Mechanisms Mediating Tart Cherry and Fish Oil Metabolic Effects in Diet-Induced (C57BL/6J) and Genetically (TALYHO/Jng) Obese Mice
Abstract
:1. Introduction
2. Materials and Methods
2.1. Animal Study and Diets
2.2. Body Composition and Adiposity Index
2.3. RNA Extraction, cDNA Preparation, and Real-Time PCR
2.4. Statistical Analyses
3. Results
3.1. Effects of HF Diet on Adiposity
3.2. Effects of Supplemental TC, FO, and Their Combination on Adiposity
3.3. Effects of HF Diet on Inflammatory Markers in WAT
3.4. Effects of Supplemental TC, FO, and Their Combination on Inflammatory Markers in WAT
3.5. Effects of HF Diet on Markers of Fatty Acid Metabolism in WAT
3.6. Effects of Supplemental TC, FO, and Their Combination on Markers of Fatty Acid Metabolism in WAT
3.7. Effects of HF Diet on ER Stress Markers in WAT
3.8. Effects of Supplemental TC, FO, and Their Combination on ER Stress Markers in WAT
3.9. Effects of HF Diet on Autophagy Markers in WAT
3.10. Effects of Supplemental TC, FO, and Their Combination on Autophagy Markers in WAT
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Blüher, M. Obesity: Global epidemiology and pathogenesis. Nat. Rev. Endocrinol. 2019, 15, 288–298. [Google Scholar] [CrossRef] [PubMed]
- Abdelaal, M.; le Roux, C.W.; Docherty, N.G. Morbidity and mortality associated with obesity. Ann. Transl. Med. 2017, 5, 161. [Google Scholar] [CrossRef] [PubMed]
- Pigeyre, M.; Yazdi, F.T.; Kaur, Y.; Meyre, D. Recent progress in genetics, epigenetics and metagenomics unveils the pathophysiology of human obesity. Clin. Sci. 2016, 130, 943–986. [Google Scholar] [CrossRef] [PubMed]
- Masood, B.; Moorthy, M. Causes of obesity: A review. Clin. Med. 2023, 23, 284–291. [Google Scholar] [CrossRef] [PubMed]
- Hagberg, C.E.; Spalding, K.L. White adipocyte dysfunction and obesity-associated pathologies in humans. Nat. Rev. Mol. Cell Biol. 2024, 25, 270–289. [Google Scholar] [CrossRef] [PubMed]
- Zwick, R.K.; Guerrero-Juarez, C.F.; Horsley, V.; Plikus, M.V. Anatomical, physiological, and functional diversity of adipose tissue. Cell Metab. 2018, 27, 68–83. [Google Scholar] [CrossRef]
- Morigny, P.; Boucher, J.; Arner, P.; Langin, D. Lipid and glucose metabolism in white adipocytes: Pathways, dysfunction and therapeutics. Nat. Rev. Endocrinol. 2021, 17, 276–295. [Google Scholar] [CrossRef]
- Jayarathne, S.; Stull, A.J.; Miranda, A.; Scoggin, S.; Claycombe-Larson, K.; Kim, J.H.; Moustaid-Moussa, N. Tart cherry reduces inflammation in adipose tissue of zucker fatty rats and cultured 3T3-L1 adipocytes. Nutrients 2018, 10, 1576. [Google Scholar] [CrossRef]
- Bhattarai, K.R.; Riaz, T.A.; Kim, H.-R.; Chae, H.-J. The aftermath of the interplay between the endoplasmic reticulum stress response and redox signaling. Exp. Mol. Med. 2021, 53, 151–167. [Google Scholar] [CrossRef]
