Prevalence, Genotypic and Phenotypic Characterization and Antibiotic Resistance Profile of Clostridium perfringens Type A and D Isolated from Feces of Sheep (Ovis aries) and Goats (Capra hircus) in Punjab, Pakistan
Abstract
1. Introduction
2. Results
2.1. Isolation and Identification of C. perfringens
2.2. Toxinotyping of Recovered C. perfringens Isolates
2.3. Antimicrobial Susceptibility Patterns
3. Discussion
4. Conclusions
5. Materials and Methods
5.1. Sample Site and Isolation Source
5.2. Isolation of C. perfringens
5.3. Molecular Typing of C. perfringens Through Multiplex PCR (mPCR)
5.4. Antimicrobial Susceptibility Testing
5.5. Criteria for Bacterial Inhibition
5.6. Statistical Analysis
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
References
- Ministry of Finance and Economic Affairs, Government of Pakistan. Pakistan Economic Survey 2018-19. Available online: http://www.finance.gov.pk/survey_1819.html (accessed on 12 January 2020).
- Devendra, C. Small ruminants in Asia; Contribution to food security, poverty alleviation and opportunities for productivity enhancement. In Proceedings of the International Workshop on Small Ruminant Production and Development in South East Asia, Ho Chi Minh City, Vietnam, 2–4 March 2005; pp. 19–32. [Google Scholar]
- Uzal, F.A.; Giannitti, F.; Finnie, J.W.; García, J.P. Diseases produced by Clostridium perfringens type D. In Clostridial Diseases of Animals; Wiley Blackwell: Ames, IA, USA, 2016; pp. 157–172. [Google Scholar]
- Radostits, O.M.; Gay, C.C.; Hinchcliff, K.W.; Constable, P.D. Veterinary Medicine E-Book: A Textbook of the Diseases of Cattle, Horses, Sheep, Pigs and Goats; Elsevier Health Sciences: Nothingam, UK, 2006. [Google Scholar]
- Stevens, D.L.; Aldape, M.J.; Bryant, A.E. Life-threatening clostridial infections. Anaerobe 2012, 18, 254–259. [Google Scholar] [CrossRef] [PubMed]
- Hill, K.K.; Smith, T.J. Genetic diversity within Clostridium botulinum serotypes, botulinum neurotoxin gene clusters and toxin subtypes. In Botulinum Neurotoxins; Springer: Los Alamos, NM, USA, 2012; pp. 1–20. [Google Scholar]
- Garcia, J.; Adams, V.; Beingesser, J.; Hughes, M.L.; Poon, R.; Lyras, D.; Hill, A.; McClane, B.A.; Rood, J.I.; Uzal, F.A. Epsilon toxin is essential for the virulence of Clostridium perfringens type D infection in sheep, goats, and mice. Infect. Immun. 2013, 81, 2405–2414. [Google Scholar] [CrossRef] [PubMed]
- Li, J.; Adams, V.; Bannam, T.L.; Miyamoto, K.; Garcia, J.P.; Uzal, F.A.; Rood, J.I.; McClane, B.A. Toxin plasmids of Clostridium perfringens. Microbiol. Mol. Biol. Rev. 2013, 77, 208–233. [Google Scholar] [CrossRef] [PubMed]
- Uzal, F.A.; Songer, J.G. Diagnosis of Clostridium perfringens intestinal infections in sheep and goats. J. Vet. Diagn. Investig. 2008, 20, 253–265. [Google Scholar] [CrossRef] [PubMed]
- Dray, T. Clostridium perfringens type A and type A and β2 toxin associated with enterotoxemia in a 5-week-old goat. Can. Vet. J. 2004, 45, 251. [Google Scholar] [PubMed]
