Myriocin Restores Metabolic Homeostasis in dAGE-Exposed Mice via AMPK-PGC1α-Mediated Mitochondrial Activation and Systemic Lipid/Glucose Regulation
Highlights
- Myriocin alleviated obesity-related metabolic dysfunction in mice exposed to dietary advanced glycation end products (dAGEs).
- Myriocin activated the AMPK-PGC1α signaling pathway, improving mitochondrial function, thermogenesis, and lipid and glucose metabolism.
- The findings highlight the central role of the AMPK-PGC1α axis in counteracting metabolic disturbances induced by excessive dietary AGEs.
- The study demonstrates the therapeutic potential of myriocin as a metabolic regulator for preventing obesity and related metabolic disorders.
Abstract
1. Introduction
2. Materials and Methods
2.1. Reagents and Materials
2.2. Preparation of AGE Diet
2.3. Detection of AGEs Content
2.4. Animal Experiment Design
2.5. Determination of Body Weight, Adiposity Index, and Serum Biochemical Markers
2.6. Oral Glucose Tolerance Test (OGTT)
2.7. Determination of Serum Biochemical Markers
2.8. Metabolite Extraction and LC-MS Analysis
2.9. Pathological Histology Analyses
2.10. Reverse Transcription Quantitative PCR (RT-qPCR) Analysis
2.11. Western Blotting Analysis
2.12. Statistical Analysis
3. Results
3.1. Myr Prevents Obesity Induced by dAGEs
3.2. Myr Improves Glucose Homeostasis in Mouse Group Fed High AGE Diet
3.3. Myr Ameliorates Ectopic Lipid Deposition in the Liver of Mice Fed High AGE Diet
3.4. Myr Treatment Alters Serum Metabolite Profile in Mice Fed dAGEs
3.5. Myr Regulates Factors Related to Lipid Metabolism in Liver
3.6. Myr Promotes Adipose Thermogenesis in Mice Fed H-AGEs
3.7. Myr Activates the AMPK-PGC1α Signaling Pathway
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Data Availability Statement
Conflicts of Interest
Abbreviations
| AGEs | Advanced glycation end products |
| ALT | Alanine aminotransferase |
| AMPK | AMP-activated protein kinase |
| AST | Aspartate aminotransferase |
| AUC | The area under the curve |
| BAT | Brown adipose tissue |
| ESI | Electro-spray ionization |
| eWAT | Epididymal white adipose tissue |
| FBG | Fasting blood glucose |
| GSP | Glycated serum proteins |
| HDL-C | High-density lipoprotein cholesterol |
| HE | Hematoxylin–eosin staining |
| iWAT | Inguinal white adipose tissue |
| LDL-C | Low-density lipoprotein cholesterol |
| Myr | Myriocin |
| OGTT | Oral glucose tolerance test |
| OPLS-DA | Orthogonal partial least squares discriminant analysis |
| PCA | Principal component analysis |
| PGC1α | Peroxisome proliferator activator receptor gamma coactivator-1 alpha |
| TC | Total cholesterol |
| TG | Total triglyceride |
References
- Goldberg, T.; Cai, W.; Peppa, M.; Dardaine, V.; Baliga, B.S.; Uribarri, J.; Vlassara, H. Advanced glycoxidation end products in commonly consumed foods. J. Am. Diet. Assoc. 2004, 104, 1287–1291. [Google Scholar] [CrossRef] [PubMed]
- Sandu, O.; Song, K.Y.; Cai, W.J.; Zheng, F.; Uribarri, J.; Vlassara, H. Insulin resistance and type 2 diabetes in high-fat-fed mice are linked to high glycotoxin intake. Diabetes 2005, 54, 2314–2319. [Google Scholar] [CrossRef] [PubMed]