- Tang, C.; Wang, Y.; Chen, D.; Zhang, M.; Xu, J.; Xu, C.; Liu, J.; Kan, J.; Jin, C. Natural polysaccharides protect against diet-induced obesity by improving lipid metabolism and regulating the immune system. Food Res. Int. 2023, 172, 113192. [Google Scholar] [CrossRef] [PubMed]
- Blüher, M.; Aras, M.; Aronne, L.J.; Batterham, R.L.; Giorgino, F.; Ji, L.; Pietiläinen, K.H.; Schnell, O.; Tonchevska, E.; Wilding, J.P. New insights into the treatment of obesity. Diabetes Obes. Metab. 2023, 25, 2058–2072. [Google Scholar] [CrossRef]
- Banwo, K.; Olojede, A.O.; Adesulu-Dahunsi, A.T.; Verma, D.K.; Thakur, M.; Tripathy, S.; Singh, S.; Patel, A.R.; Gupta, A.K.; Aguilar, C.N.; et al. Functional importance of bioactive compounds of foods with Potential Health Benefits: A review on recent trends. Food Biosci. 2021, 43, 101320. [Google Scholar] [CrossRef]
- LeMieux, M.J.; Kalupahana, N.S.; Scoggin, S.; Moustaid-Moussa, N. Eicosapentaenoic acid reduces adipocyte hypertrophy and inflammation in diet-induced obese mice in an adiposity-independent manner. J. Nutr. 2015, 145, 411–417. [Google Scholar] [CrossRef] [PubMed]
- Miguel, M.G. Anthocyanins: Antioxidant and/or anti-inflammatory activities. J. Appl. Pharm. Sci. 2011, 1, 7–15. [Google Scholar]
- Kim, D.-O.; Heo, H.J.; Kim, Y.J.; Yang, H.S.; Lee, C.Y. Sweet and sour cherry phenolics and their protective effects on neuronal cells. J. Agric. Food Chem. 2005, 53, 9921–9927. [Google Scholar] [CrossRef] [PubMed]
- Kirakosyan, A.; Seymour, E.; Llanes, D.E.U.; Kaufman, P.B.; Bolling, S.F. Chemical profile and antioxidant capacities of tart cherry products. Food Chem. 2009, 115, 20–25. [Google Scholar] [CrossRef]
- Santamarina, A.B.; Calder, P.C.; Estadella, D.; Pisani, L.P. Anthocyanins ameliorate obesity-associated metainflammation: Preclinical and clinical evidence. Nutr. Res. 2023, 114, 50–70. [Google Scholar] [CrossRef] [PubMed]
- Escalante-Aburto, A.; Mendoza-Córdova, M.Y.; Mahady, G.B.; Luna-Vital, D.A.; Gutiérrez-Uribe, J.A.; Chuck-Hernández, C. Consumption of dietary anthocyanins and their association with a reduction in obesity biomarkers and the prevention of obesity. Trends Food Sci. Technol. 2023, 140, 104140. [Google Scholar] [CrossRef]
- Oppedisano, F.; Macrì, R.; Gliozzi, M.; Musolino, V.; Carresi, C.; Maiuolo, J.; Bosco, F.; Nucera, S.; Zito, M.C.; Guarnieri, L.; et al. The anti-inflammatory and antioxidant properties of n-3 PUFAs: Their role in cardiovascular protection. Biomedicines 2020, 8, 306. [Google Scholar] [CrossRef] [PubMed]
- Khan, I.; Hussain, M.; Jiang, B.; Zheng, L.; Pan, Y.; Hu, J.; Khan, A.; Ashraf, A.; Zou, X. Omega-3 long-chain polyunsaturated fatty acids: Metabolism and health implications. Progress Lipid Res. 2023, 92, 101255. [Google Scholar] [CrossRef] [PubMed]
- Lepretti, M.; Martucciello, S.; Burgos Aceves, M.A.; Putti, R.; Lionetti, L. Omega-3 fatty acids and insulin resistance: Focus on the regulation of mitochondria and endoplasmic reticulum stress. Nutrients 2018, 10, 350. [Google Scholar] [CrossRef]