- Lewis, C.J. Control of important clostridial diseases of sheep. Vet. Clin. Food Anim. Pract. 2011, 27, 121–126. [Google Scholar] [CrossRef]
- Alves, G.G.; de Ávila, R.A.M.; Chávez-Olórtegui, C.D.; Lobato, F.C.F. Clostridium perfringens epsilon toxin: The third most potent bacterial toxin known. Anaerobe 2014, 30, 102–107. [Google Scholar] [CrossRef]
- Bokori-Brown, M.; Savva, C.G.; da Costa, S.P.F.; Naylor, C.E.; Basak, A.K.; Titball, R.W. Molecular basis of toxicity of Clostridium perfringens epsilon toxin. FEBS J. 2011, 278, 4589–4601. [Google Scholar] [CrossRef]
- Uzal, F.A.; McClane, B.A.; Cheung, J.K.; Theoret, J.; Garcia, J.P.; Moore, R.J.; Rood, J.I. Animal models to study the pathogenesis of human and animal Clostridium perfringens infections. Vet. Microbiol. 2015, 179, 23–33. [Google Scholar] [CrossRef]
- Lindström, M.; Heikinheimo, A.; Lahti, P.; Korkeala, H. Novel insights into the epidemiology of Clostridium perfringens type A food poisoning. Food Microbiol. 2011, 28, 192–198. [Google Scholar] [CrossRef]
- Yadav, J.P.; Das, S.C.; Dhaka, P.; Vijay, D.; Kumar, M.; Mukhopadhyay, A.K.; Chowdhury, G.; Chauhan, P.; Singh, R.; Dhama, K. Molecular characterization and antimicrobial resistance profile of Clostridium perfringens type A isolates from humans, animals, fish and their environment. Anaerobe 2017, 47, 120–124. [Google Scholar] [CrossRef] [PubMed]
- Sarker, M.R.; Carman, R.J.; McClane, B.A. Inactivation of the gene (cpe) encoding Clostridium perfringens enterotoxin eliminates the ability of two cpe-positive C. perfringens type A human gastrointestinal disease isolates to affect rabbit ileal loops. Mol. Microbiol. 1999, 33, 946–958. [Google Scholar] [CrossRef] [PubMed]
- Bourlioux, P.; Koletzko, B.; Guarner, F.; Braesco, V. The intestine and its microflora are partners for the protection of the host: Report on the Danone Symposium “The Intelligent Intestine”, held in Paris, June 14, 2002. Am. J. Clin. Nutr. 2003, 78, 675–683. [Google Scholar] [CrossRef] [PubMed]
- Popoff, M.R.; Stiles, B.G. 17 Clostridial Toxins vs. Other Bacterial Toxins. In Handbook on Clostridia; Duerre, P., Ed.; Taylor&Francis Group: Boca Raton, FL, USA, 2005; p. 323. [Google Scholar]
- Kumar, N.V.; Sreenivasulu, D.; Reddy, Y. Prevalence of Clostridium perfringens toxin genotypes in enterotoxemia suspected sheep flocks of Andhra Pradesh. Vet. World 2014, 7, 1132–1136. [Google Scholar] [CrossRef]
- Labbé, R.G.; Juneja, V. Clostridium perfringens gastroenteritis. In Foodborne Infections and Intoxications; Elsevier: Amsterdam, The Netherlands, 2013; pp. 99–112. [Google Scholar]
- Hadimli, H.H.; Erganiş, O.; Sayin, Z.; Aras, Z. Toxinotyping of Clostridium perfringens isolates by ELISA and PCR from lambs suspected of enterotoxemia. Turk. J. Vet. Anim. Sci. 2012, 36, 409–415. [Google Scholar]
- Gajdács, M.; Spengler, G.; Urbán, E. Identification and antimicrobial susceptibility testing of anaerobic bacteria: Rubik’s cube of clinical microbiology? Antibiotics 2017, 6, 25. [Google Scholar] [CrossRef]