- Angoorani, P.; Ejtahed, H.S.; Mirmiran, P.; Mirzaei, S.; Azizi, F. Dietary consumption of advanced glycation end products and risk of metabolic syndrome. Int. J. Food Sci. Nutr. 2016, 67, 170–176. [Google Scholar] [CrossRef]
- Baye, E.; de Courten, M.P.J.; Walker, K.; Ranasinha, S.; Earnest, A.; Forbes, J.M.; de Courten, B. Effect of dietary advanced glycation end products on inflammation and cardiovascular risks in healthy overweight adults: A randomised crossover trial. Sci. Rep. 2017, 7, 4123. [Google Scholar] [CrossRef]
- Di Pino, A.; Currenti, W.; Urbano, F.; Mantegna, C.; Purrazzo, G.; Piro, S.; Purrello, F.; Rabuazzo, A.M. Low advanced glycation end product diet improves the lipid and inflammatory profiles of prediabetic subjects. J. Clin. Lipidol. 2016, 10, 1098–1108. [Google Scholar] [CrossRef]
- Koenen, M.; Hill, M.A.; Cohen, P.; Sowers, J.R. Obesity, Adipose Tissue and Vascular Dysfunction. Circ. Res. 2021, 128, 951–968. [Google Scholar] [CrossRef]
- Chouchani, E.T.; Kazak, L.; Spiegelman, B.M. New Advances in Adaptive Thermogenesis: UCP1 and Beyond. Cell Metab. 2019, 29, 27–37. [Google Scholar] [CrossRef]
- Wan, Z.X.; Root-Mccaig, J.; Castellani, L.; Kemp, B.E.; Steinberg, G.R.; Wright, D.C. Evidence for the Role of AMPK in Regulating PGC-1 Alpha Expression and Mitochondrial Proteins in Mouse Epididymal Adipose Tissue. Obesity 2014, 22, 730–738. [Google Scholar] [CrossRef]
- Zhou, J.; Poudel, A.; Chandramani-Shivalingappa, P.; Xu, B.; Welchko, R.; Li, L. Liraglutide induces beige fat development and promotes mitochondrial function in diet induced obesity mice partially through AMPK-SIRT-1-PGC1-alpha cell signaling pathway. Endocrine 2019, 64, 271–283. [Google Scholar] [CrossRef]
- Ziqubu, K.; Mazibuko-Mbeje, S.E.; Mthembu, S.X.H.; Mabhida, S.E.; Jack, B.U.; Nyambuya, T.M.; Nkambule, B.B.; Basson, A.K.; Tiano, L.; Dludla, P.V. Anti-Obesity Effects of Metformin: A Scoping Review Evaluating the Feasibility of Brown Adipose Tissue as a Therapeutic Target. Int. J. Mol. Sci. 2023, 24, 2227. [Google Scholar] [CrossRef]
- Aburasayn, H.; Al Batran, R.; Ussher, J.R. Targeting ceramide metabolism in obesity. Am. J. Physiol. Endocrinol. Metab. 2016, 311, E423–E435. [Google Scholar] [CrossRef] [PubMed]
- Zhang, Q.-J.; Holland, W.L.; Wilson, L.; Tanner, J.M.; Kearns, D.; Cahoon, J.M.; Pettey, D.; Losee, J.; Duncan, B.; Gale, D.; et al. Ceramide Mediates Vascular Dysfunction in Diet-Induced Obesity by PP2A-Mediated Dephosphorylation of the eNOS-Akt Complex. Diabetes 2012, 61, 1848–1859. [Google Scholar] [CrossRef] [PubMed]
- Campana, M.; Bellini, L.; Rouch, C.; Rachdi, L.; Coant, N.; Butin, N.; Bandet, C.L.; Philippe, E.; Meneyrol, K.; Kassis, N.; et al. Inhibition of central de novo ceramide synthesis restores insulin signaling in hypothalamus and enhances β-cell function of obese Zucker rats. Mol. Metab. 2018, 8, 23–36. [Google Scholar] [CrossRef] [PubMed]
- Liu, J.; Huang, X.; Withers, B.R.; Blalock, E.; Liu, K.; Dickson, R.C. Reducing sphingolipid synthesis orchestrates global changes to extend yeast lifespan. Aging Cell 2013, 12, 833–841. [Google Scholar] [CrossRef]
- Hepowit, N.; Macedo, J.; Young, L.; Liu, K.; Sun, R.; MacGurn, J.; Dickson, R. Enhancing lifespan of budding yeast by pharmacological lowering of amino acid pools. Aging 2020, 13, 7846–7871. [Google Scholar] [CrossRef]
