Effects of Illumination Color on Hypothalamic Appetite-Regulating Gene Expression and Glycolipid Metabolism
Abstract
1. Introduction
2. Materials and Methods
2.1. Animals
2.2. Sample Collection and Processing
2.3. Oral Glucose Tolerance Test (OGTT) and Pyruvate Tolerance Test (PTT)
2.4. Histological Analyses
2.5. Serological Analysis
2.6. Hypothalamic Gene Expression
2.7. Statistical Analysis
3. Results and Analysis
3.1. Changes in Food Intake and Body Weight of Mice
3.2. Weight and Histological Observations of Liver and Fat
3.3. Effect of Lighting Color on Glucose Regulation
3.4. Serum Lipid Metabolism Indexes
3.5. Effects of Different Lighting Colors on Appetite Hormones
3.6. Fluorescence Quantitative PCR Analysis
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Data Availability Statement
Conflicts of Interest
References
- Benedito-Silva, A.A.; Evans, S.; Viana Mendes, J.; Castro, J.; Gonçalves, B.d.S.B.; Ruiz, F.S.; Beijamini, F.; Evangelista, F.S.; Vallada, H.; Krieger, J.E. Association between light exposure and metabolic syndrome in a rural Brazilian town. PLoS ONE 2020, 15, e0238772. [Google Scholar] [CrossRef]
- Zhang, S.; Xu, M.; Shen, Z.; Shang, C.; Zhang, W.; Chen, S.; Liu, C. Green light exposure aggravates high-fat diet feeding-induced hepatic steatosis and pancreatic dysfunction in male mice. Ecotoxicol. Environ. Saf. 2021, 225, 112802. [Google Scholar] [CrossRef] [PubMed]
- Borck, P.; Batista, T.; Vettorazzi, J.; Soares, G.; Lubaczeuski, C.; Guan, D. Nighttime light exposure enhances Rev-erbα-targeting microRNAs and contributes to hepatic steatosis. Metabolism 2018, 85, P250–P258. [Google Scholar] [CrossRef]
- Luo, Y.S.; Yang, J.L.; Kang, J.Y.; Chen, K.H.; Jin, X.F.; Gonzalez, F.J.; Liu, A.M. PPARα mediates night neon light-induced weight gain: Role of lipid homeostasis. Theranostics 2020, 10, 11497–11506. [Google Scholar] [CrossRef] [PubMed]
- Rapf, R.J.; Vaida, V. Sunlight as an energetic driver in the synthesis of molecules necessary for life. Phys. Chem. Chem. Phys. 2016, 18, 20067–20084. [Google Scholar] [CrossRef] [PubMed]
- Saraf, R.; Mahmood, F.; Amir, R.; Matyal, R. Neuropeptide Y is an angiogenic factor in cardiovascular regeneration. Eur. J. Pharmacol. 2016, 776, 64–70. [Google Scholar] [CrossRef] [PubMed]
- Farnworth, B.; Innes, J.; Waas, J.R. Converting predation cues into conservation tools: The effect of light on mouse foraging behaviour. PLoS ONE 2016, 11, e0145432. [Google Scholar] [CrossRef] [PubMed]
- Hawkes, C.; Smith, T.G.; Jewell, J.; Wardle, J.; Hammond, R.A.; Friel, S.; Thow, A.M.; Kain, J. Smart food policies for obesity prevention. Lancet 2015, 385, 2410–2421. [Google Scholar] [CrossRef]
- Paronis, E.; Kapogiannatou, A.; Paschidis, K.; Stasinopoulou, M.; Alexakos, P.; Skaliora, I.; Kostomitsopoulos, N.G. Lighting environment: What colour of light do male C57BL/6J prefer? Appl. Anim. Behav. Sci. 2018, 209, 99–103. [Google Scholar] [CrossRef]