- Baums, C.G.; Schotte, U.; Amtsberg, G.; Goethe, R. Diagnostic multiplex PCR for toxin genotyping of Clostridium perfringens isolates. Vet. Microbiol. 2004, 100, 11–16. [Google Scholar] [CrossRef]
- Chukwu, E.E.; Nwaokorie, F.O.; Coker, A.O.; Avila-Campos, M.J.; Solis, R.L.; Llanco, L.A.; Ogunsola, F.T. Detection of toxigenic Clostridium perfringens and Clostridium botulinum from food sold in Lagos, Nigeria. Anaerobe 2016, 42, 176–181. [Google Scholar] [CrossRef]
- Crespo, R.; Fisher, D.J.; Shivaprasad, H.; Fernández-Miyakawa, M.E.; Uzal, F.A. Toxinotypes of Clostridium perfringens isolated from sick and healthy avian species. J. Vet. Diagn. Investig. 2007, 19, 329–333. [Google Scholar] [CrossRef]
- Lebrun, M.; Mainil, J.; Linden, A. Cattle enterotoxaemia and Clostridium perfringens: Description, diagnosis and prophylaxis. Vet. Rec. J. Br. Vet. Assoc. 2010, 167, 13–22. [Google Scholar] [CrossRef]
- Chandran, D.; Naidu, S.S.; Sugumar, P.; Rani, G.S.; Vijayan, S.P.; Mathur, D.; Garg, L.C.; Srinivasan, V.A. Development of a recombinant epsilon toxoid vaccine against enterotoxemia and its use as a combination vaccine with live attenuated sheep pox virus against enterotoxemia and sheep pox. Clin. Vaccine Immunol. 2010, 17, 1013–1016. [Google Scholar] [CrossRef] [PubMed]
- Khan, M.A.; Bahadar, S.; Ullah, N.; Ullah, S.; Shakeeb, U.; Khan, A.Z.; Khan, I.U.; Kalhoro, N.H.; Shah, M.B.; Malik, M.I.U. Distribution and antimicrobial resistance patterns of Clostridium Perfringens isolated from vaccinated and unvaccinated goats. Small Rumin. Res. 2019, 173, 70–73. [Google Scholar] [CrossRef]
- Marshall, B.M.; Levy, S.B. Food animals and antimicrobials: Impacts on human health. Clin. Microbiol. Rev. 2011, 24, 718–733. [Google Scholar] [CrossRef] [PubMed]
- Oliver, S.P.; Murinda, S.E.; Jayarao, B.M. Impact of antibiotic use in adult dairy cows on antimicrobial resistance of veterinary and human pathogens: A comprehensive review. Foodborne Pathog. Dis. 2011, 8, 337–355. [Google Scholar] [CrossRef] [PubMed]
- Greco, G.; Madio, A.; Buonavoglia, D.; Totaro, M.; Corrente, M.; Martella, V.; Buonavoglia, C. Clostridium perfringens toxin-types in lambs and kids affected with gastroenteric pathologies in Italy. Vet. J. 2005, 170, 346–350. [Google Scholar] [CrossRef] [PubMed]
- Kamber, U.; Gokce, H.; Elmali, M. Clostridium perfringens and its toxins in minced meat from Kars, Turkey. Food Addit. Contam. 2007, 24, 673–678. [Google Scholar] [CrossRef]
- Yoo, H.S.; Lee, S.U.; Park, K.Y.; Park, Y.H. Molecular typing and epidemiological survey of prevalence of Clostridium perfringens types by multiplex PCR. J. Clin. Microbiol. 1997, 35, 228–232. [Google Scholar] [CrossRef]
- Ahsani, M.; Mohammadabadi, M.; Shamsaddini, M. Clostridium perfringens isolate typing by multiplex PCR. J. Venom. Anim. Tox. Incl. Trop. Dis. 2010, 16, 573–578. [Google Scholar] [CrossRef]
- Costin, S. Regnum Prokaryotae. Available online: https://www.tgw1916.net/citation.html (accessed on 2 October 2012).