- Kalupahana, N.S.; Claycombe, K.; Newman, S.J.; Stewart, T.; Siriwardhana, N.; Matthan, N.; Lichtenstein, A.H.; Moustaid-Moussa, N. Eicosapentaenoic acid prevents and reverses insulin resistance in high-fat diet-induced obese mice via modulation of adipose tissue inflammation. J. Nutr. 2010, 140, 1915–1922. [Google Scholar] [CrossRef] [PubMed]
- Kim, J.H.; Saxton, A.M. The TALLYHO mouse as a model of human type 2 diabetes. In Animal Models in Diabetes Research; Humana Press: Totowa, NJ, USA, 2012; pp. 75–87. [Google Scholar]
- Denvir, J.; Boskovic, G.; Fan, J.; Primerano, D.A.; Parkman, J.K.; Kim, J.H. Whole genome sequence analysis of the TALLYHO/Jng mouse. BMC Genom. 2016, 17, 907. [Google Scholar] [CrossRef]
- Parkman, J.K.; Mao, X.; Dillon, K.; Gudivada, A.; Moustaid-Moussa, N.; Saxton, A.M.; Kim, J.H. Genotype-dependent metabolic responses to semi-purified high-sucrose high-fat diets in the TALLYHO/Jng vs. C57BL/6 mouse during the development of obesity and type 2 diabetes. Exp. Clin. Endocrinol. Diabetes 2016, 124, 622–629. [Google Scholar] [CrossRef] [PubMed]
- Parkman, J.K.; Sklioutovskaya-Lopez, K.; Menikdiwela, K.R.; Freeman, L.; Moustaid-Moussa, N.; Kim, J.H. Effects of high fat diets and supplemental tart cherry and fish oil on obesity and type 2 diabetes in male and female C57BL/6J and TALLYHO/Jng mice. J. Nutr. Biochem. 2021, 94, 108644. [Google Scholar] [CrossRef] [PubMed]
- Mandarim-de-Lacerda, C.A.; Del Sol, M.; Vazquez, B.; Aguila, M.B. Mice as an animal model for the study of adipose tissue and obesity. Int. J. Morphol. 2021, 39, 1521–1528. [Google Scholar] [CrossRef]
- Schemmel, R.; Sclafani, A. Animal models of obesity: Classification and characaterization. Int. J. Obes. 1984, 8, 491–508. [Google Scholar]
- Buettner, R.; Schölmerich, J.; Bollheimer, L.C. High-fat diets: Modeling the metabolic disorders of human obesity in rodents. Obesity 2007, 15, 798–808. [Google Scholar] [CrossRef] [PubMed]
- Hariri, N.; Thibault, L. High-fat diet-induced obesity in animal models. Nutr. Res. Rev. 2010, 23, 270–299. [Google Scholar] [CrossRef] [PubMed]
- Mobbs, C.V.; Mastaitis, J.; Yen, K.; Schwartz, J.; Mohan, V.; Poplawski, M.; Isoda, F. Low-carbohydrate diets cause obesity, low-carbohydrate diets reverse obesity: A metabolic mechanism resolving the paradox. Appetite 2007, 48, 135–138. [Google Scholar] [CrossRef] [PubMed]
- Nakamura, S.; Narimatsu, H.; Sato, H.; Sho, R.; Otani, K.; Kawasaki, R.; Karasawa, S.; Daimon, M.; Yamashita, H.; Kubota, I.; et al. Gene–environment interactions in obesity: Implication for future applications in preventive medicine. J. Hum. Genet. 2016, 61, 317–322. [Google Scholar] [CrossRef] [PubMed]
- Pahlavani, M.; Ramalingam, L.; Miller, E.K.; Davis, H.; Scoggin, S.; Moustaid-Moussa, N. Discordant dose-dependent metabolic effects of eicosapentanoic acid in diet-induced obese mice. Nutrients 2020, 12, 1342. [Google Scholar] [CrossRef]
- Nemes, A.; Homoki, J.R.; Kiss, R.; Hegedűs, C.; Kovács, D.; Peitl, B.; Gál, F.; Stündl, L.; Szilvássy, Z.; Remenyik, J. Effect of anthocyanin-rich tart cherry extract on inflammatory mediators and adipokines involved in type 2 diabetes in a high fat diet induced obesity mouse model. Nutrients 2019, 11, 1966. [Google Scholar] [CrossRef]
- He, M.; Wang, J.; Wang, Y.; Sui, J.; Zhang, M.; Ding, X.; Zhao, Y.; Chen, Z.; Ren, X.; Shi, B. High-fat diet-induced adipose tissue expansion occurs prior to insulin resistance in C57BL/6J mice. Chronic Dis. Transl. Med. 2020, 6, 198–207. [Google Scholar] [CrossRef]
- van der Heijden, R.A.; Sheedfar, F.; Morrison, M.C.; Hommelberg, P.P.; Kor, D.; Kloosterhuis, N.J.; Gruben, N.; A Youssef, S.; de Bruin, A.; Hofker, M.H.; et al. High-fat diet induced obesity primes inflammation in adipose tissue prior to liver in C57BL/6j mice. Aging 2015, 7, 256–268. [Google Scholar] [CrossRef] [PubMed]
- Strissel, K.J.; Stancheva, Z.; Miyoshi, H.; Perfield, J.W., 2nd; DeFuria, J.; Jick, Z.; Greenberg, A.S.; Obin, M.S. Adipocyte death, adipose tissue remodeling, and obesity complications. Diabetes 2007, 56, 2910–2918. [Google Scholar] [CrossRef] [PubMed]
- Kiran, S.; Rakib, A.; Kodidela, S.; Kumar, S.; Singh, U.P. High-fat diet-induced dysregulation of immune cells correlates with macrophage phenotypes and chronic inflammation in adipose tissue. Cells 2022, 11, 1327. [Google Scholar] [CrossRef]
- Martin, K.R.; Burrell, L.; Bopp, J. Authentic tart cherry juice reduces markers of inflammation in overweight and obese subjects: A randomized, crossover pilot study. Food Funct. 2018, 9, 5290–5300. [Google Scholar] [CrossRef]
- da Cunha de Sá, R.D.C.; Cruz, M.M.; de Farias, T.M.; da Silva, V.S.; de Jesus Simão, J.; Telles, M.M.; Alonso-Vale, M.I.C. Fish oil reverses metabolic syndrome, adipocyte dysfunction, and altered adipokines secretion triggered by high-fat diet-induced obesity. Physiol. Rep. 2020, 8, e14380. [Google Scholar] [CrossRef]
- Yang, B.; Ren, X.-L.; Li, Z.-H.; Shi, M.-Q.; Ding, F.; Su, K.-P.; Guo, X.-J.; Li, D. Lowering effects of fish oil supplementation on proinflammatory markers in hypertension: Results from a randomized controlled trial. Food Funct. 2020, 11, 1779–1789. [Google Scholar] [CrossRef] [PubMed]
- Pahlavani, M.; Davis, H.; Miller, E.; Ramalingam, L.; Scoggin, S.; Moustaid-Moussa, N. Dose-Dependent Anti-Inflammatory and Metabolic Effects of Eicosapentaenoic Acid in Diet-Induced Obese Mice. FASEB J. 2020, 34, 1. [Google Scholar] [CrossRef]
- Voigt, A.; Agnew, K.; van Schothorst, E.M.; Keijer, J.; Klaus, S. Short-term, high fat feeding-induced changes in white adipose tissue gene expression are highly predictive for long-term changes. Mol. Nutr. Food Res. 2013, 57, 1423–1434. [Google Scholar] [CrossRef] [PubMed]
- Hunter, C.A.; Kartal, F.; