishnan, P.; Kautz, N.; Elssner, C.; Weiss, J.; Jaeger, D.; Schneider, M.; et al. Pan-Bcl-2 inhibitor Obatoclax is a potent late stage autophagy inhibitor in colorectal cancer cells independent of canonical autophagy signaling. BMC Cancer 2015, 15, 1–11. [Google Scholar] [CrossRef]
- Śledziński, P.; Zeyland, J.; Słomski, R.; Nowak, A. The current state and future perspectives of cannabinoids in cancer biology. Cancer Med. 2018, 7, 765–775. [Google Scholar] [CrossRef]
- Costa, L.; Amaral, C.; Teixeira, N.; Correia-Da-Silva, G.; Fonseca, B.M. Cannabinoid-induced autophagy: Protective or death role? Prostaglandins Other Lipid Mediat. 2016, 122, 54–63. [Google Scholar] [CrossRef]
- Mrakovcic, M.; Kleinheinz, J.; Fröhlich, L.F. Histone deacetylase inhibitor-induced autophagy in tumor cells: Implications for p53. Int. J. Mol. Sci. 2017, 18, 1883. [Google Scholar] [CrossRef]
- Newbold, A.; Falkenberg, K.J.; Prince, H.M.; Johnstone, R.W. How do tumor cells respond to HDAC inhibition? FEBS J. 2016, 283, 4032–4046. [Google Scholar] [CrossRef] [Green Version]
- Mrakovcic, M.; Bohner, L.; Hanisch, M.; Fröhlich, L.F. Epigenetic targeting of autophagy via HDAC inhibition in tumor cells: Role of p53. Int. J. Mol. Sci. 2018, 19, 3952. [Google Scholar] [CrossRef] [PubMed]
- Mann, B.S.; Johnson, J.R.; Cohen, M.H.; Justice, R.; Pazdur, R. FDA Approval Summary: Vorinostat for Treatment of Advanced Primary Cutaneous T-Cell Lymphoma. Oncologist 2007, 12, 1247–1252. [Google Scholar] [CrossRef] [PubMed]
- Wang, J.; Ren, X.R.; Piao, H.; Zhao, S.; Osada, T.; Premont, R.T.; Mook, R.A.; Morse, M.A.; Lyerly, H.K.; Chen, W. Niclosamide-induced Wnt signaling inhibition in colorectal cancer is mediated by autophagy. Biochem. J. 2019, 476, 535–546. [Google Scholar] [CrossRef] [PubMed]
- Lazarus, M.B.; Novotny, C.J.; Shokat, K.M. Structure of the human autophagy initiating kinase ULK1 in complex with potent inhibitors. ACS Chem. Biol. 2015, 10, 257–261. [Google Scholar] [CrossRef] [PubMed]
- Skah, S.; Richartz, N.; Duthil, E.; Gilljam, K.M.; Bindesbøll, C.; Naderi, E.H.; Eriksen, A.B.; Ruud, E.; Dirdal, M.M.; Simonsen, A.; et al. cAMP-mediated autophagy inhibits DNA damage-induced death of leukemia cells independent of p53. Oncotarget 2018, 9, 30434–30449. [Google Scholar] [CrossRef] [PubMed]
- Petherick, K.J.; Conway, O.J.L.; Mpamhanga, C.; Osborne, S.A.; Kamal, A.; Saxty, B.; Ganley, I.G. Pharmacological inhibition of ULK1 kinase blocks mammalian target of rapamycin (mTOR)-dependent autophagy. J. Biol. Chem. 2015, 290, 11376–11383. [Google Scholar] [CrossRef]
- Lu, J.; Zhu, L.; Zheng, L.P.; Cui, Q.; Zhu, H.H.; Zhao, H.; Shen, Z.J.; Dong, H.Y.; Chen, S.S.; Wu, W.Z.; et al. Overexpression of ULK1 Represents a Potential Diagnostic Marker for Clear Cell Renal Carcinoma and the Antitumor Effects of SBI-0206965. EBioMedicine 2018, 34, 85–93. [Google Scholar] [CrossRef] [Green Version]
- Dower, C.M.; Bhat, N.; Gebru, M.T.; Chen, L.; Wills, C.A.; Miller, B.A.; Wang, H.-G. Targeted Inhibition of ULK1 Promotes Apoptosis and Suppresses Tumor Growth and Metastasis in Neuroblastoma. Mol. Cancer Ther. 2018, 17, 2365–2376. [Google Scholar] [CrossRef] [Green Version]
- Tang, F.; Hu, P.; Yang, Z.; Xue, C.; Gong, J.; Sun, S.; Shi, L.; Zhang, S.; Li, Z.; Yang, C.; et al. SBI0206965, a novel inhibitor of Ulk1, suppresses non-small cell lung cancer cell growth by modulating both autophagy and apoptosis pathways. Oncol. Rep. 2017, 37, 3449–3458. [Google Scholar] [CrossRef] [Green Version]
- Egan, D.F.; Chun, M.G.H.; Vamos, M.; Zou, H.; Rong, J.; Miller, C.J.; Lou, H.J.; Raveendra-Panickar, D.; Yang, C.-C.; Sheffler, D.J.; et al. Small molecule inhibition of the autophagy kinase ULK1 and identification of ULK1 substrates. Mol. Cell 2015, 59, 285–297. [Google Scholar] [CrossRef]
- Martin, K.R.; Celano, S.L.; Solitro, A.R.; Gunaydin, H.; Scott, M.; O’Hagan, R.C.; Shumway, S.D.; Fuller, P.; MacKeigan, J.P. A Potent and Selective ULK1 Inhibitor Suppresses Autophagy and Sensitizes Cancer Cells to Nutrient Stress. iScience 2018, 8, 74–84. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Seglen, P.O.; Gordon, P.B. 3-Methyladenine: Specific inhibitor of autophagic/lysosomal protein degradation in isolated rat hepatocytes. Proc. Natl. Acad. Sci. USA 1982, 79, 1889–1892. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Wu, Y.T.; Tan, H.L.; Shui, G.; Bauvy, C.; Huang, Q.; Wenk, M.R.; Ong, C.N.; Codogno, P.; Shen, H.M. Dual role of 3-methyladenine in modulation of autophagy via different temporal patterns of inhibition on class I and III phosphoinositide 3-kinase. J. Biol. Chem. 2010, 285, 10850–10861. [Google Scholar] [CrossRef] [PubMed]
- Zou, Z.; Zhang, J.; Zhang, H.; Liu, H.; Li, Z.; Cheng, D.; Chen, J.; Liu, L.; Ni, M.; Zhang, Y.; et al. 3-Methyladenine can depress drug efflux transporters via blocking the PI3K-AKT-mTOR pathway thus sensitizing MDR cancer to chemotherapy. J. Drug Target. 2014, 22, 839–848. [Google Scholar] [CrossRef]
- Wu, Y.; Wang, X.; Guo, H.; Zhang, B.; Zhang, X.B.; Shi, Z.J.; Yu, L. Synthesis and screening of 3-MA derivatives for autophagy inhibitors. Autophagy 2013, 9, 595–603. [Google Scholar] [CrossRef] [Green Version]
- Powis, G.; Bonjouklian, R.; Berggren, M.M.; Gallegos, A.; Abraham, R.; Ashendel, C.; Zalkow, L.; Matter, W.F.; Dodge, J.; Grindey, G.; et al. Wortmannin, a Potent and Selective Inhibitor of Phosphatidylinositol-3-kinase. Cancer Res. 1994, 54, 2419–2423. [Google Scholar]
- Thelen, M.; Wymann, M.P.; Langen, H. Wortmannin binds specifically to 1-phosphatidylinositol 3-kinase while inhibiting guanine nucleotide-binding protein-coupled receptor signaling in neutrophil leukocytes. Proc. Natl. Acad. Sci. USA 1994, 91, 4960–4964. [Google Scholar] [CrossRef]
- Vlahos, C.J.; Matter, W.F.; Hui, K.Y.; Brown, R.F. A Specific Inhibitor of Phosphatidylinositol 3 Kinase, 2-(4-Morpholinyl)-8-phenyl-4H-1-benzopyran-4-one (LY294002). J. Biol. Chem. 1994, 269, 5241–5248. [Google Scholar]
- Garlich, J.R.; De, P.; Dey, N.; Jing, D.S.; Peng, X.; Miller, A.; Murali, R.; Lu, Y.; Mills, G.B.; Kundra, V.; et al. A vascular targeted pan phosphoinositide 3-kinase inhibitor prodrug, SF1126, with antitumor and antiangiogenic activity. Cancer Res. 2008, 68, 206–215. [Google Scholar] [CrossRef]
- Qin, A.; Li, Y.; Zhou, L.; Xing, C.; Lu, X. Dual PI3K-BRD4 Inhibitor SF1126 Inhibits Colorectal Cancer Cell Growth in Vitro and in Vivo. Cell. Physiol. Biochem. 2019, 52, 758–768. [Google Scholar] [Green Version]
- Ronan, B.; Flamand, O.; Vescovi, L.; Dureuil, C.; Durand, L.; Fassy, F.; Bachelot, M.F.; Lamberton, A.; Mathieu, M.; Bertrand, T.; et al. A highly potent and selective Vps34 inhibitor alters vesicle trafficking and autophagy. Nat. Chem. Biol. 2014, 10, 1013–1019. [Google Scholar] [CrossRef] [PubMed]
- Farkas, T.; Daugaard, M.; Jäättelä, M. Identification of small molecule inhibitors of phosphatidylinositol 3-kinase and autophagy. J. Biol. Chem. 2011, 286, 38904–38912. [Google Scholar] [CrossRef] [PubMed]
- Xie, J.; Li, Q.; Ding, X.; Gao, Y. GSK1059615 kills head and neck squamous cell carcinoma cells possibly via activating mitochondrial programmed necrosis pathway. Oncotarget 2017, 8, 50814–50823. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Bei, S.; Li, F.; Li, H.; Li, J.; Zhang, X.; Sun, Q.; Feng, L. Inhibition of gastric cancer cell growth by a PI3K-mTOR dual inhibitor GSK1059615. Biochem. Biophys. Res. Commun. 2019, 511, 13–20. [Google Scholar] [CrossRef] [PubMed]
- Bago, R.; Malik, N.; Munson, M.J.; Prescott, A.R.; Davies, P.; Sommer, E.; Shpiro, N.; Ward, R.; Cross, D.; Ganley, I.G.; et al. Characterization of VPS34-IN1, a selective inhibitor of Vps34, reveals that the phosphatidylinositol 3-phosphate-binding SGK3 protein kinase is a downstream target of class III phosphoinositide 3-kinase. Biochem. J. 2014, 463, 413–427. [Google Scholar] [CrossRef] [Green Version]
- Dowdle, W.E.; Nyfeler, B.; Nagel, J.; Elling, R.A.; Liu, S.; Triantafellow, E.; Menon, S.; Wang, Z.; Honda, A.; Pardee, G.; et al. Selective VPS34 inhibitor blocks autophagy and uncovers a role for NCOA4 in ferritin degradation and iron homeostasis in vivo. Nat. Cell Biol. 2014, 16, 1069–1079. [Google Scholar] [CrossRef]
- Pasquier, B.; El-Ahmad, Y.; Filoche-Rommé, B.; Dureuil, C.; Fassy, F.; Abecassis, P.Y.; Mathieu, M.; Bertrand, T.; Benard, T.; Barrière, C.; et al. Discovery of (2 S)-8-[(3 R)-3-Methylmorpholin-4-yl]-1-(3-methyl-2-oxobutyl)-2-(trifluoromethyl)-3,4-dihydro-2 H -pyrimido[1,2- a ]pyrimidin-6-one: A novel potent and selective inhibitor of Vps34 for the treatment of solid tumors. J. Med. Chem. 2015, 58, 376–400. [Google Scholar] [CrossRef]
- Liu, J.; Xia, H.; Kim, M.; Xu, L.; Li, Y.; Zhang, L.; Cai, Y.; Norberg, H.V.; Zhang, T.; Furuya, T.; et al. Beclin1 Controls the Levels of p53 by Regulating the Deubiquitination Activity of USP10 and USP13. Cell 2011, 147, 223–234. [Google Scholar] [CrossRef] [Green Version]
- Zhang, J.; Mao, S.; Wang, L.; Zhang, W.; Zhang, Z.; Guo, Y.; Wu, Y.; Yi, F.; Yao, X. MicroRNA-154 functions as a tumor suppressor in bladder cancer by directly targeting ATG7. Oncol. Rep. 2019, 41, 819–828. [Google Scholar] [CrossRef]
- Akin, D.; Wang, S.K.; Habibzadegah-Tari, P.; Law, B.; Ostrov, D.; Li, M.; Yin, X.M.; Kim, J.S.; Horenstein, N.; Dunn, W.A. A novel ATG4B antagonist inhibits autophagy and has a negative impact on osteosarcoma tumors. Autophagy 2014, 10, 2021–2035. [Google Scholar] [CrossRef]
- Liu, P.-F.; Hsu, C.-J.; Tseng, H.-H.; Wu, C.-H.; Shu, C.-W.; Tsai, K.-L.; Yang, L.-W.; Tsai, W.-L.; Cheng, J.-S.; Chang, H.-W.; et al. Drug repurposing screening identifies tioconazole as an ATG4 inhibitor that suppresses autophagy and sensitizes cancer cells to chemotherapy. Theranostics 2018, 8, 830–845. [Google Scholar] [CrossRef] [PubMed]
- Kurdi, A.; Cleenewerck, M.; Vangestel, C.; Lyssens, S.; Declercq, W.; Timmermans, J.P.; Stroobants, S.; Augustyns, K.; De Meyer, G.R.Y.; Van Der Veken, P.; et al. ATG4B inhibitors with a benzotropolone core structure block autophagy and augment efficiency of chemotherapy in mice. Biochem. Pharmacol. 2017, 138, 150–162. [Google Scholar] [CrossRef] [PubMed]
- Bosc, D.; Vezenkov, L.; Bortnik, S.; An, J.; Xu, J.; Choutka, C.; Hannigan, A.M.; Kovacic, S.; Loo, S.; Clark, P.G.K.; et al. A new quinoline-based chemical probe inhibits the autophagy-related cysteine protease ATG4B OPEN. Sci. Rep. 2018, 8, 11653. [Google Scholar] [CrossRef] [PubMed]
- Fu, Y.; Hong, L.; Xu, J.; Zhong, G.; Gu, Q.; Gu, Q.; Guan, Y.; Zheng, X.; Dai, Q.; Luo, X.; et al. Discovery of a small molecule targeting autophagy via ATG4B inhibition and cell death of colorectal cancer cells in vitro and in vivo. Autophagy 2019, 15, 295–311. [Google Scholar] [CrossRef] [PubMed]
- Qiu, Z.; Kuhn, B.; Aebi, J.; Lin, X.; Ding, H.; Zhou, Z.; Xu, Z.; Xu, D.; Han, L.; Liu, C.; et al. Discovery of Fluoromethylketone-Based Peptidomimetics as Covalent ATG4B (Autophagin-1) Inhibitors. ACS Med. Chem. Lett. 2016, 7, 802–806. [Google Scholar] [CrossRef] [Green Version]
- Xu, D.; Xu, Z.; Han, L.; Liu, C.; Zhou, Z.; Qiu, Z.; Lin, X.; Tang, G.; Shen, H.; Aebi, J.; et al. Identification of new ATG4B inhibitors based on a novel high-throughput screening platform. SLAS Discov. 2017, 22, 338–347. [Google Scholar] [CrossRef]
- Chu, J.; Fu, Y.; Xu, J.; Zheng, X.; Gu, Q.; Luo, X.; Dai, Q.; Zhang, S.; Liu, P.; Hong, L.; et al. ATG4B inhibitor FMK-9a induces autophagy independent on its enzyme inhibition. Arch. Biochem. Biophys. 2018, 644, 29–36. [Google Scholar] [CrossRef]
- Donohue, E.; Tovey, A.; Vogl, A.W.; Arns, S.; Sternberg, E.; Young, R.N.; Roberge, M. Inhibition of autophagosome formation by the benzoporphyrin derivative verteporfin. J. Biol. Chem. 2011, 286, 7290–7300. [Google Scholar] [CrossRef]
- Liu-Chittenden, Y.; Huang, B.; Shim, J.S.; Chen, Q.; Lee, S.-J.; Anders, R.A.; Liu, J.O.; Pan, D. Genetic and pharmacological disruption of the TEAD-YAP complex suppresses the oncogenic activity of YAP. Genes Dev. 2012, 26, 1300–1305. [Google Scholar] [CrossRef]
- Donohue, E.; Thomas, A.; Maurer, N.; Manisali, I.; Zeisser-Labouebe, M.; Zisman, N.; Anderson, H.J.; Ng, S.S.W.; Webb, M.; Bally, M.; et al. The Autophagy Inhibitor Verteporfin Moderately Enhances the Antitumor Activity of Gemcitabine in a Pancreatic Ductal Adenocarcinoma Model. J. Cancer 2013, 4, 585–596. [Google Scholar] [CrossRef] [Green Version]
- Lui, J.W.; Xiao, S.; Ogomori, K.; Hammarstedt, J.E.; Little, E.C.; Lang, D. The efficiency of verteporfin as a therapeutic option in pre-clinical models of melanoma. J. Cancer 2019, 10, 1–10. [Google Scholar] [CrossRef]
- Poole, B.; Ohkuma, S. Effect of weak bases on the intralysosomal pH in mouse peritoneal macrophages. J. Cell Biol. 1981, 90, 665–669. [Google Scholar] [CrossRef] [PubMed]
- Solomon, V.R.; Lee, H. Chloroquine and its analogs: A new promise of an old drug for effective and safe cancer therapies. Eur. J. Pharmacol. 2009, 625, 220–233. [Google Scholar] [CrossRef] [PubMed]
- Shi, T.T.; Yu, X.X.; Yan, L.J.; Xiao, H.T. Research progress of hydroxychloroquine and autophagy inhibitors on cancer. Cancer Chemother. Pharmacol. 2017, 79, 287–294. [Google Scholar] [CrossRef] [PubMed]
- McAfee, Q.; Zhang, Z.; Samanta, A.; Levi, S.M.; Ma, X.-H.; Piao, S.; Lynch, J.P.; Uehara, T.; Sepulveda, A.R.; Davis, L.E.; et al. Autophagy inhibitor Lys05 has single-agent antitumor activity and reproduces the phenotype of a genetic autophagy deficiency. Proc. Natl. Acad. Sci. USA 2012, 109, 8253–8258. [Google Scholar] [CrossRef] [Green Version]
- Baquero, P.; Dawson, A.; Mukhopadhyay, A.; Kuntz, E.M.; Mitchell, R.; Olivares, O.; Ianniciello, A.; Scott, M.T.; Dunn, K.; Nicastri, M.C.; et al. Targeting quiescent leukemic stem cells using second generation autophagy inhibitors. Leukemia 2019, 33, 981–994. [Google Scholar] [CrossRef]
- Rebecca, V.W.; Nicastri, M.C.; Mclaughlin, N.; Fennelly, C.; Ronghe, A.; Nofal, M.; Lim, C.; Witze, E.; Chude, C.I.; Zhang, G.; et al. A unified approach to targeting the lysosome’s degradative and growth signaling roles. Cancer Discov. 2017, 7, 1266–1283. [Google Scholar] [CrossRef]
- Goodall, M.L.; Wang, T.; Martin, K.R.; Kortus, M.G.; Kauffman, A.L.; Trent, J.M.; Gately, S.; MacKeigan, J.P. Development of potent autophagy inhibitors that sensitize oncogenic BRAF V600E mutant melanoma tumor cells to vemurafenib. Autophagy 2014, 10, 1120–1136. [Google Scholar] [CrossRef]
- Lam Yi, H.; Than, H.; Sng, C.; Cheong, M.A.; Chuah, C.; Xiang, W. Lysosome Inhibition by Mefloquine Preferentially Enhances the Cytotoxic Effects of Tyrosine Kinase Inhibitors in Blast Phase Chronic Myeloid Leukemia. Transl. Oncol. 2019, 12, 1221–1228. [Google Scholar] [CrossRef]
- Sharma, N.; Thomas, S.; Golden, E.B.; Hofman, F.M.; Chen, T.C.; Petasis, N.A.; Schönthal, A.H.; Louie, S.G. Inhibition of autophagy and induction of breast cancer cell death by mefloquine, an antimalarial agent. Cancer Lett. 2012, 326, 143–154. [Google Scholar] [CrossRef]
- Cheng, S.; Sliva, D. Ganoderma lucidum for cancer treatment: We are close but still not there. Integr. Cancer Ther. 2015, 14, 249–257. [Google Scholar] [CrossRef] [PubMed]
- Pan, H.; Wang, Y.; Na, K.; Wang, Y.; Wang, L.; Li, Z.; Guo, C.; Guo, D.; Wang, X. Autophagic flux disruption contributes to Ganoderma lucidum polysaccharide-induced apoptosis in human colorectal cancer cells via MAPK/ERK activation. Cell Death Dis. 2019, 10. [Google Scholar] [CrossRef] [PubMed]
- Wu, K.; Na, K.; Chen, D.; Wang, Y.; Pan, H.; Wang, X. Effects of non-steroidal anti-inflammatory drug-activated gene-1 on Ganoderma lucidum polysaccharides-induced apoptosis of human prostate cancer PC-3 cells. Int. J. Oncol. 2018, 53, 2356–2368. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Yamamoto, A.; Tagawa, Y.; Yoshimori, T.; Moriyama, Y.; Masaki, R.; Tashiro, Y. Bafilomycin Ai Prevents Maturation of Autophagic Vacuoles by Inhibiting Fusion between Autophagosomesand Lysosomesin Rat HepatomaCell Line. Cell Struct. Funct. 1998, 23, 33–42. [Google Scholar] [CrossRef] [PubMed]
- Bowman, E.J.; Siebers, A.; Altendorf, K. Bafilomycins; A class of inhibitors of membrane ATPases from microorganisms, animal cells, and plant cells. Proc. Natl. Acad. Sci. USA 1988, 85, 7972–7976. [Google Scholar] [CrossRef]
- Mauvezin, C.; Neufeld, T.P. Bafilomycin A1 disrupts autophagic flux by inhibiting both V-ATPase-dependent acidification and Ca-P60A/SERCA-dependent autophagosome-lysosome fusion. Autophagy 2015, 11, 1437–1438. [Google Scholar] [CrossRef] [Green Version]
- Rodilla, A.M.; Korrodi-Gregório, L.; Hernando, E.; Manuel-Manresa, P.; Quesada, R.; Pérez-Tomás, R.; Soto-Cerrato, V. Synthetic tambjamine analogues induce mitochondrial swelling and lysosomal dysfunction leading to autophagy blockade and necrotic cell death in lung cancer. Biochem. Pharmacol. 2017, 126, 23–33. [Google Scholar] [CrossRef] [Green Version]
- Grinde, B. Effect of carboxylic ionophores on lysosomal protein degradation in rat hepatocytes. Exp. Cell Res. 1983, 149, 27–35. [Google Scholar] [CrossRef]
- Busschaert, N.; Park, S.H.; Baek, K.H.; Choi, Y.P.; Park, J.; Howe, E.N.W.; Hiscock, J.R.; Karagiannidis, L.E.; Marques, I.; Félix, V.; et al. A synthetic ion transporter that disrupts autophagy and induces apoptosis by perturbing cellular chloride concentrations. Nat. Chem. 2017, 9, 667–675. [Google Scholar] [CrossRef]
- Sharma, G.; Guardia, C.M.; Roy, A.; Vassilev, A.; Saric, A.; Griner, L.N.; Marugan, J.; Ferrer, M.; Bonifacino, J.S.; DePamphilis, M.L. A family of PIKFYVE inhibitors with therapeutic potential against autophagy-dependent cancer cells disrupt multiple events in lysosome homeostasis. Autophagy 2019, 15, 1694–1718. [Google Scholar] [CrossRef]
- Lu, Y.; Dong, S.; Hao, B.; Li, C.; Zhu, K.; Guo, W.; Wang, Q.; Cheung, K.-H.; Wong, C.W.M.; Wu, W.-T.; et al. Vacuolin-1 potently and reversibly inhibits autophagosome-lysosome fusion by activating RAB5A. Autophagy 2014, 10, 1895–1905. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Rossi, M.; Munarriz, E.R.; Bartesaghi, S.; Milanese, M.; Dinsdale, D.; Guerra-Martin, M.A.; Bampton, E.T.W.; Glynn, P.; Bonanno, G.; Knight, R.A.; et al. Desmethylclomipramine induces the accumulation of autophagy markers by blocking autophagic flux. J. Cell Sci. 2009, 122, 3330–3339. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Libby, P.; Goldberg, A.L. Leupeptin, a protease inhibitor, decreases protein degradation in normal and diseased muscles. Science (80-. ). 1978, 199, 534–536. [Google Scholar] [CrossRef] [PubMed]
- Tanida, I.; Minematsu-Ikeguchi, N.; Ueno, T.; Kominami, E. Lysosomal turnover, but not a cellular level, of endogenous LC3 is a marker for autophagy. Autophagy 2005, 1, 84–91. [Google Scholar] [CrossRef]
- Stern, S.T.; Adiseshaiah, P.P.; Crist, R.M. Autophagy and lysosomal dysfunction as emerging mechanisms of nanomaterial toxicity. Part. Fibre Toxicol. 2012, 9, 20. [Google Scholar] [CrossRef]
- Ma, X.; Wu, Y.; Jin, S.; Tian, Y.; Zhang, X.; Zhao, Y.; Yu, L.; Liang, X.J. Gold nanoparticles induce autophagosome accumulation through size-dependent nanoparticle uptake and lysosome impairment. ACS Nano 2011, 5, 8629–8639. [Google Scholar] [CrossRef]
- Cui, Z.; Zhang, Y.; Xia, K.; Yan, Q.; Kong, H.; Zhang, J.; Zuo, X.; Shi, J.; Wang, L.; Zhu, Y.; et al. Nanodiamond autophagy inhibitor allosterically improves the arsenical-based therapy of solid tumors. Nat. Commun. 2018, 9, 4347. [Google Scholar] [CrossRef]
- Chen, S.; Wang, C.; Yeo, S.; Liang, C.C.; Okamoto, T.; Sun, S.; Wen, J.; Guan, J.L. Distinct roles of autophagy-dependent and -independent functions of FIP200 revealed by generation and analysis of a mutant knock-in mouse model. Genes Dev. 2016, 30, 856–869. [Google Scholar] [CrossRef] [Green Version]
- Mercer, C.A.; Kaliappan, A.; Dennis, P.B. A novel, human Atg13 binding protein, Atg101, interacts with ULK1 and is essential for macroautophagy. Autophagy 2009, 5, 649–662. [Google Scholar] [CrossRef] [Green Version]
- Lee, E.J.; Tournier, C. The requirement of uncoordinated 51-like kinase 1 (ULK1) and ULK2 in the regulation of autophagy. Autophagy 2011, 7, 689–695. [Google Scholar] [CrossRef] [Green Version]
- Chaikuad, A.; Koschade, S.E.; Stolz, A.; Zivkovic, K.; Pohl, C.; Shaid, S.; Ren, H.; Lambert, L.J.; Cosford, N.D.P.; Brandts, C.H.; et al. Conservation of structure, function and inhibitor binding in UNC-51-like kinase 1 and 2 (ULK1/2). Biochem. J. 2019, 2, BCJ20190038. [Google Scholar] [CrossRef] [PubMed]
- Yun, M.; Bai, H.Y.; Zhang, J.X.; Rong, J.; Weng, H.W.; Zheng, Z.S.; Xu, Y.; Tong, Z.T.; Huang, X.X.; Liao, Y.J.; et al. ULK1: A promising biomarker in predicting poor prognosis and therapeutic response in human nasopharygeal carcinoma. PLoS ONE 2015, 10, e0117375. [Google Scholar] [CrossRef] [PubMed]
- Zou, Y.; Chen, Z.; He, X.; He, X.; Wu, X.; Chen, Y.; Wu, X.; Wang, J.; Lan, P. High expression levels of unc-51-like kinase 1 as a predictor of poor prognosis in colorectal cancer. Oncol. Lett. 2015, 10, 1583–1588. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Jiang, S.; Li, Y.; Zhu, Y.H.; Wu, X.Q.; Tang, J.; Li, Z.; Feng, G.K.; Deng, R.; Li, D.D.; Luo, R.Z.; et al. Intensive expression of UNC-51-like kinase 1 is a novel biomarker of poor prognosis in patients with esophageal squamous cell carcinoma. Cancer Sci. 2011, 102, 1568–1575. [Google Scholar] [CrossRef] [PubMed]
- Dite, T.A.; Langendorf, C.G.; Hoque, A.; Galic, S.; Rebello, R.J.; Ovens, A.J.; Lindqvist, L.M.; Ngoei, K.R.W.; Ling, N.X.Y.; Furic, L.; et al. AMP-activated protein kinase selectively inhibited by the type II inhibitor SBI-0206965. J. Biol. Chem. 2018, 293, 8874–8885. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Lindmo, K. Regulation of membrane traffic by phosphoinositide 3-kinases. J. Cell Sci. 2006, 119, 605–614. [Google Scholar] [CrossRef] [Green Version]
- Liu, P.; Cheng, H.; Roberts, T.M.; Zhao, J.J. Targeting the phophoinositide 3-kinase(PI3K)pathway in cancer. Nat Rev Drug Discov 2009, 8, 627–644. [Google Scholar] [CrossRef]
- Leontieva, O.V.; Blagosklonny, M. V Gerosuppression by pan-mTOR inhibitors. Aging (Albany. NY). 2016, 8, 3535–3551. [Google Scholar] [CrossRef]
- Funderburk, S.F.; Wang, Q.J.; Yue, Z. Public Access NIH Public Access. Trends Cell Biol. 2010, 20, 355–362. [Google Scholar] [CrossRef]
- Valet, C.; Levade, M.; Chicanne, G.; Bilanges, B.; Cabou, C.; Viaud, J.; Gratacap, M.-P.; Gaits-Iacovoni, F.; Vanhaesebroeck, B.; Payrastre, B.; et al. A dual role for the class III PI3K, Vps34, in platelet production and thrombus growth. Blood 2017, 130, 2032–2042. [Google Scholar] [CrossRef] [Green Version]
- Tanida, I.; Sou, Y.S.; Ezaki, J.; Minematsu-Ikeguchi, N.; Ueno, T.; Kominami, E. HsAtg4B/HsApg4B/autophagin-1 cleaves the carboxyl termini of three human Atg8 homologues and delipidates microtubule-associated protein light chain 3- and GABAA receptor-associated protein-phospholipid conjugates. J. Biol. Chem. 2004, 279, 36268–36276. [Google Scholar] [CrossRef] [PubMed]
- Yu, Z.Q.; Ni, T.; Hong, B.; Wang, H.Y.; Jiang, F.J.; Zou, S.; Chen, Y.; Zheng, X.L.; Klionsky, D.J.; Liang, Y.; et al. Dual roles of Atg8—PE deconjugation by Atg4 in autophagy. Autophagy 2012, 8, 883–892. [Google Scholar] [CrossRef] [PubMed]
- Fu, Y.; Huang, Z.; Hong, L.; Lu, J.H.; Feng, D.; Yin, X.M.; Li, M. Targeting ATG4 in cancer therapy. Cancers 2019, 11, 649. [Google Scholar] [CrossRef] [PubMed]
- Tran, E.; Chow, A.; Goda, T.; Wong, A.; Blakely, K.; Rocha, M.; Taeb, S.; Hoang, V.C.; Liu, S.K.; Emmenegger, U. Context-dependent role of ATG4B as target for autophagy inhibition in prostate cancer therapy. Biochem. Biophys. Res. Commun. 2013, 441, 726–731. [Google Scholar] [CrossRef] [PubMed]
- Bortnik, S.; Choutka, C.; Horlings, H.M.; Leung, S.; Baker, J.H.E.; Lebovitz, C.; Dragowska, W.H.; Go, N.E.; Bally, M.B.; Minchinton, A.I.; et al. Identification of breast cancer cell subtypes sensitive to ATG4B inhibition. Oncotarget 2016, 7. [Google Scholar] [CrossRef] [PubMed]
- Donohue, E.; Balgi, A.D.; Komatsu, M.; Roberge, M. Induction of Covalently Crosslinked p62 Oligomers with Reduced Binding to Polyubiquitinated Proteins by the Autophagy Inhibitor Verteporfin. PLoS ONE 2014, 9, e114964. [Google Scholar] [CrossRef]
- Zhang, H.; Ramakrishnan, S.K.; Triner, D.; Centofanti, B.; Maitra, D.; Győrffy, B.; Sebolt-Leopold, J.S.; Dame, M.K.; Varani, J.; Brenner, D.E.; et al. Tumor-selective proteotoxicity of verteporfin inhibits colon cancer progression independently of YAP1. Sci. Signal. 2015, 8, ra98. [Google Scholar] [CrossRef]
- Ota, M.; Sasaki, H. Mammalian Tead proteins regulate cell proliferation and contact inhibition as transcriptional mediators of Hippo signaling. Development 2008, 135, 4059–4069. [Google Scholar] [CrossRef] [Green Version]
- Wei, H.; Wang, F.; Wang, Y.; Li, T.; Xiu, P.; Zhong, J.; Sun, X.; Li, J. Verteporfin suppresses cell survival, angiogenesis and vasculogenic mimicry of pancreatic ductal adenocarcinoma via disrupting the YAP-TEAD complex. Cancer Sci. 2017, 108, 478–487. [Google Scholar] [CrossRef]
- Melles, R.B.; Marmor, M.F. The risk of toxic retinopathy in patients on long-term hydroxychloroquine therapy. JAMA Ophthalmol. 2014, 132, 1453–1460. [Google Scholar] [CrossRef]
- Costedoat-Chalumeau, N.; Hulot, J.-S.; Amoura, Z.; Delcourt, A.; Maisonobe, T.; Dorent, R.; Bonnet, N.; Sablé, R.; Lechat, P.; Wechsler, B.; et al. Cardiomyopathy Related to Antimalarial Therapy with Illustrative Case Report. Cardiology 2007, 107, 73–80. [Google Scholar] [CrossRef] [PubMed]
- Marmor, M.F.; Kellner, U.; Lai, T.Y.Y.; Melles, R.B.; Mieler, W.F.; Lum, F. Recommendations on Screening for Chloroquine and Hydroxychloroquine Retinopathy (2016 Revision). Ophthalmology 2016, 123, 1386–1394. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Bristol, M.L.; Emery, S.M.; Maycotte, P.; Thorburn, A.; Chakradeo, S.; Gewirtz, D.A. Autophagy inhibition for chemosensitization and radiosensitization in cancer: Do the preclinical data support this therapeutic strategy? J. Pharmacol. Exp. Ther. 2013, 344, 544–552. [Google Scholar] [CrossRef] [PubMed]
- Bongiorno-Borbone, L.; Giacobbe, A.; Compagnone, M.; Eramo, A.; De Maria, R.; Peschiaroli, A.; Melino, G. Anti-tumoral effect of desmethylclomipramine in lung cancer stem cells. Oncotarget 2015, 6, 16926–16938. [Google Scholar] [CrossRef]
- Boya, P.; Casares, N.; Perfettini, J.; Dessen, P.; Larochette, N.; Métivier, D.; Meley, D.; Souquere, S.; Pierron, G.; Codogno, P.; et al. Inhibition of Macroautophagy Triggers Apoptosis. Mol. Cell. Biol. 2005, 25, 1025–1040. [Google Scholar] [CrossRef] [Green Version]
- Verbaanderd, C.; Maes, H.; Schaaf, M.B.; Sukhatme, V.P.; Pantziarka, P.; Sukhatme, V.; Agostinis, P.; Bouche, G. Repurposing drugs in oncology (ReDO)—Chloroquine and hydroxychloroquine as anti-cancer agents. Ecancermedicalscience 2017, 11, 1–35. [Google Scholar] [CrossRef]
- Piao, S.; Ojha, R.; Rebecca, V.W.; Samanta, A.; Ma, X.H.; Mcafee, Q.; Nicastri, M.C.; Buckley, M.; Brown, E.; Winkler, J.D.; et al. ALDH1A1 and HLTF modulate the activity of lysosomal autophagy inhibitors in cancer cells. Autophagy 2017, 13, 2056–2071. [Google Scholar] [CrossRef]
- Maycotte, P.; Aryal, S.; Ct, C.; Thorburn, J. Chloroquine sensitizes breast cancer cells to chemotherapy independent of autophagy. Autophagy 2012, 8, 200–212. [Google Scholar] [CrossRef] [Green Version]
- Eng, C.H.; Wang, Z.; Tkach, D.; Toral-Barza, L.; Ugwonali, S.; Liu, S.; Fitzgerald, S.L.; George, E.; Frias, E.; Cochran, N.; et al. Macroautophagy is dispensable for growth of KRAS mutant tumors and chloroquine efficacy. Proc. Natl. Acad. Sci. USA 2016, 113, 182–187. [Google Scholar] [CrossRef]
- Degtyarev, M.; De Mazière, A.; Orr, C.; Lin, J.; Lee, B.B.; Tien, J.Y.; Prior, W.W.; Van Dijk, S.; Wu, H.; Gray, D.C.; et al. Akt inhibition promotes autophagy and sensitizes PTEN-null tumors to lysosomotropic agents. J. Cell Biol. 2008, 183, 101–116. [Google Scholar] [CrossRef] [Green Version]
- Kwakye-Berko, F.; Meshnick, S.R. Binding of chloroquine to DNA. Mol. Biochem. Parasitol. 1989, 35, 51–55. [Google Scholar] [CrossRef]
- Loehberg, C.R.; Strissel, P.L.; Dittrich, R.; Strick, R.; Dittmer, J.; Dittmer, A.; Fabry, B.; Kalender, W.A.; Koch, T.; Wachter, D.L.; et al. Akt and p53 are potential mediators of reduced mammary tumor growth by Chloroquine and the mTOR inhibitor RAD001. Biochem. Pharmacol. 2012, 83, 480–488. [Google Scholar] [CrossRef] [PubMed]
- Enzenmüller, S.; Gonzalez, P.; Debatin, K.M.; Fulda, S. Chloroquine overcomes resistance of lung carcinoma cells to the dual PI3K/mTOR inhibitor PI103 by lysosome-mediated apoptosis. Anticancer. Drugs 2013, 24, 14–19. [Google Scholar] [CrossRef]
- Kroemer, G.; Jäättelä, M. Lysosomes and autophagy in cell death control. Nat. Rev. Cancer 2005, 5, 886–897. [Google Scholar] [CrossRef] [PubMed]
- Carew, J.S.; Nawrocki, S.T.; Kahue, C.N.; Zhang, H.; Yang, C.; Chung, L.; Houghton, J.A.; Huang, P.; Giles, F.J.; Cleveland, J.L. Targeting autophagy augments the anticancer activity of the histone deacetylase inhibitor SAHAto overcome Bcr-Abl-mediated drug resistance. Blood 2007, 110, 313–322. [Google Scholar] [CrossRef]
- Morgan, M.J.; Fitzwalter, B.E.; Owens, C.R.; Powers, R.K.; Sottnik, J.L.; Gamez, G.; Costello, J.C.; Theodorescu, D.; Thorburn, A. Metastatic cells are preferentially vulnerable to lysosomal inhibition. Proc. Natl. Acad. Sci. USA 2018, 115, E8479–E8488. [Google Scholar] [CrossRef]
- Fennelly, C.; Amaravadi, R.K. Lysosomal Biology in Cancer. Methods Mol Biol 2017, 1594, 293–308. [Google Scholar] [Green Version]
- Uhlman, A.; Folkers, K.; Liston, J.; Pancholi, H.; Hinton, A. Effects of Vacuolar H(+)-ATPase Inhibition on Activation of Cathepsin B and Cathepsin L Secreted from MDA-MB231 Breast Cancer Cells. Cancer Microenviron. 2017, 10, 49–56. [Google Scholar] [CrossRef]
- Balic, A.; Sørensen, M.D.; Trabulo, S.M.; Sainz, B.; Cioffi, M.; Vieira, C.R.; Miranda-Lorenzo, I.; Hidalgo, M.; Kleeff, J.; Erkan, M.; et al. Chloroquine Targets Pancreatic Cancer Stem Cells via Inhibition of CXCR4 and Hedgehog Signaling. Mol. Cancer Ther. 2014, 13, 1758–1771. [Google Scholar] [CrossRef]
- Maes, H.; Kuchnio, A.; Peric, A.; Moens, S.; Nys, K.; DeBock, K.; Quaegebeur, A.; Schoors, S.; Georgiadou, M.; Wouters, J.; et al. Tumor vessel normalization by chloroquine independent of autophagy. Cancer Cell 2014, 26, 190–206. [Google Scholar] [CrossRef]
- Mulcahy Levy, J.M.; Thompson, J.C.; Griesinger, A.M.; Amani, V.; Donson, A.M.; Birks, D.K.; Morgan, M.J.; Mirsky, D.M.; Handler, M.H.; Foreman, N.K.; et al. Autophagy Inhibition ImprovesChemosensitivity in BRAFV600E Brain Tumors. Cancer Discov 2014, 4, 773–780. [Google Scholar] [CrossRef] [PubMed]
- Kocaturk, N.M.; Akkoc, Y.; Kig, C.; Bayraktar, O.; Gozuacik, D.; Kutlu, O. Autophagy as a molecular target for cancer treatment. Eur. J. Pharm. Sci. 2019, 134, 116–137. [Google Scholar] [CrossRef] [PubMed]
- Huang, T.; Kim, C.K.; Alvarez, A.A.; Pangeni, R.P.; Wan, X.; Song, X.; Shi, T.; Yang, Y.; Sastry, N.; Horbinski, C.M.; et al. MST4 Phosphorylation of ATG4B Regulates Autophagic Activity, Tumorigenicity, and Radioresistance in Glioblastoma. Cancer Cell 2017, 32, 840–855.e8. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Wang, F.; Tang, J.; Li, P.; Si, S.; Yu, H.; Yang, X.; Tao, J.; Lv, Q.; Gu, M.; Yang, H.; et al. Chloroquine Enhances the Radiosensitivity of Bladder Cancer Cells by Inhibiting Autophagy and Activating Apoptosis. Cell. Physiol. Biochem. 2018, 45, 54–66. [Google Scholar] [CrossRef]
- Daido, S.; Yamamoto, A.; Fujiwara, K.; Sawaya, R.; Kondo, S.; Kondo, Y. Inhibition of the DNA-dependent protein kinase catalytic subunit radiosensitizes malignant glioma cells by inducing autophagy. Cancer Res. 2005, 65, 4368–4375. [Google Scholar] [CrossRef]
- Kim, K.W.; Hwang, M.; Moretti, L.; Jaboin, J.J.; Cha, Y.I.; Lu, B. Autophagy upregulation by inhibitors of caspase-3 and mTOR enhances radiotherapy in a mouse model of lung cancer. Autophagy 2008, 4, 659–668. [Google Scholar] [CrossRef] [Green Version]
- Chiu, H.W.; Yeh, Y.L.; Wang, Y.C.; Huang, W.J.; Ho, S.Y.; Lin, P.; Wang, Y.J. Combination of the novel histone deacetylase inhibitor YCW1 and radiation induces autophagic cell death through the downregulation of BNIP3 in triple-negative breast cancer cells in vitro and in an orthotopic mouse model. Mol. Cancer 2016, 15, 1–12. [Google Scholar] [CrossRef] [Green Version]
- Scott, K.A.; Dalgleish, A.G.; Liu, W.M. The combination of cannabidiol and Δ9-tetrahydrocannabinol enhances the anticancer effects of radiation in an orthotopic murine glioma model. Mol. Cancer Ther. 2014, 13, 2955–2967. [Google Scholar] [CrossRef]
- Keshmiri-Neghab, H.; Goliaei, B.; Nikoofar, A. Gossypol enhances radiation-induced autophagy in glioblastoma multiforme. Gen. Physiol. Biophys. 2014, 33, 433–442. [Google Scholar] [CrossRef]
- Saleh, T.; Cuttino, L.; Gewirtz, D.A. Autophagy is not uniformly cytoprotective: A personalized medicine approach for autophagy inhibition as a therapeutic strategy in non-small cell lung cancer. Biochim. Biophys. Acta. Gen. Subj. 2016, 1860, 2130–2136. [Google Scholar] [CrossRef]
- Chakradeo, S.; Sharma, K.; Alhaddad, A.; Bakhshwin, D.; Le, N.; Harada, H.; Nakajima, W.; Yeudall, W.A.; Torti, S.V.; Torti, F.M.; et al. Yet another function of p53—The switch that determines whether radiation-induced autophagy will be cytoprotective or nonprotective: Implications for autophagy inhibition as a therapeutic strategy. Mol. Pharmacol. 2015, 87, 803–814. [Google Scholar] [CrossRef] [PubMed]
- Singh, K.; Matsuyama, S.; Drazba, J.A.; Almasan, A. Autophagy-dependent senescence in response to DNA damage and chronic apoptotic stress. Autophagy 2012, 8, 236–251. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Chen, N.; Wu, L.; Yuan, H.; Wang, J. ROS/Autophagy/Nrf2 Pathway Mediated Low-Dose Radiation Induced Radio-Resistance in Human Lung Adenocarcinoma A549 Cell. Int. J. Biol. Sci. 2015, 11, 833–844. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kim, E.J.; Jeong, J.H.; Bae, S.; Kang, S.; Kim, C.H.; Lim, Y. Bin MTOR inhibitors radiosensitize PTEN-deficient non-small-cell lung cancer cells harboring an EGFR activating mutation by inducing autophagy. J. Cell. Biochem. 2013, 114, 1248–1256. [Google Scholar] [CrossRef]
- Ko, A.; Kanehisa, A.; Martins, I.; Senovilla, L.; Chargari, C.; Dugue, D.; Mariño, G.; Kepp, O.; Michaud, M.; Perfettini, J.L.; et al. Autophagy inhibition radiosensitizes in vitro, yet reduces radioresponses in vivo due to deficient immunogenic signalling. Cell Death Differ. 2014, 21, 92–99. [Google Scholar] [CrossRef]
- Jiang, G.-M.; Tan, Y.; Wang, H.; Peng, L.; Chen, H.-T.; Meng, X.-J.; Li, L.-L.; Liu, Y.; Li, W.-F.; Shan, H. The relationship between autophagy and the immune system and its applications for tumor immunotherapy. Mol. Cancer 2019, 18, 17. [Google Scholar] [CrossRef]
- Bhat, P.; Kriel, J.; Priya, B.S.; Shivananju, N.S.; Loos, B. Modulating autophagy in cancer therapy: Advancements and challenges for cancer cell death sensitization. Biochem. Pharmacol. 2018, 147, 170–182. [Google Scholar] [CrossRef]
- Choi, J.H.; Yoon, J.S.; Won, Y.W.; Park, B.B.; Lee, Y.Y. Chloroquine enhances the chemotherapeutic activity of 5-fluorouracil in a colon cancer cell line via cell cycle alteration. Apmis 2012, 120, 597–604. [Google Scholar] [CrossRef]
- Qin, L.; Xu, T.; Xia, L.; Wang, X.; Zhang, X.; Zhang, X.; Zhu, Z.; Zhong, S.; Wang, C.; Shen, Z. Chloroquine enhances the efficacy of cisplatin by suppressing autophagy in human adrenocortical carcinoma treatment. Drug Des. Devel. Ther. 2016, 10, 1035–1045. [Google Scholar] [Green Version]
- Gonçalves, R.M.; Agnes, J.P.; Delgobo, M.; de Souza, P.O.; Thomé, M.P.; Heimfarth, L.; Lenz, G.; Moreira, J.C.F.; Zanotto-Filho, A. Late autophagy inhibitor chloroquine improves efficacy of the histone deacetylase inhibitor SAHA and temozolomide in gliomas. Biochem. Pharmacol. 2019, 163, 440–450. [Google Scholar] [CrossRef]
- Hori, Y.S.; Hosoda, R.; Akiyama, Y.; Sebori, R.; Wanibuchi, M.; Mikami, T.; Sugino, T.; Suzuki, K.; Maruyama, M.; Tsukamoto, M.; et al. Chloroquine potentiates temozolomide cytotoxicity by inhibiting mitochondrial autophagy in glioma cells. J. Neurooncol. 2015, 122, 11–20. [Google Scholar] [CrossRef] [PubMed]
- Cufí, S.; Vazquez-Martin, A.; Oliveras-Ferraros, C.; Corominas-Faja, B.; Cuyàs, E.; López-Bonet, E.; Martin-Castillo, B.; Joven, J.; Menendez, J.A. The anti-malarial chloroquine overcomes Primary resistance and restores sensitivity to Trastuzumab in HER2-positive breast cancer. Sci. Rep. 2013, 3, 1–13. [Google Scholar] [CrossRef] [PubMed]
- Scott, A.J.; Arcaroli, J.J.; Bagby, S.M.; Yahn, R.; Huber, K.M.; Serkova, N.J.; Nguyen, A.; Kim, J.; Thorburn, A.; Vogel, J.; et al. Cabozantinib Exhibits Potent Antitumor Activity in Colorectal Cancer Patient-Derived Tumor Xenograft Models via Autophagy and Signaling Mechanisms. Mol. Cancer Ther. 2018, 17, 2112–2122. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Zhou, P.; Li, Y.; Li, B.; Zhang, M.; Xu, C.; Liu, F.; Bian, L.; Liu, Y.; Yao, Y.; Li, D. Autophagy inhibition enhances celecoxib-induced apoptosis in osteosarcoma. Cell Cycle 2018, 17, 997–1006. [Google Scholar] [CrossRef] [PubMed]
- Zhang, X.; Li, W.; Wang, C.; Leng, X.; Lian, S.; Feng, J.; Li, J.; Wang, H. Inhibition of autophagy enhances apoptosis induced by proteasome inhibitor bortezomib in human glioblastoma U87 and U251 cells. Mol. Cell. Biochem. 2014, 385, 265–275. [Google Scholar] [CrossRef]
- Xie, X.; White, E.P.; Mehnert, J.M. Coordinate Autophagy and mTOR Pathway Inhibition Enhances Cell Death in Melanoma. PLoS ONE 2013, 8, e55096. [Google Scholar] [CrossRef] [PubMed]
- Kaneko, M.; Nozawa, H.; Hiyoshi, M.; Tada, N.; Murono, K.; Nirei, T.; Emoto, S.; Kishikawa, J.; Iida, Y.; Sunami, E.; et al. Temsirolimus and chloroquine cooperatively exhibit a potent antitumor effect against colorectal cancer cells. J. Cancer Res. Clin. Oncol. 2014, 140, 769–781. [Google Scholar] [CrossRef]
- Avniel-Polak, S.; Leibowitz, G.; Doviner, V.; Gross, D.J.; Grozinsky-Glasberg, S. Combining Chloroquine with RAD001 Inhibits Tumor Growth in a NEN mouse model. Endocr. Relat. Cancer 2018, 25, 677–686. [Google Scholar] [CrossRef]
- Carew, J.S.; Medina, E.C.; Esquivel, J.A.; Mahalingam, D.; Swords, R.; Kelly, K.; Zhang, H.; Huang, P.; Mita, A.C.; Mita, M.M.; et al. Autophagy inhibition enhances vorinostat-induced apoptosis via ubiquitinated protein accumulation. J. Cell. Mol. Med. 2010, 14, 2448–2459. [Google Scholar] [CrossRef]
- Pasquier, B. SAR405, a PIK3C3/VPS34 inhibitor that prevents autophagy and synergizes with MTOR inhibition in tumor cells. Autophagy 2015, 11, 725–726. [Google Scholar] [CrossRef]
- Pinto-Leite, R.; Arantes-Rodrigues, R.; Ferreira, R.; Palmeira, C.; Colaço, A.; Moreira da Silva, V.; Oliveira, P.; Lara Santos, L. Temsirolimus improves cytotoxic efficacy of cisplatin and gemcitabine against urinary bladder cancer cell lines. Urol. Oncol. Semin. Orig. Investig. 2014, 32, 41.e11–41.e22. [Google Scholar] [CrossRef] [PubMed]
- Wang, H.W.; Yang, S.H.; Huang, G.D.; Lin, J.K.; Chen, W.S.; Jiang, J.K.; Lan, Y.T.; Lin, C.C.; Hwang, W.L.; Tzeng, C.H.; et al. Temsirolimus enhances the efficacy of cetuximab in colon cancer through a CIP2A-dependent mechanism. J. Cancer Res. Clin. Oncol. 2014, 140, 561–571. [Google Scholar] [CrossRef] [PubMed]
- Chen, P.; Huang, H.P.; Wang, Y.; Jin, J.; Long, W.G.; Chen, K.; Zhao, X.H.; Chen, C.G.; Li, J. Curcumin overcome primary gefitinib resistance in non-small-cell lung cancer cells through inducing autophagy-related cell death. J. Exp. Clin. Cancer Res. 2019, 38, 1–17. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ma, X.-H.; Piao, S.-F.; Dey, S.; McAfee, Q.; Karakousis, G.; Villanueva, J.; Hart, L.S.; Levi, S.; Hu, J.; Zhang, G.; et al. Targeting ER stress-induced autophagy overcomes BRAF inhibitor resistance in melanoma. J. Clin. Investig. 2014, 124, 1406–1417. [Google Scholar] [CrossRef] [PubMed]
- Zhang, H.; Ren, Y.; Cao, F.; Chen, J.; Chen, C.; Chang, J.; Hou, L.; Zhang, Z. In Situ Autophagy Disruption Generator for Cancer Theranostics. ACS Appl. Mater. Interfaces 2019, 11, 29641–29654. [Google Scholar] [CrossRef] [PubMed]
- Wang, Y.; Shi, K.; Zhang, L.; Hu, G.; Wan, J.; Tang, J.; Yin, S.; Duan, J.; Qin, M.; Wang, N.; et al. Significantly enhanced tumor cellular and lysosomal hydroxychloroquine delivery by smart liposomes for optimal autophagy inhibition and improved antitumor efficiency with liposomal doxorubicin. Autophagy 2016, 12, 949–962. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Wang, X.; Qiu, Y.; Yu, Q.; Li, H.; Chen, X.; Li, M.; Long, Y.; Liu, Y.; Lu, L.; Tang, J.; et al. Enhanced glioma therapy by synergistic inhibition of autophagy and tyrosine kinase activity. Int. J. Pharm. 2018, 536, 1–10. [Google Scholar] [CrossRef]
- Zhang, X.; Dong, Y.; Zeng, X.; Liang, X.; Li, X.; Tao, W.; Chen, H.; Jiang, Y.; Mei, L.; Feng, S.-S. The effect of autophagy inhibitors on drug delivery using biodegradable polymer nanoparticles in cancer treatment. Biomaterials 2014, 35, 1932–1943. [Google Scholar] [CrossRef]
- Zhang, X.; Yang, Y.; Liang, X.; Zeng, X.; Liu, Z.; Tao, W.; Xiao, X.; Chen, H.; Huang, L.; Mei, L. Enhancing therapeutic effects of docetaxel-loaded dendritic copolymer nanoparticles by co-treatment with autophagy inhibitor on breast cancer. Theranostics 2014, 4, 1085–1095. [Google Scholar] [CrossRef]
- Feng, Q.; Yang, X.; Hao, Y.; Wang, N.; Feng, X.; Hou, L.; Zhang, Z. Cancer Cell Membrane-Biomimetic Nanoplatform for Enhanced Sonodynamic Therapy on Breast Cancer via Autophagy Regulation Strategy. ACS Appl. Mater. Interfaces 2019, 11, 32729–32738. [Google Scholar] [CrossRef]
- Zhou, Z.; Yan, Y.; Hu, K.; Zou, Y.; Li, Y.; Ma, R.; Zhang, Q.; Cheng, Y. Autophagy inhibition enabled efficient photothermal therapy at a mild temperature. Biomaterials 2017, 141, 116–124. [Google Scholar] [CrossRef] [PubMed]
- Ren, X.; Chen, Y.; Peng, H.; Fang, X.; Zhang, X.; Chen, Q.; Wang, X.; Yang, W.; Sha, X. Blocking Autophagic Flux Enhances Iron Oxide Nanoparticle Photothermal Therapeutic Efficiency in Cancer Treatment. ACS Appl. Mater. Interfaces 2018, 10, 27701–27711. [Google Scholar] [CrossRef] [PubMed]
- Wolfram, J.; Nizzero, S.; Liu, H.; Li, F.; Zhang, G.; Li, Z.; Shen, H.; Blanco, E.; Ferrari, M. A chloroquine-induced macrophage-preconditioning strategy for improved nanodelivery. Sci. Rep. 2017, 7, 13738. [Google Scholar] [CrossRef] [PubMed]
- Lv, T.; Li, Z.; Xu, L.; Zhang, Y.; Chen, H.; Gao, Y. Chloroquine in combination with aptamer-modified nanocomplexes for tumor vessel normalization and efficient erlotinib/Survivin shRNA co-delivery to overcome drug resistance in EGFR-mutated non-small cell lung cancer. Acta Biomater. 2018, 76, 257–274. [Google Scholar] [CrossRef] [PubMed]
- Wang, P.; Burikhanov, R.; Jayswal, R.; Weiss, H.L.; Arnold, S.M.; Villano, J.L.; Rangnekar, V.M. Neoadjuvant administration of hydroxychloroquine in a phase 1 clinical trial induced plasma Par-4 levels and apoptosis in diverse tumors. Genes Cancer 2018, 9, 190–197. [Google Scholar] [PubMed] [Green Version]
- Wolpin, B.M.; Rubinson, D.A.; Wang, X.; Chan, J.A.; Cleary, J.M.; Enzinger, P.C.; Fuchs, C.S.; McCleary, N.J.; Meyerhardt, J.A.; Ng, K.; et al. Phase II and pharmacodynamic study of autophagy inhibition using hydroxychloroquine in patients with metastatic pancreatic adenocarcinoma. Oncologist 2014, 19, 637–638. [Google Scholar] [CrossRef] [PubMed]
- Goldberg, S.B.; Supko, J.G.; Neal, J.W.; Muzikansky, A.; Digumarthy, S.; Fidias, P.; Temel, J.S.; Heist, R.S.; Shaw, A.T.; McCarthy, P.O.; et al. A phase I study of erlotinib and hydroxychloroquine in advanced non-small-cell lung cancer. J. Thorac. Oncol. 2012, 7, 1602–1608. [Google Scholar] [CrossRef]
- Rangwala, R.; Leone, R.; Chang, Y.C.; Fecher, L.A.; Schuchter, L.M.; Kramer, A.; Tan, K.S.; Heitjan, D.F.; Rodgers, G.; Gallagher, M.; et al. Phase I trial of hydroxychloroquine with dose-intense temozolomide in patients with advanced solid tumors and melanoma. Autophagy 2014, 10, 1369–1379. [Google Scholar] [CrossRef] [Green Version]
- Vogl, D.T.; Stadtmauer, E.A.; Tan, K.S.; Heitjan, D.F.; Davis, L.E.; Pontiggia, L.; Rangwala, R.; Piao, S.; Chang, Y.C.; Scott, E.C.; et al. Combined autophagy and proteasome inhibition a phase 1 trial of hydroxychloroquine and bortezomib in patients with relapsed/refractory myeloma. Autophagy 2014, 10, 1380–1390. [Google Scholar] [CrossRef]
- Rosenfeld, M.R.; Ye, X.; Supko, J.G.; Desideri, S.; Grossman, S.A.; Brem, S.; Mikkelson, T.; Wang, D.; Chang, Y.C.; Hu, J.; et al. A phase I/II trial of hydroxychloroquine in conjunction with radiation therapy and concurrent and adjuvant temozolomide in patients with newly diagnosed glioblastoma multiforme. Autophagy 2014, 10, 1359–1368. [Google Scholar] [CrossRef]
- Sotelo, J.; Briceño, E.; López-González, M.A. Adding chloroquine to conventional treatment for glioblastoma multiforme: A randomized, double-blind, placebo-controlled trial. Ann. Intern. Med. 2006, 144, 337–343. [Google Scholar] [CrossRef] [PubMed]
- Briceño, E.; Reyes, S.; Sotelo, J. Therapy of glioblastoma multiforme improved by the antimutagenic chloroquine. Neurosurg. Focus 2003, 14, 2–7. [Google Scholar] [CrossRef]
- Rojas-Puentes, L.L.; Gonzalez-Pinedo, M.; Crismatt, A.; Ortega-Gomez, A.; Gamboa-Vignolle, C.; Nuñez-Gomez, R.; Dorantes-Gallareta, Y.; Arce-Salinas, C.; Arrieta, O. Phase II randomized, double-blind, placebo-controlled study of whole-brain irradiation with concomitant chloroquine for brain metastases. Radiat. Oncol. 2013, 8. [Google Scholar] [CrossRef] [PubMed]
- Mulcahy Levy, J.M.; Zahedi, S.; Griesinger, A.M.; Morin, A.; Davies, K.D.; Aisner, D.L.; Kleinschmidt-DeMasters, B.K.; Fitzwalter, B.E.; Goodall, M.L.; Thorburn, J.; et al. Autophagy inhibition overcomes multiple mechanisms of resistance to BRAF inhibition in brain tumors. Elife 2017, 6, 1–24. [Google Scholar] [CrossRef]
- Schelman, W.R.; Mohammed, T.A.; Traynor, A.M.; Kolesar, J.M.; Marnocha, R.M.; Eickhoff, J.; Keppen, M.; Alberti, D.B.; Wilding, G.; Takebe, N.; et al. A phase I study of AT-101 with cisplatin and etoposide in patients with advanced solid tumors with an expanded cohort in extensive-stage small cell lung cancer. Investig. New Drugs 2014, 32, 295–302. [Google Scholar] [CrossRef]
- Swiecicki, P.L.; Bellile, E.; Sacco, A.G.; Pearson, A.T.; Taylor, J.M.G.; Jackson, T.L.; Chepeha, D.B.; Spector, M.E.; Shuman, A.; Malloy, K.; et al. A phase II trial of the BCL-2 homolog domain 3 mimetic AT-101 in combination with docetaxel for recurrent, locally advanced, or metastatic head and neck cancer. Investig. New Drugs 2016, 34, 481–489. [Google Scholar] [CrossRef]
- Stein, M.N.; Hussain, M.; Stadler, W.M.; Liu, G.; Tereshchenko, I.V.; Goodin, S.; Jeyamohan, C.; Kaufman, H.L.; Mehnert, J.; Dipaola, R.S. A Phase II Study of AT-101 to Overcome Bcl-2-Mediated Resistance to Androgen Deprivation Therapy in Patients with Newly Diagnosed Castration-Sensitive Metastatic Prostate Cancer. Clin. Genitourin. Cancer 2016, 14, 22–27. [Google Scholar] [CrossRef]
- Munster, P.N.; Thurn, K.T.; Thomas, S.; Raha, P.; Lacevic, M.; Miller, A.; Melisko, M.; Ismail-Khan, R.; Rugo, H.; Moasser, M.; et al. A phase II study of the histone deacetylase inhibitor vorinostat combined with tamoxifen for the treatment of patients with hormone therapy-resistant breast cancer. Br. J. Cancer 2011, 104, 1828–1835. [Google Scholar] [CrossRef]
- Mahalingam, D.; Mita, M.; Sarantopoulos, J.; Wood, L.; Amaravadi, R.K.; Davis, L.E.; Mita, A.C.; Curiel, T.J.; Espitia, C.M.; Nawrocki, S.T.; et al. Combined autophagy and HDAC inhibition: A phase I safety, tolerability, pharmacokinetic, and pharmacodynamic analysis of hydroxychloroquine in combination with the HDAC inhibitor vorinostat in patients with advanced solid tumors. Autophagy 2014, 10, 1403–1414. [Google Scholar] [CrossRef]
- Margolin, K.; Longmate, J.; Baratta, T.; Synold, T.; Christensen, S.; Weber, J.; Gajewski, T.; Quirt, I.; Doroshow, J.H. CCI-779 in metastatic melanoma: A phase II trial of the California Cancer Consortium. Cancer 2005, 104, 1045–1048. [Google Scholar] [CrossRef]
- El-Chemaly, S.; Taveira-Dasilva, A.; Goldberg, H.J.; Peters, E.; Haughey, M.; Bienfang, D.; Jones, A.M.; Julien-Williams, P.; Cui, Y.; Villalba, J.A.; et al. Sirolimus and Autophagy Inhibition in Lymphangioleiomyomatosis: Results of a Phase I Clinical Trial. Chest 2017, 151, 1302–1310. [Google Scholar] [CrossRef] [PubMed]
- Chi, K.H.; Ko, H.L.; Yang, K.L.; Lee, C.Y.; Chi, M.S.; Kao, S.J. Addition of rapamycin and hydroxychloroquine to metronomic chemotherapy as a second line treatment results in high salvage rates for refractory metastatic solid tumors: A pilot safety and effectiveness analysis in a small patient cohort. Oncotarget 2015, 6, 16735–16745. [Google Scholar] [CrossRef] [PubMed]
- Rangwala, R.; Chang, Y.C.; Hu, J.; Algazy, K.M.; Evans, T.L.; Fecher, L.A.; Schuchter, L.M.; Torigian, D.A.; Panosian, J.T.; Troxel, A.B.; et al. Combined MTOR and autophagy inhibition: Phase I trial of hydroxychloroquine and temsirolimus in patients with advanced solid tumors and melanoma. Autophagy 2014, 10, 1391–1402. [Google Scholar] [CrossRef] [PubMed]
- Boone, B.A.; Murthy, P.; Miller-Ocuin, J.; Doerfler, W.R.; Ellis, J.T.; Liang, X.; Ross, M.A.; Wallace, C.T.; Sperry, J.L.; Lotze, M.T.; et al. Chloroquine reduces hypercoagulability in pancreatic cancer through inhibition of neutrophil extracellular traps. BMC Cancer 2018, 18, 678. [Google Scholar] [CrossRef] [PubMed]
- Miller-Ocuin, J.L.; Liang, X.; Boone, B.A.; Doerfler, W.R.; Singhi, A.D.; Tang, D.; Kang, R.; Lotze, M.T.; Zeh, H.J., 3rd. DNA released from neutrophil extracellular traps (NETs) activates pancreatic stellate cells and enhances pancreatic tumor growth. Oncoimmunology 2019, 8, e1605822. [Google Scholar] [CrossRef] [PubMed]
- Boone, B.A.; Bahary, N.; Zureikat, A.H.; Moser, A.J.; Normolle, D.P.; Wu, W.C.; Singhi, A.D.; Bao, P.; Bartlett, D.L.; Liotta, L.A.; et al. Safety and Biologic Response of Pre-operative Autophagy Inhibition in Combination with Gemcitabine in Patients with Pancreatic Adenocarcinoma. Ann. Surg. Oncol. 2015, 22, 4402–4410. [Google Scholar] [CrossRef] [PubMed]
- Chi, M.-S.; Lee, C.-Y.; Huang, S.-C.; Yang, K.-L.; Ko, H.-L.; Chen, Y.-K.; Chung, C.-H.; Liao, K.-W.; Chi, K.-H. Double autophagy modulators reduce 2-deoxyglucose uptake in sarcoma patients. Oncotarget 2015, 6, 29808–29817. [Google Scholar] [CrossRef] [Green Version]
- Tang, Y.; El-Chemaly, S.; Taveira-Dasilva, A.; Goldberg, H.J.; Bagwe, S.; Rosas, I.O.; Moss, J.; Priolo, C.; Henske, E.P. Metabolic Changes in Patients With Lymphangioleiomyomatosis Treated With Sirolimus and Hydroxychloroquine. Chest 2019. In press. [Google Scholar] [CrossRef]
- Lamattina, A.M.; Taveira-Dasilva, A.; Goldberg, H.J.; Bagwe, S.; Cui, Y.; Rosas, I.O.; Moss, J.; Henske, E.P.; El-Chemaly, S. Circulating Biomarkers From the Phase 1 Trial of Sirolimus and Autophagy Inhibition for Patients With Lymphangioleiomyomatosis. Chest 2018, 154, 1070–1082. [Google Scholar] [CrossRef]
- Bilger, A.; Bittner, M.-I.; Grosu, A.-L.; Wiedenmann, N.; Meyer, P.T.; Firat, E.; Niedermann, G.; Weber, W.A.; Milanović, D. FET-PET-based reirradiation and chloroquine in patients with recurrent glioblastomaFET-PET-basierte Rebestrahlung und Chloroquin bei Patienten mit rezidiviertem Glioblastom. Strahlentherapie und Onkol. 2014, 190, 957–961. [Google Scholar] [CrossRef]
- Eldredge, H.B.; DeNittis, A.; DuHadaway, J.B.; Chernick, M.; Metz, R.; Prendergast, G.C. Concurrent whole brain radiotherapy and short-course chloroquine in patients with brain metastases: A pilot trial. J. Radiat. Oncol. 2013, 2, 315–321. [Google Scholar] [CrossRef] [PubMed]
Mechanism of Action/Type | Name | Structure | Number in Figure 1 | Refs. |
---|---|---|---|---|
mTOR Inhibitors | Rapacmycin | | 1 | [43,44,45,46] |
Temsirolimus (CCI779) | | 2 | [47,48] | |
Everolimus (RAD001) | | 3 | [49,50] | |
AZD8055 | | 4 | [51,52] | |
BH3 Mimetics | (-)-gossypol (AT-101) | | 5 | [53,54,55,56] |
Obatoclax (GX15-070) | | 6 | [57,58,59] | |
ABT-737 | | 7 | [60] | |
Cannabinoids | Δ9-Tetrahydrocannabinol (THC) | | 8 | [61,62,63] |
JWH-015 | | 9 | [64] | |
Histone Deacetylase Inhibitors | Suberoylanilide hydroxamic acid (SAHA, Vorinostat) | | 10 | [65] |
MHY2256 | | 11 | [66] | |
Natural Products | Betulinic acid | | 12 | [67] |
Resveratrol | | 13 | [68] | |
δ-Tocotrienol | | 14 | [69] | |
Curcumin | | 15 | [70] | |
Others | Lapatinib | | 16 | [71,72] |
APO866 | | 17 | [73] |
Mechanism of Action | Name | Structure | Number in Figure 1 | Refs. | |
---|---|---|---|---|---|
ULK Inhibitors | Compound 6 | | 1 | [96] | |
MRT68921 | | 2 | [97,98] | ||
MRT67307 | | 3 | [97,98] | ||
SBI-0206965 | | 4 | [99,100,101,102] | ||
ULK-100 | | 5 | [103] | ||
ULK-101 | | 6 | [103] | ||
Pan PI3k Inhibitors | 3MA | | 7 | [104,105,106] | |
3 MA derivatives | | 8 | [107] | ||
Wortmannin | | 9 | [108,109] | ||
LY294002 | | 10 | [110] | ||
SF1126 | | 11 | [111,112] | ||
PI103 | | 12 | [113] | ||
KU55933 | | 13 | [114] | ||
Gö6976 | | 14 | [114] | ||
GSK1059615 | | 15 | [115,116] | ||
VPS34 (PI3KC3) Inhibitors | SAR405 | | 16 | [113] | |
VPS34-IN1 | | 17 | [117] | ||
PIK-III | | 18 | [118] | ||
Compound 31 | | 19 | [119] | ||
Spautin-1 | | 20 | [120] | ||
ATG Inhibitors | ATG7 inhibitor | | 21 | WO2018/089786 | |
ATG7 inhibitor, miR154 | UAGGUUAUCCGUGUUGCCUUCG | 22 | [121] | ||
NSC185058 | | 23 | [122] | ||
Tioconazol | | 24 | [123] | ||
UAMC-2526 | | 25 | [124] | ||
LV320 | | 26 | [125] | ||
S130 | | 27 | [126] | ||
FMK-9a | | 28 | [127,128,129] | ||
Autophagy Formation | Verteporfin | | 29 | [130,131,132,133] | |
Lysosome Inhibitors | Lysosomotropic Agents | Chloroquine | | 30 | [134,135] |
Hydroxychloroquine | | 31 | [136] | ||
Lys05 | | 32 | [137,138] | ||
DQ661 | | 33 | [139] | ||
VATG-027 | | 34 | [140] | ||
Mefloquine | | 35 | [141,142] | ||
Ganoderma lucidum polysaccharide (GLP) | 36 | [143,144,145] | |||
Vacuolar H+ ATPase Inhibitors | Bafilomycin A1 | | 37 | [146,147,148] | |
Ionophores | Tambjamines | | 38 | [149] | |
Monensin | | 39 | [150] | ||
Squaramides | | 40 | [151] | ||
Inhibition of Autophagosome-Lysosome Fusion | WX8 family | | 41 | [152] | |
Vacuolin-1 | | 42 | [153] | ||
Desmethylclomipramine | | 43 | [154] | ||
Acid Protease Inhibitors | Pepstatin A | | 44 | [155] | |
Leupeptin | | 45 | [155] | ||
E64d | | 46 | [156] | ||
Others | Nanoparticles | 47 | [157,158,159] |
Clinicaltrials.Gov ID | Treatment (Dose Per Day) | Autophagy Modulator | Condition | Study Phase | Result | Refs. |
---|---|---|---|---|---|---|
NCT01273805 | HCQ (1200 mg) | Inhibitor | Metastatic Pancreatic cancer | II | Lack of efficacy | [248] |
HCQ (800 mg) | Inhibitor | Early stage solid tumors | I | Autophagy inhibition, apoptosis | [247] | |
NCT00771056 | HCQ (400 mg) | Inhibitor | B-cell chronic lymphocytic leukemia | II | 50% efficacy. No adverse events | |
HCQ (1200 mg) + bortezomib | Inhibitor | Myeloma | I | Autophagy Inhibition. Moderate response | [251] | |
NCT00786682 | HCQ (400 mg) + docetaxel | Inhibitor | Prostate cancer | II | Terminated; lack of efficacy | |
NCT01649947 | HCQ (400 mg) + Paclitaxel + Carboplatin + Bevacizumab | Inhibitor | NSCLC | II | Evaluation of Bevacizumab addition to the drug cocktail | |
NCT01026844 | HCQ (1000 mg) + Erlotinib | Inhibitor | Advanced NSCLC | I | Safe but low efficacy | [249] |
NCT00977470 | HCQ (1000 mg) + Erlotinib | Inhibitor | Advanced NSCLC | II | Not completed; lack of efficacy | |
NCT01978184 | HCQ (1200 mg) + Gemcitabine + paclitaxel | Inhibitor | Pancreatic cancer | II | Moderate results | [266,267] |
NCT01128296 | HCQ (1200 mg) + Gemcitabine | Inhibitor | Pancreatic cancer (stage IIb III) | I–II | 65% Autophagy inhibition | [268] |
NCT00486603 | HCQ (600 mg) + Temozolomide + radiation | Inhibitor | Glioblastoma multiforme | I–II | Autophagy inhibition in 45–66%. 70% affected by serious adverse effects. Lack of efficacy | [252] |
HCQ (1200 mg) + Temozolomide | Inhibitor | Advanced solid tumors and melanoma | I | Autophagy inhibition. Moderate results | [250] | |
NCT01842594 | HCQ (400 mg) + Rapamycin | Inhibitor + Inducer | Sarcoma | II | Terminated; 60% partial response. | [269] |
NCT01687179 | HCQ (400 mg) + Rapamycin | Inhibitor + Inducer | Lymphaglioleiomyomatosis | I | Well tolerated. Limited response | [263,270,271] |
HCQ (1200 mg) + Temsirolimus | Inhibitor + Inducer | Advanced solid tumors and melanoma | I | Well tolerated, autophagy inhibition. Moderate response | [265] | |
HCQ (600 mg) + Vorinostat | Inhibitor + Inducer | Advanced solid tumors | I | Well tolerated, moderate response | [261] | |
HCQ (400 mg) + Rapamycin + metronomic conventional chemotherapy | Inhibitor + Inducer | Solid tumors | I | Encouraging results | [264] | |
CQ (150 mg) | Inhibitor | GBM | II | Encouraging results | [185] | |
CQ (150 mg) + Carmustine | Inhibitor | GBM | Limited response | [253] | ||
CQ (250 mg) + radiotherapy | Inhibitor | GBM | Pilot | Encouraging results (5 patients) | [272] | |
NCT01894633 | CQ (150 mg) + radiotherapy | Inhibitor | Brain metastais | II | Limited response | [255] |
CQ (250 mg) + radiotherapy | Inhibitor | Brain metastasis | Pilot | Well tolerated | [273] | |
CQ (150 mg) + vemurafenib | Inhibitor | BRAFV600E Brain tumor | Encouraging results (6 patients) | [203,256] | ||
NCT00365599 | Vorinostat (400 mg) + Tamoxifen | Inducer | hormone-therapy resistant breast cancer | II | Moderate response | [260] |
(-)-gossypol (80 mg) + cisplatin + etoposide | Inducer | SCLC | I | Encouraging results | [257] | |
(-)-gossypol (80 mg) + docetaxel | Inducer | Head and neck cancer | II | Lack of efficacy | [258] | |
NCT00666666 | (-)-gossypol (20 mg) + androgen deprivation therapy | Inducer | metastatic prostate cancer | II | Lack of efficacy | [259] |
© 2019 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Pérez-Hernández, M.; Arias, A.; Martínez-García, D.; Pérez-Tomás, R.; Quesada, R.; Soto-Cerrato, V. Targeting Autophagy for Cancer Treatment and Tumor Chemosensitization. Cancers 2019, 11, 1599. https://doi.org/10.3390/cancers11101599
Pérez-Hernández M, Arias A, Martínez-García D, Pérez-Tomás R, Quesada R, Soto-Cerrato V. Targeting Autophagy for Cancer Treatment and Tumor Chemosensitization. Cancers. 2019; 11(10):1599. https://doi.org/10.3390/cancers11101599
Chicago/Turabian StylePérez-Hernández, Marta, Alain Arias, David Martínez-García, Ricardo Pérez-Tomás, Roberto Quesada, and Vanessa Soto-Cerrato. 2019. "Targeting Autophagy for Cancer Treatment and Tumor Chemosensitization" Cancers 11, no. 10: 1599. https://doi.org/10.3390/cancers11101599
APA StylePérez-Hernández, M., Arias, A., Martínez-García, D., Pérez-Tomás, R., Quesada, R., & Soto-Cerrato, V. (2019). Targeting Autophagy for Cancer Treatment and Tumor Chemosensitization. Cancers, 11(10), 1599. https://doi.org/10.3390/cancers11101599