- Mohiuddin, M. Molecular Epidemiology of Clostridium Perfringens Isolated from Small Ruminants. Ph.D. Thesis, Isra University, Islamabad, Pakistan, 2016. [Google Scholar]
- Reed, R. Nitrate, nitrite and indole reactions of gas gangrene anaerobes. J. Bacteriol. 1942, 44, 425. [Google Scholar] [CrossRef]
- Itodo, A.; Adesiyun, A.; Adekeye, J.; Umoh, J. Toxin-types of Clostridium perfringens strains isolated from sheep, cattle and paddock soils in Nigeria. Vet. Microbiol. 1986, 12, 93–96. [Google Scholar] [CrossRef]
- Sipos, W.; Fischer, L.; Schindler, M.; Schmoll, F. Genotyping of Clostridium perfringens isolated from domestic and exotic ruminants and swine. J. Vet. Med. Ser. B 2003, 50, 360–362. [Google Scholar] [CrossRef] [PubMed]
- Uzal, F.; Marcellino, R. Clostridium perfringens in clinically healthy sheep of Patagonia, Argentina. In Proceedings of the 6th Biennial Congress of the Anaerobe Society of the Americas, Park City, UT, USA, 29 June–2 July 2002. [Google Scholar]
- Sobel, J.; Mixter, C.G.; Kolhe, P.; Gupta, A.; Guarner, J.; Zaki, S.; Hoffman, N.A.; Songer, J.G.; Fremont-Smith, M.; Fischer, M. Necrotizing enterocolitis associated with Clostridium perfringens type A in previously healthy North American adults. J. Am. Coll. Surg. 2005, 201, 48–56. [Google Scholar] [CrossRef] [PubMed]
- Omer, S.A.; Al-Olayan, E.M.; Babiker, S.E.H.; Aljulaifi, M.Z.; Alagaili, A.N.; Mohammed, O.B. Genotyping of Clostridium perfringens Isolates from Domestic Livestock in Saudi Arabia. BioMed Res. Int. 2020, 2020, 9035341. [Google Scholar] [CrossRef] [PubMed]
- van Asten, A.J.; Nikolaou, G.N.; Gröne, A. The occurrence of cpb2-toxigenic Clostridium perfringens and the possible role of the β2-toxin in enteric disease of domestic animals, wild animals and humans. Vet. J. 2010, 183, 135–140. [Google Scholar] [CrossRef] [PubMed]
- Mohiuddin, M.; Iqbal, Z.; Rahman, S.U. Prevalence of Clostridium perfringens β2-toxin in sheep and goat population in Punjab, Pakistan. Thai J. Vet. Med. 2016, 46, 491–496. [Google Scholar]
- Jabbari, A.; Tekyei, F.; Esmaelizad, M.; Pilehchian, L.R. Occurrence of Beta2 toxigenic Clostridium perfringens isolates with different toxin types in Iran. Arch. Razi Inst. 2012, 67, 133–137. [Google Scholar]
- Kalender, H.; Ertas, H.; Cetinkaya, B.; Muz, A.; Arslan, N.; Kilic, A. Typing of isolates of Clostridium perfringens from healthy and diseased sheep by multiplex PCR. Vet. Med. Praha 2005, 50, 439. [Google Scholar] [CrossRef]
- Grant, K.A.; Kenyon, S.; Nwafor, I.; Plowman, J.; Ohai, C.; Halford-Maw, R.; Peck, M.W.; McLauchlin, J. The identification and characterization of Clostridium perfringens by real-time PCR, location of enterotoxin gene, and heat resistance. Foodborne Pathog. Dis. 2008, 5, 629–639. [Google Scholar] [CrossRef]
- Özcan, C.; Gürçay, M. Enterotoxaemia incidence in small ruminants in Elazığ and the surrounding provinces in 1994–1998. Turk. J. Vet. Anim. Sci. 2000, 24, 283–286. [Google Scholar]
- Wang, G.; Zhou, J.; Zheng, F.; Lin, G.; Cao, X.; Gong, X.; Qiu, C. Detection of different genotypes of Clostridium perfringens in feces of healthy dairy cattle from China using real-time duplex PCR assay. Pak. Vet. J. 2011, 31, 120–124. [Google Scholar]
- Al-Humiany, A.A. Microbiological studies on enteritis caused by Clostridium perfringens type A, in sheep in Saudi Arabia. J. Appl. Sci. Res. 2012, 2012, 836–844. [Google Scholar]
- Chai, T.; Ma, R.; Chang, W.; Zhang, S. Spread and Pathogenic Mechanism of Clostridium perfringens. Chin. J. Prev. Vet. Med. 2001, 1, 70–72. [Google Scholar]
- Milton, A.A.P.; Agarwal, R.K.; Priya, G.B.; Saminathan, M.; Aravind, M.; Reddy, A.; Athira, C.; Ramees, T.; Sharma, A.K.; Kumar, A. Prevalence and molecular typing of Clostridium perfringens in captive wildlife in India. Anaerobe 2017, 44, 55–57. [Google Scholar] [CrossRef] [PubMed]
- Mohiuddin, M.; Mudasser, H.; Zahid, I.; Iftikhar, H. Immune response of rabbits to hemorrhagic septicemia vaccine formulations adjuvanted with montanide ISA-206, paraffin oil and alum. Asian J. Agri. Biol. 2012, 2, 161–167. [Google Scholar]
- Gharaibeh, S.; Al Rifai, R.; Al-Majali, A. Molecular typing and antimicrobial susceptibility of Clostridium perfringens from broiler chickens. Anaerobe 2010, 16, 586–589. [Google Scholar] [CrossRef]
- Silva, R.O.S.; Ferreira Junior, F.C.; Marques, M.V.R.; Oliveira Junior, C.A.; Martins, N.R.D.S.; Lobato, F.C.F. Genotyping and antimicrobial susceptibility of Clostridium perfringens isolated from Tinamidae, Cracidae and Ramphastidae species in Brazil. Ciência Rural 2014, 44, 486–491. [Google Scholar] [CrossRef]
- Salvarani, F.M.; Silva, R.O.S.; Pires, P.S.; Cruz Júnior, E.C.D.C.; Albefaro, I.S.; Guedes, R.M.D.C.; Lobato, F.C.F. Antimicrobial susceptibility of Clostridium perfringens isolated from piglets with or without diarrhea in Brazil. Braz. J. Microbiol. 2012, 43, 1030–1033. [Google Scholar] [CrossRef]
- Tansuphasiri, U.; Matra, W.; Sangsuk, L. Antimicrobial resistance among Clostridium perfringens isolated from various sources in Thailand. Southeast Asian J. Trop. Med. Public Health 2005, 36, 954–961. [Google Scholar]
- Citron, D.M.; Tyrrell, K.L.; Merriam, C.V.; Goldstein, E.J. Comparative in vitro activities of LFF571 against Clostridium difficile and 630 other intestinal strains of aerobic and anaerobic bacteria. Antimicrob. Agents Chemother. 2012, 56, 2493–2503. [Google Scholar] [CrossRef]
- Gholamiandehkordi, A.; Eeckhaut, V.; Lanckriet, A.; Timbermont, L.; Bjerrum, L.; Ducatelle, R.; Haesebrouck, F.; Van Immerseel, F. Antimicrobial resistance in Clostridium perfringens isolates from broilers in Belgium. Vet. Res. Commun. 2009, 33, 1031–1037. [Google Scholar] [CrossRef]
- Johansson, A.; Greko, C.; Engström, B.; Karlsson, M. Antimicrobial susceptibility of Swedish, Norwegian and Danish isolates of Clostridium perfringens from poultry, and distribution of tetracycline resistance genes. Vet. Microbiol. 2004, 99, 251–257. [Google Scholar] [CrossRef] [PubMed]
- Gad, W.; Hauck, R.; Krüger, M.; Hafez, H. Prevalence of Clostridium perfringens in commercial turkey and layer flocks. Arch. Geflkd 2011, 75, 74–79. [Google Scholar]
- Behra-Miellet, J.; Calvet, L.; Dubreuil, L. Activity of linezolid against anaerobic bacteria. Int. J. Antimicrob. Agents 2003, 22, 28–34. [Google Scholar] [CrossRef]
- Miranda, C.; Rojo, M.D. Clostridium Perfringens: Infecciones de Piel y Tejidos Blandos. 2010. Available online: https://www.seimc.org/Contenidos/Ccs/Revisionestematicas/Bacteriologia/Clostper.Pdf (accessed on 12 October 2020).
- Bailey, M. The Development and Use of Multiplex PCR Protocols for the Detection of Clostridium Perfringens Toxin Encoding Genes Cpa, Cpb, Etx, Ia, Cpe, NetB, and TpeL. Master‘s Thesis, Auburn University, Auburn, AL, USA, 2013. [Google Scholar]
- Ferrarezi, M.C.; Cardoso, T.C.; Dutra, I.S. Genotyping of Clostridium perfringens isolated from calves with neonatal diarrhea. Anaerobe 2008, 14, 328–331. [Google Scholar] [CrossRef] [PubMed]
- Guran, H.S.; Vural, A.; Erkan, M.E. The prevalence and molecular typing of Clostridium perfringens in ground beef and sheep meats. J. Für Verbrauch. Und Lebensm. 2014, 9, 121–128. [Google Scholar] [CrossRef]
- Hudzicki, J. Kirby-Bauer disk diffusion susceptibility test protocol. Am. Soc. Microbiol. 2009, 2009, 1–23. [Google Scholar]
- Debalke, D.; Birhan, M.; Kinubeh, A.; Yayeh, M. Assessments of Antibacterial Effects of Aqueous-Ethanolic Extracts of Sida rhombifolia’s Aerial Part. Sci. World J. 2018, 2018, 8429809. [Google Scholar] [CrossRef]
- Hafidh, R.R.; Abdulamir, A.S.; Vern, L.S.; Bakar, F.A.; Abas, F.; Jahanshiri, F.; Sekawi, Z. Inhibition of Growth of Highly Resistant Bacterial and Fungal Pathogens by a Natural Product. Open Microbiol. J. 2011, 5, 96–106. [Google Scholar] [CrossRef]
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |


| Groups | Carbohydrate Fermentation | |||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Clostridium perfringens | Glucose | Mannitol | Lactose | Sucrose | Maltose | Salicin | Xylose | Arabinose | Glycerol | Cellobiose | Mannose | Melezitose | Raffinose | Sorbitol | Rhamnose | Trehalose |
| Group I isolates | + | − | + | + | + | − | − | − | + | − | + | − | − | − | − | + |
| Group II isolates | + | − | + | + | + | − | − | − | − | − | + | − | − | − | − | + |
| Group III isolates | + | − | + | + | + | − | − | − | − | − | + | − | + | − | − | + |
| Group IV isolates | + | − | + | + | + | − | − | − | + | − | + | − | + | − | − | + |
| Esculin positive isolates (2%) | + | − | + | + | + | − | − | − | + | − | + | − | − | − | − | + |
| Indole positive isolate (<1%) | + | − | + | + | + | − | − | − | + | − | + | − | − | − | − | + |
| Microorganism | Egg Yolk Agar | Biochemical Tests | |||||
|---|---|---|---|---|---|---|---|
| Clostridium perfringens | Lecithinase Production | Lipase Production | Gelatin Hydrolysis | Indole Production | Urease Test | Esculin Hydrolysis | Catalase Test |
| Group I, II, III, IV isolates | + | − | + | − | − | − | − |
| Esculin positive isolates (2%) | + | − | + | − | − | + | − |
| Indole positive isolate (<1%) | + | − | + | + | − | − | − |
| S. No. | Toxin Gene of C. perfringens | C. perfringens Type | Positive Cases | Total Fecal Samples Collected | Animal |
|---|---|---|---|---|---|
| 1. | Alpha, epsilon, beta2 | A | 65 (Diseased 42 + Healthy 23) | 148 | Goat |
| Aβ2 | |||||
| D | |||||
| D β2 | |||||
| 2. | Alpha, epsilon, beta2 | A | 119 (Diseased 76 + Healthy 43) | 251 | Sheep |
| Aβ2 | |||||
| D | |||||
| D β2 |
| Positive Gene(s) | Isolate Population | |
|---|---|---|
| Healthy (n = 68) | Diseased (n = 116) | |
| cpa (Type A) * | 40 (59%) | 31 (27%) |
| cpa, cpb2 (Type A, cpb2) * | 23 (34%) | 57 (49%) |
| cpa, etx (Type D) | 3 (4%) | 11 (9%) |
| cpa, etx, cpb2 (Type D, cpb2) | 2 (3%) | 17 (15%) |
| Antibiotics | Number of Strains of Clostridium perfringens with Percentage of Inhibition | |||
|---|---|---|---|---|
| Significant Susceptibility (>70% Inhibition) | Good Susceptibility (60–70% Inhibition) | Moderate Susceptibility (40–60% Inhibition) | Resistant (≤40% Inhibition) | |
| Tetracycline (30 µg) | 26/184(14%) | 00 | 26/184(14%) | 132/184(72%) |
| Teicoplanin (30 µg) | 105/184(57%) | 53/184(29%) | 26/184(14%) | 00 |
| Enrofloxacin (5 µg) | 105/184(57%) | 79/184(43%) | 00 | 00 |
| Chloramphenicol (30 µg) | 105/184(57%) | 26/184(14%) | 53/184(29%) | 00 |
| Rifampin (5 µg) | 184/184(100%) | 00 | 00 | 00 |
| Amoxicillin (10 µg) | 105/184(57%) | 79/184(43%) | 00 | 00 |
| Penicillin G (10 µg) | 184/184(100%) | 00 | 00 | 00 |
| Ceftiofur (30 µg) | 184/184(100%) | 00 | 00 | 00 |
| Ciprofloxacin (5 µg) | 79/184(43%) | 53/184(29%) | 52/184(28%) | 00 |
| Erythromycin (15 µg) | 26/184(14%) | 132/184(72%) | 26/184(14%) | 00 |
| Norfloxacin (10 µg) | 00 | 00 | 184/184(100%) | 00 |
| Linezolid (30 µg) | 105/184(57%) | 26/184(14%) | 53/184(29%) | 00 |
| Neomycin (10 µg) | 00 | 00 | 00 | 184/184(100%) |
| Toxin Gene | Primers | Primer Sequence (5′–3′) | Product Size (bp) |
|---|---|---|---|
| cpa (α-toxin) | CPA F | GCTAATGTTACTGCCGTTGA | 324 bp |
| CPA R | CCTCTGATACATCGTGTAAG | ||
| cpb (β-toxin) | CPB F | GCGAATATGCTGAATCATCTA | 195 bp |
| CPB R | GCAGGAACATTAGTATATCTTC | ||
| cpb2 (β2-toxin) | CPB2 F | AAATATGATCCTAACCAACAA | 548 bp |
| CPB2 R | CCAAATACTCTAATCGATGC | ||
| etx (ε-toxin) | ETX F | TGGGAACTTCGATACAAGCA | 376 bp |
| ETX R | AACTGCACTATAATTTCCTTTTCC | ||
| iap (ι-toxin) | IA F | AATGGTCCTTTAAATAATCC | 272 bp |
| IA R | TTAGCAAATGCACTCATATT | ||
| cpe (enterotoxin) | CPE F | TTCAGTTGGATTTACTTCTG | 485 bp |
| CPE R | TGTCCAGTAGCTGTAATTGT |
| Significant Level | Growth Inhibition |
|---|---|
| Resistant | ≤40% inhibition |
| Moderate Sensitivity | 40–60% inhibition |
| Good Susceptibility | 60–70% inhibition |
| Significant Susceptibility | 70% and above |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Mohiuddin, M.; Iqbal, Z.; Siddique, A.; Liao, S.; Salamat, M.K.F.; Qi, N.; Din, A.M.; Sun, M. Prevalence, Genotypic and Phenotypic Characterization and Antibiotic Resistance Profile of Clostridium perfringens Type A and D Isolated from Feces of Sheep (Ovis aries) and Goats (Capra hircus) in Punjab, Pakistan. Toxins 2020, 12, 657. https://doi.org/10.3390/toxins12100657
Mohiuddin M, Iqbal Z, Siddique A, Liao S, Salamat MKF, Qi N, Din AM, Sun M. Prevalence, Genotypic and Phenotypic Characterization and Antibiotic Resistance Profile of Clostridium perfringens Type A and D Isolated from Feces of Sheep (Ovis aries) and Goats (Capra hircus) in Punjab, Pakistan. Toxins. 2020; 12(10):657. https://doi.org/10.3390/toxins12100657
Chicago/Turabian StyleMohiuddin, Mudassar, Zahid Iqbal, Abubakar Siddique, Shenquan Liao, Muhammad Khalid Farooq Salamat, Nanshan Qi, Ayesha Mohiud Din, and Mingfei Sun. 2020. "Prevalence, Genotypic and Phenotypic Characterization and Antibiotic Resistance Profile of Clostridium perfringens Type A and D Isolated from Feces of Sheep (Ovis aries) and Goats (Capra hircus) in Punjab, Pakistan" Toxins 12, no. 10: 657. https://doi.org/10.3390/toxins12100657
APA StyleMohiuddin, M., Iqbal, Z., Siddique, A., Liao, S., Salamat, M. K. F., Qi, N., Din, A. M., & Sun, M. (2020). Prevalence, Genotypic and Phenotypic Characterization and Antibiotic Resistance Profile of Clostridium perfringens Type A and D Isolated from Feces of Sheep (Ovis aries) and Goats (Capra hircus) in Punjab, Pakistan. Toxins, 12(10), 657. https://doi.org/10.3390/toxins12100657