- Liu, Y.; He, L.; Liu, B.; Ying, Y.; Xu, J.; Yu, M.; Dang, J.; Liu, K. Pharmacological inhibition of sphingolipid synthesis reduces ferroptosis by stimulating the HIF-1 pathway. iScience 2022, 25, 104533. [Google Scholar] [CrossRef]
- Lima, T.I.; Laurila, P.-P.; Wohlwend, M.; Morel, J.D.; Goeminne, L.J.E.; Li, H.; Romani, M.; Li, X.; Oh, C.-M.; Park, D.; et al. Inhibiting de novo ceramide synthesis restores mitochondrial and protein homeostasis in muscle aging. Sci. Transl. Med. 2023, 15, eade6509. [Google Scholar] [CrossRef]
- Sourris, K.; Harcourt, B.; Penfold, S.; Yap, F.; Morley, A.; Morgan, P.; Davies, M.; Baker, S.; Jerums, G.; Forbes, J.J.E.d.r. Modulation of the cellular expression of circulating advanced glycation end-product receptors in type 2 diabetic nephropathy. J. Diabetes Res. 2010, 2010, 974681. [Google Scholar] [CrossRef]
- Petit, C.S.; Lee, J.J.; Boland, S.; Swarup, S.; Christiano, R.; Lai, Z.W.; Mejhert, N.; Elliott, S.D.; McFall, D.; Haque, S.; et al. Inhibition of sphingolipid synthesis improves outcomes and survival in GARP mutant wobbler mice, a model of motor neuron degeneration. Proc. Natl. Acad. Sci. USA 2020, 117, 10565–10574. [Google Scholar] [CrossRef]
- Gengatharan, J.M.; Handzlik, M.K.; Chih, Z.Y.; Ruchhoeft, M.L.; Secrest, P.; Ashley, E.L.; Green, C.R.; Wallace, M.; Gordts, P.; Metallo, C.M. Altered sphingolipid biosynthetic flux and lipoprotein trafficking contribute to trans-fat-induced atherosclerosis. Cell Metab. 2025, 37, 274–290.e279. [Google Scholar] [CrossRef]
- Glaros, E.N.; Kim, W.S.; Quinn, C.M.; Jessup, W.; Rye, K.A.; Garner, B. Myriocin slows the progression of established atherosclerotic lesions in apolipoprotein E gene knockout mice. J. Lipid Res. 2008, 49, 324–331. [Google Scholar] [CrossRef] [PubMed]
- Zelena, E.; Dunn, W.B.; Broadhurst, D.; Francis-McIntyre, S.; Carroll, K.M.; Begley, P.; O’Hagan, S.; Knowles, J.D.; Halsall, A.; Wilson, I.D.; et al. Development of a Robust and Repeatable UPLC−MS Method for the Long-Term Metabolomic Study of Human Serum. Anal. Chem. 2009, 81, 1357–1364. [Google Scholar] [CrossRef] [PubMed]
- Want, E.J.; Masson, P.; Michopoulos, F.; Wilson, I.D.; Theodoridis, G.; Plumb, R.S.; Shockcor, J.; Loftus, N.; Holmes, E.; Nicholson, J.K. Global metabolic profiling of animal and human tissues via UPLC-MS. Nat. Protoc. 2013, 8, 17–32. [Google Scholar] [CrossRef] [PubMed]
- Xue, J.; Rai, V.; Singer, D.; Chabierski, S.; Xie, J.J.; Reverdatto, S.; Burz, D.S.; Schmidt, A.M.; Hoffmann, R.; Shekhtman, A. Advanced Glycation End Product Recognition by the Receptor for AGEs. Structure 2011, 19, 722–732. [Google Scholar] [CrossRef]
- Ludwig, S. Diabetes care in the office. In Practical Diabetes Care for Healthcare Professionals, 2nd ed.; Ludwig, S., Ed.; Elsevier: Amsterdam, The Netherlands, 2021; pp. 9–17. [Google Scholar]
- Kobori, T.; Ganesh, D.; Kumano-Kuramochi, M.; Torigoe, K.; Machida, S. Assay for advanced glycation end products generating intracellular oxidative stress through binding to its receptor. Anal. Biochem. 2020, 611, 114018. [Google Scholar] [CrossRef]