- Opperhuizen, A.-L.; Stenvers, D.J.; Jansen, R.D.; Foppen, E.; Fliers, E.; Kalsbeek, A. Light at night acutely impairs glucose tolerance in a time-, intensity-and wavelength-dependent manner in rats. Diabetologia 2017, 60, 1333–1343. [Google Scholar] [CrossRef]
- Mariné-Casadó, R.; Domenech-Coca, C.; Del Bas, J.M.; Bladé, C.; Arola, L.; Caimari, A. The exposure to different photoperiods strongly modulates the glucose and lipid metabolisms of normoweight fischer 344 rats. Front. Physiol. 2018, 9, 416. [Google Scholar] [CrossRef] [PubMed]
- Guan, Q.; Wang, Z.; Cao, J.; Dong, Y.; Chen, Y. Monochromatic blue light not green light exposure is associated with continuous light-induced hepatic steatosis in high fat diet fed-mice via oxidative stress. Ecotoxicol. Environ. Saf. 2022, 239, 113625. [Google Scholar] [CrossRef] [PubMed]
- Ross, A.; Johnson, C.; Bell, L.; Reilly, L.; Duncan, J.; Barrett, P.; Heideman, P.; Morgan, P.J. Divergent regulation of hypothalamic neuropeptide Y and agouti-related protein by photoperiod in F344 rats with differential food intake and growth. J. Neuroendocrinol. 2009, 21, 610–619. [Google Scholar] [CrossRef]
- Alaimo, A.; Liñares, G.G.; Bujjamer, J.M.; Gorojod, R.M.; Alcon, S.P.; Martínez, J.H.; Baldessari, A.; Grecco, H.E.; Kotler, M.L. Toxicity of blue led light and A2E is associated to mitochondrial dynamics impairment in ARPE-19 cells: Implications for age-related macular degeneration. Arch. Toxicol. 2019, 93, 1401–1415. [Google Scholar] [CrossRef]
- Moreira, P.I.; Oliveira, C.R. Mitochondria as potential targets in antidiabetic therapy. In Diabetes—Perspectives in Drug Therapy; Springer: Berlin/Heidelberg, Germany, 2011; pp. 331–356. [Google Scholar]
- Ouyang, X.; Yang, J.; Hong, Z.; Wu, Y.; Xie, Y.; Wang, G. Mechanisms of blue light-induced eye hazard and protective measures: A review. Biomed. Pharmacother. 2020, 130, 110577. [Google Scholar] [CrossRef]
- Yuan, D.; Collage, R.D.; Huang, H.; Zhang, X.; Kautza, B.C.; Lewis, A.J.; Zuckerbraun, B.S.; Tsung, A.; Angus, D.C.; Rosengart, M.R. Blue light reduces organ injury from ischemia and reperfusion. Proc. Natl. Acad. Sci. USA 2016, 113, 5239–5244. [Google Scholar] [CrossRef]
- Cheung, I.N.; Zee, P.C.; Shalman, D.; Malkani, R.G.; Kang, J.; Reid, K.J. Morning and evening blue-enriched light exposure alters metabolic function in normal weight adults. PLoS ONE 2016, 11, e0155601. [Google Scholar] [CrossRef]
- Masís-Vargas, A.; Ritsema, W.I.; Mendoza, J.; Kalsbeek, A. Metabolic effects of light at night are time-and wavelength-dependent in rats. Obesity 2020, 28, S114–S125. [Google Scholar] [CrossRef]
- Zhang, Z.; Wang, H.-J.; Wang, D.-R.; Qu, W.-M.; Huang, Z.-L. Red light at intensities above 10 lx alters sleep–wake behavior in mice. Light Sci. Appl. 2017, 6, e16231. [Google Scholar] [CrossRef]
- Kambe, Y.; Nguyen, T.T.; Yasaka, T.; Nguyen, T.T.; Sameshima, Y.; Hashiguchi, K.; Shintani, N.; Hashimoto, H.; Kurihara, T.; Miyata, A. The Pivotal Role of Neuropeptide Crosstalk from Ventromedial-PACAP to Dorsomedial-Galanin in the Appetite Regulation in the Mouse Hypothalamus. Mol. Neurobiol. 2023, 60, 171–182. [Google Scholar] [CrossRef]
- Rudehill, A.; Franco-Cereceda, A.; Hemsen, A.; Stensdotter, M.; Pernow, J.; Lundberg, J. Cigarette smoke-induced elevation of plasma neuropeptide Y levels in man. Clin. Physiol. 1989, 9, 243–248. [Google Scholar] [CrossRef] [PubMed]
- Vettor, R.; Fabris, R.; Pagano, C.; Federspil, G. Neuroendocrine regulation of eating behavior. J. Endocrinol. Investig. 2002, 25, 836–854. [Google Scholar] [CrossRef]
- Windeløv, J.A.; Pedersen, J.; Holst, J.J. Use of anesthesia dramatically alters the oral glucose tolerance and insulin secretion in C57Bl/6 mice. Physiol. Rep. 2016, 4, e12824. [Google Scholar] [CrossRef]
- Livak, K.J.; Schmittgen, T.D. Analysis of Relative Gene Expression Data using Real-Time Quantitative PCR. Methods 2002, 25, 402–408. [Google Scholar] [CrossRef]
- Togo, Y.; Otsuka, T.; Goto, M.; Furuse, M.; Yasuo, S. Photoperiod regulates dietary preferences and energy metabolism in young developing Fischer 344 rats but not in same-age Wistar rats. Am. J. Physiol. 2012, 303, E777–E786. [Google Scholar] [CrossRef]
- Zhang, S.; Zhang, Y.; Zhang, W.; Chen, S.; Liu, C. Chronic exposure to green light aggravates high-fat diet-induced obesity and metabolic disorders in male mice. Ecotoxicol. Environ. Saf. 2019, 178, 94–104. [Google Scholar] [CrossRef]
- Liu, C.; Shao, M.; Lu, L.; Zhao, C.; Qiu, L.; Liu, Z. Obesity, insulin resistance and their interaction on liver enzymes. PLoS ONE 2021, 16, e0249299. [Google Scholar] [CrossRef]
- Yang, T.; Xu, W.-J.; York, H.; Liang, N.-C. Diet choice patterns in rodents depend on novelty of the diet, exercise, species, and sex. Physiol. Behav. 2017, 176, 149–158. [Google Scholar] [CrossRef]
- Masís-Vargas, A.; Hicks, D.; Kalsbeek, A.; Mendoza, J. Blue light at night acutely impairs glucose tolerance and increases sugar intake in the diurnal rodent Arvicanthis ansorgei in a sex-dependent manner. Physiol. Rep. 2019, 7, e14257. [Google Scholar] [CrossRef]
- Duarte, L.; Gasaly, N.; Aro, C.E.P.; Uribe, D.; Garcia-Diaz, D.F. Polyphenols and their anti-obesity role mediated by the gut microbiota: A comprehensive review. Rev. Endocr. Metab. Disord. 2021, 22, 367–388. [Google Scholar] [CrossRef]
- Bedrosian, T.A.; Vaughn, C.A.; Galan, A.; Daye, G.; Weil, Z.M.; Nelson, R.J. Nocturnal light exposure impairs affective responses in a wavelength-dependent manner. J. Neurosci. 2013, 33, 13081–13087. [Google Scholar] [CrossRef] [PubMed]
- Hong, F.; Pan, S.; Xu, P.; Xue, T.; Wang, J.; Guo, Y.; Jia, L.; Qiao, X.; Li, L.; Zhai, Y. Melatonin orchestrates lipid homeostasis through the hepatointestinal circadian clock and microbiota during constant light exposure. Cells 2020, 9, 489. [Google Scholar] [CrossRef] [PubMed]
- Dauchy, R.T.; Blask, D.E.; Hoffman, A.E.; Xiang, S.L.; Hanifin, J.P.; Warfield, B.; Brainard, G.C.; Anbalagan, M.; Dupepe, L.M.; Dobek, G.L.; et al. Influence of Daytime LED Light Exposure on Circadian Regulatory Dynamics of Metabolism and Physiology in Mice. Comp. Med. 2019, 69, 350–373. [Google Scholar] [CrossRef] [PubMed]
- Molnár, G.; Faragó, N.; Kocsis, Á.K.; Rózsa, M.; Lovas, S.; Boldog, E.; Báldi, R.; Csajbók, É.; Gardi, J.; Puskás, L.G. GABAergic neurogliaform cells represent local sources of insulin in the cerebral cortex. J. Neurosci. 2014, 34, 1133–1137. [Google Scholar] [CrossRef]
- García-Cáceres, C.; Quarta, C.; Varela, L.; Gao, Y.; Gruber, T.; Legutko, B.; Jastroch, M.; Johansson, P.; Ninkovic, J.; Yi, C.-X. Astrocytic insulin signaling couples brain glucose uptake with nutrient availability. Cell 2016, 166, 867–880. [Google Scholar] [CrossRef]
- Brunham, L.R.; Kruit, J.K.; Verchere, C.B.; Hayden, M.R. Cholesterol in islet dysfunction and type 2 diabetes. J. Clin. Investig. 2008, 118, 403–408. [Google Scholar] [CrossRef]
- Ghalami, J.; Zardooz, H.; Rostamkhani, F.; Farrokhi, B.; Hedayati, M. Glucose-stimulated insulin secretion: Effects of high-fat diet and acute stress. J. Endocrinol. Investig. 2013, 36, 835–842. [Google Scholar]
- Barrios-Correa, A.A.; Estrada, J.A.; Contreras, I. Leptin signaling in the control of metabolism and appetite: Lessons from animal models. J. Mol. Neurosci. 2018, 66, 390–402. [Google Scholar] [CrossRef]
- Heijboer, A.; Voshol, P.; Donga, E.; Van Eden, C.; Havekes, L.; Romijn, J.; Pijl, H.; Corssmit, E. High fat diet induced hepatic insulin resistance is not related to changes in hypothalamic mRNA expression of NPY, AgRP, POMC and CART in mice. Peptides 2005, 26, 2554–2558. [Google Scholar] [CrossRef]
- Li, L.; Lee, E.W.; Ji, H.; Zukowska, Z. Neuropeptide Y–induced acceleration of postangioplasty occlusion of rat carotid artery. Arterioscler. Thromb. Vasc. Biol. 2003, 23, 1204–1210. [Google Scholar] [CrossRef]
- Li, L.; Jönsson-Rylander, A.-C.; Abe, K.; Zukowska, Z. Chronic stress induces rapid occlusion of angioplasty-injured rat carotid artery by activating neuropeptide Y and its Y1 receptors. Arterioscler. Thromb. Vasc. Biol. 2005, 25, 2075–2080. [Google Scholar] [CrossRef] [PubMed]
- Ghersi, G.; Chen, W.-T.; Lee, E.W.; Zukowska, Z. Critical role of dipeptidyl peptidase IV in neuropeptide Y-mediated endothelial cell migration in response to wounding. Peptides 2001, 22, 453–458. [Google Scholar] [CrossRef] [PubMed]
- Ha, G.E.; Cheong, E. Chronic Restraint Stress Decreases the Excitability of Hypothalamic POMC Neuron and Increases Food Intake. Exp. Neurobiol. 2021, 30, 375. [Google Scholar] [CrossRef] [PubMed]
- Bruinstroop, E.; Pei, L.; Ackermans, M.T.; Foppen, E.; Borgers, A.J.; Kwakkel, J.; Alkemade, A.; Fliers, E.; Kalsbeek, A. Hypothalamic neuropeptide Y (NPY) controls hepatic VLDL-triglyceride secretion in rats via the sympathetic nervous system. Diabetes 2012, 61, 1043–1050. [Google Scholar] [CrossRef]
- Shi, Y.-C.; Lau, J.; Lin, Z.; Zhang, H.; Zhai, L.; Sperk, G.; Heilbronn, R.; Mietzsch, M.; Weger, S.; Huang, X.-F. Arcuate NPY controls sympathetic output and BAT function via a relay of tyrosine hydroxylase neurons in the PVN. Cell Metab. 2013, 17, 236–248. [Google Scholar] [CrossRef]
- Sainsbury, A.; Zhang, L. Role of the arcuate nucleus of the hypothalamus in regulation of body weight during energy deficit. Mol. Cell. Endocrinol. 2010, 316, 109–119. [Google Scholar] [CrossRef]
- Panda, S.; Sato, T.K.; Castrucci, A.M.; Rollag, M.D.; DeGrip, W.J.; Hogenesch, J.B.; Provencio, I.; Kay, S.A. Melanopsin (Opn4) requirement for normal light-induced circadian phase shifting. Science 2002, 298, 2213–2216. [Google Scholar] [CrossRef]
- Ruby, N.F.; Brennan, T.J.; Xie, X.; Cao, V.; Franken, P.; Heller, H.C.; O’Hara, B.F. Role of melanopsin in circadian responses to light. Science 2002, 298, 2211–2213. [Google Scholar] [CrossRef]
- Walmsley, L.; Hanna, L.; Mouland, J.; Martial, F.; West, A.; Smedley, A.R.; Bechtold, D.A.; Webb, A.R.; Lucas, R.J.; Brown, T.M. Colour as a signal for entraining the mammalian circadian clock. PLoS Biol. 2015, 13, e1002127. [Google Scholar] [CrossRef]
- Hanna, L.; Walmsley, L.; Pienaar, A.; Howarth, M.; Brown, T.M. Geniculohypothalamic GABAergic projections gate suprachiasmatic nucleus responses to retinal input. J. Physiol. 2017, 595, 3621–3649. [Google Scholar] [CrossRef]
- Huang, L.; Xi, Y.; Peng, Y.; Yang, Y.; Ren, C. A Visual Circuit Related to Habenula Underlies the Antidepressive Effects of Light Therapy. Neuron 2019, 102, 128–142. [Google Scholar] [CrossRef] [PubMed]
- Hanada, M. Correspondence analysis of color-emotion associations. Color Res. Appl. 2018, 43, 224–237. [Google Scholar] [CrossRef]
- Wang, C.Y. The enhancement of appetite through the use of colored light in case of a cake: Preliminary evidence from event-related potentials. Color Res. Appl. 2021, 46, 456–466. [Google Scholar] [CrossRef]
- Rouch, C.; Meile, M.J.; Orosco, M. Extracellular hypothalamic serotonin and plasma amino acids in response to sequential carbohydrate and protein meals. Nutr. Neurosci. 2003, 6, 117–124. [Google Scholar] [CrossRef]
- Rupp, A.C.; Ren, M.; Altimus, C.M.; Fernandez, D.C.; Richardson, M.; Turek, F.; Hattar, S.; Schmidt, T.M. Distinct ipRGC subpopulations mediate light’s acute and circadian effects on body temperature and sleep. Elife 2019, 8, e44358. [Google Scholar] [CrossRef]
- Lucas, R.J.; Lall, G.S.; Allen, A.E.; Brown, T.M. How rod, cone, and melanopsin photoreceptors come together to enlighten the mammalian circadian clock. Prog. Brain Res. 2012, 199, 1–18. [Google Scholar]
- Chung, I.; Kim, S.A.; Kim, S.; Lee, J.O.; Park, C.Y.; Lee, J.; Kang, J.; Lee, J.Y.; Seo, I.; Lee, H.J. Biglycan reduces body weight by regulating food intake in mice and improves glucose metabolism through AMPK/AKT dual pathways in skeletal muscle. FASEB J. 2021, 35, e21794. [Google Scholar] [CrossRef]
Raw Materials | D12450J (10 kcal% Fat) | D12492 (60 kcal% Fat) | ||
---|---|---|---|---|
gm | kcal | gm | kcal | |
Casein | 200 | 800 | 200 | 800 |
L-cystine | 3 | 12 | 3 | 12 |
Corn starch | 506.2 | 2024.8 | 0 | 0 |
Maltodextrin 10 | 125 | 500 | 125 | 500 |
Sucrose | 68.8 | 275.2 | 68.8 | 275.5 |
Cellulose, BW200 | 50 | 0 | 50 | 0 |
Soybean oil | 25 | 225 | 25 | 225 |
Lard | 20 | 180 | 245 | 2205 |
Mineral Mx S10026 | 10 | 0 | 10 | 0 |
Dicalcium phosphate | 13 | 0 | 13 | 0 |
Calcium carbonate | 5.5 | 0 | 5.5 | 0 |
Potassium citrate, 1 H2O | 16.5 | 0 | 16.5 | 0 |
Vitamin Mx V10001 | 10 | 40 | 10 | 40 |
Choline bitartrate | 2 | 0 | 2 | 0 |
FD&C Yellow Dye #5 | 0.04 | 0 | 0 | 0 |
FD&C Blue Dye #1 | 0.01 | 0 | 0.05 | 0 |
Gm% | Kcal% | Gm% | Kcal% | |
Protein | 19.2 | 20 | 26.2 | 20 |
Carbohydrate | 67.3 | 70 | 26.3 | 20.1 |
Fat | 4.3 | 10 | 34.9 | 59.9 |
Total | 100 | 100 | ||
Total | 1055.05 | 4057 | 4057 |
Item | Base Sequence (5′-3′) | |
---|---|---|
Ghrelin | Forward | CATCCCCAGGCATTCCAGGTC |
Reverse | TCGAAGGGAGCATTGAACCTGAT | |
Leptin | Forward | GGAATTCAGGAAAATGTGCTGGAGA |
Reverse | GGAATTCTCAGCATTCAGGGCTAAC | |
NPY | Forward | CGCTCTGCGACACTACATCA |
Reverse | AGGGTCTTCAAGCCTTGTTCT | |
AgRP | Forward | AGAGTTCTCAGGTCTAAGTCT |
Reverse | CTTGAAGAAGCGGCAGTAGCACGT | |
POMC | Forward | CAGCGAGAGGTCGAGTTTG |
Reverse | CTGCTTCAGACCTCCATAGATGTG | |
GAPDH | Forward | CAAGGAGTAAGAAACCCTGGACC, |
Reverse | CGAGTTGGGATAGGGCCTCT |
Parameters | RL | GL | WL |
---|---|---|---|
Serum TC (mmol/L) | 3.15 ± 0.09 a | 2.26 ± 0.21 b | 2.10 ± 0.16 b |
Serum TGs (mmol/L) | 5.78 ± 0.14 a | 2.76 ± 0.42 c | 3.14 ± 0.16 b |
Serum LDL-C (mmol/L) | 3.11 ± 0.33 a | 1.79 ± 0.33 b | 1.45 ± 0.39 c |
Serum HDL-C (mmol/L) | 1.55 ± 0.18 b | 1.68 ± 0.26 b | 1.78 ± 0.26 a |
Serum LDL-C/HDL-C ratio | 2.03 ± 0.26 a | 1.08 ± 0.23 b | 0.83 ± 0.22 c |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Wang, Q.; Li, Q.; Quan, T.; Liang, H.; Li, J.; Li, K.; Ye, S.; Zhu, S.; Li, B. Effects of Illumination Color on Hypothalamic Appetite-Regulating Gene Expression and Glycolipid Metabolism. Nutrients 2024, 16, 4330. https://doi.org/10.3390/nu16244330
Wang Q, Li Q, Quan T, Liang H, Li J, Li K, Ye S, Zhu S, Li B. Effects of Illumination Color on Hypothalamic Appetite-Regulating Gene Expression and Glycolipid Metabolism. Nutrients. 2024; 16(24):4330. https://doi.org/10.3390/nu16244330
Chicago/Turabian StyleWang, Qi, Qianru Li, Tuo Quan, Hongshan Liang, Jing Li, Kaikai Li, Shuxin Ye, Sijia Zhu, and Bin Li. 2024. "Effects of Illumination Color on Hypothalamic Appetite-Regulating Gene Expression and Glycolipid Metabolism" Nutrients 16, no. 24: 4330. https://doi.org/10.3390/nu16244330
APA StyleWang, Q., Li, Q., Quan, T., Liang, H., Li, J., Li, K., Ye, S., Zhu, S., & Li, B. (2024). Effects of Illumination Color on Hypothalamic Appetite-Regulating Gene Expression and Glycolipid Metabolism. Nutrients, 16(24), 4330. https://doi.org/10.3390/nu16244330