- Lee, G.; Kim, Y.Y.; Jang, H.; Han, J.S.; Nahmgoong, H.; Park, Y.J.; Han, S.M.; Cho, C.; Lim, S.; Noh, J.R.; et al. SREBP1c-PARP1 axis tunes anti-senescence activity of adipocytes and ameliorates metabolic imbalance in obesity. Cell Metab. 2022, 34, 702–718.e705. [Google Scholar] [CrossRef]
- Al Ojaimi, Y.; Khachab, M.; Bazzi, S.; Bahr, G.M.; Echtay, K.S. Mitochondrial bioenergetics, uncoupling protein-2 activity, and reactive oxygen species production in the small intestine of a TNBS-induced colitis rat model. Mol. Cell Biochem. 2020, 470, 87–98. [Google Scholar] [CrossRef]
- Chaurasia, B.; Kaddai, V.A.; Lancaster, G.I.; Henstridge, D.C.; Sriram, S.; Galam, D.L.; Gopalan, V.; Prakash, K.N.; Velan, S.S.; Bulchand, S.; et al. Adipocyte Ceramides Regulate Subcutaneous Adipose Browning, Inflammation, and Metabolism. Cell Metab. 2016, 24, 820–834. [Google Scholar] [CrossRef]
- Handzlik, M.K.; Gengatharan, J.M.; Frizzi, K.E.; McGregor, G.H.; Martino, C.; Rahman, G.; Gonzalez, A.; Moreno, A.M.; Green, C.R.; Guernsey, L.S.; et al. Insulin-regulated serine and lipid metabolism drive peripheral neuropathy. Nature 2023, 614, 118–124. [Google Scholar] [CrossRef]
- Seale, P.; Kajimura, S.; Yang, W.; Chin, S.; Rohas, L.M.; Uldry, M.; Tavernier, G.; Langin, D.; Spiegelman, B.M. Transcriptional control of brown fat determination by PRDM16. Cell Metab. 2007, 6, 38–54. [Google Scholar] [CrossRef]
- Ma, Q.X.; Zhu, W.Y.; Lu, X.C.; Jiang, D.; Xu, F.; Li, J.T.; Zhang, L.; Wu, Y.L.; Chen, Z.J.; Yin, M.; et al. BCAA-BCKA axis regulates WAT browning through acetylation of PRDM16. Nat. Metab. 2022, 4, 106–122. [Google Scholar] [CrossRef] [PubMed]
- Fullerton, M.D.; Galic, S.; Marcinko, K.; Sikkema, S.; Pulinilkunnil, T.; Chen, Z.P.; O’Neill, H.M.; Ford, R.J.; Palanivel, R.; O’Brien, M.; et al. Single phosphorylation sites in Acc1 and Acc2 regulate lipid homeostasis and the insulin-sensitizing effects of metformin. Nat. Med. 2013, 19, 1649–1654. [Google Scholar] [CrossRef] [PubMed]
- Watt, M.J.; Holmes, A.G.; Pinnamaneni, S.K.; Garnham, A.P.; Steinberg, G.R.; Kemp, B.E.; Febbraio, M.A. Regulation of HSL serine phosphorylation in skeletal muscle and adipose tissue. Am. J. Physiol. Endocrinol. Metab. 2006, 290, E500–E508. [Google Scholar] [CrossRef] [PubMed]
- Sahu-Osen, A.; Montero-Moran, G.; Schittmayer, M.; Fritz, K.; Dinh, A.; Chang, Y.F.; McMahon, D.; Boeszoermenyi, A.; Cornaciu, I.; Russell, D.; et al. CGI-58/ABHD5 is phosphorylated on Ser239 by protein kinase A: Control of subcellular localization. J. Lipid Res. 2015, 56, 109–121. [Google Scholar] [CrossRef]
- Herzig, S.; Shaw, R.J. AMPK: Guardian of metabolism and mitochondrial homeostasis. Nat. Rev. Mol. Cell Biol. 2018, 19, 121–135. [Google Scholar] [CrossRef]
- Betz, M.J.; Enerback, S. Targeting thermogenesis in brown fat and muscle to treat obesity and metabolic disease. Nat. Rev. Endocrinol. 2018, 14, 77–87. [Google Scholar] [CrossRef]
- Yang, G.; Badeanlou, L.; Bielawski, J.; Roberts, A.J.; Hannun, Y.A.; Samad, F. Central role of ceramide biosynthesis in body weight regulation, energy metabolism, and the metabolic syndrome. Am. J. Physiol. Endocrinol. Metab. 2009, 297, E211–E224. [Google Scholar] [CrossRef]
- Kim, S.H.; Plutzky, J. Brown Fat and Browning for the Treatment of Obesity and Related Metabolic Disorders. Diabetes Metab. J. 2016, 40, 12–21. [Google Scholar] [CrossRef]







| Genes | Primer Pairs (5′-3′) | Protein Names |
|---|---|---|
| Actb | GATGTATGAAGGCTTTGGTC TGTGCACTTTTATTGGTCTC | Actin |
| Gck | CAACTGGACCAAGGGCTTCAA TGTGGCCACCGTGTCATTC | Glucokinase |
| G6pc | CAAGGGAGAACTCAGCAAGT GGGCTTCAGAGAGTCAAAGA | Glucose-6-phosphatase catalytic subunit 1 |
| Srebp1c | GGAGCCATGGATTGCACATT GGCCCGGGAAGTCACTGT | Sterol regulatory element-binding protein 1 |
| Acc1 | CCCGCTCCTTCAACTTGCT ATTGGGCACCCCAGAGCTA | Acetyl-CoA carboxylase 1 |
| Fasn | TGCTCCAGGGATAACAGC CCAAATCCAACATGGGACA | Fatty acid synthase |
| Pparg | CTTGCTGTGGGGATGTCT GGGTTCAGCTGGTCGATA | Peroxisome proliferator-activated receptor gamma |
| Hsl | GAGTAGTAACAAAGGTCAA CACAGTGACAGCCACATTCT | Hormone-sensitive lipase |
| Atgl | CTGGTCATCATCCTGCCTTT TTTTGGCAGAGGGAAAAAGA | Patatin-like phospholipase domain-containing protein |
| Ucp1 | ACTGCCACACCTCCAGTCATT CTTTGCCTCACTCAGGATTGG | Mitochondrial brown fat uncoupling protein 1 |
| Dio2 | CAGTGTGGTGCACGTCTCCAATC TGAACCAAAGTTGACCACCAG | Type II iodothyronine deiodinase |
| Cidea | GCCGTGTTAAGGAATCTGCTG TGCTCTTCTGTATCGCCCAGT | Lipid transferase CIDEA |
| Pgc1a | CCCTGCCATTGTTAAGACC TGCTGCTGTTCCTGTTTTC | Peroxisome proliferator-activated receptor gamma coactivator 1-alpha |
| Pgc1b | TCCTGTAAAAGCCCGGAGTAT GCTCTGGTAGGGGCAGTGA | Peroxisome proliferator-activated receptor gamma coactivator 1-beta |
| Nrf1 | GCTTCAGAACTGCCAACCAC TGTTCCACCTCTCCATCAGC | Nuclear respiratory factor 1 |
| Nrf2 | TAGATG ACCATGAGTCGCTTGC GCCAAACTTGCTCCATGTCC | Nuclear factor erythroid 2-related factor 2 |
| Tfam | CAGGAGGCAAAGGATGATTC CCAAGACTTCATTTCATTGTCG | Transcription factor A, mitochondrial |
| Cox2 | ACCAATAGCCCTGGCCGTAC GGTGGCGCTTCCAATTAGGT | Cytochrome c oxidase subunit 2 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
He, L.; Dang, J.; Li, J.; Xue, H.; Cai, J.; Cheng, G.; Yang, Y.; Liu, Z.; Liu, B.; Dai, Y.; et al. Myriocin Restores Metabolic Homeostasis in dAGE-Exposed Mice via AMPK-PGC1α-Mediated Mitochondrial Activation and Systemic Lipid/Glucose Regulation. Nutrients 2025, 17, 1549. https://doi.org/10.3390/nu17091549
He L, Dang J, Li J, Xue H, Cai J, Cheng G, Yang Y, Liu Z, Liu B, Dai Y, et al. Myriocin Restores Metabolic Homeostasis in dAGE-Exposed Mice via AMPK-PGC1α-Mediated Mitochondrial Activation and Systemic Lipid/Glucose Regulation. Nutrients. 2025; 17(9):1549. https://doi.org/10.3390/nu17091549
Chicago/Turabian StyleHe, Libo, Jinye Dang, Jingjing Li, Hairui Xue, Jiaxiu Cai, Guohua Cheng, Yuhui Yang, Zhiyi Liu, Binghua Liu, Yali Dai, and et al. 2025. "Myriocin Restores Metabolic Homeostasis in dAGE-Exposed Mice via AMPK-PGC1α-Mediated Mitochondrial Activation and Systemic Lipid/Glucose Regulation" Nutrients 17, no. 9: 1549. https://doi.org/10.3390/nu17091549
APA StyleHe, L., Dang, J., Li, J., Xue, H., Cai, J., Cheng, G., Yang, Y., Liu, Z., Liu, B., Dai, Y., Zhang, Y., Huang, Y., Sun, Y., Guo, J., & Liu, K. (2025). Myriocin Restores Metabolic Homeostasis in dAGE-Exposed Mice via AMPK-PGC1α-Mediated Mitochondrial Activation and Systemic Lipid/Glucose Regulation. Nutrients, 17(9), 1549. https://doi.org/10.3390/nu17091549

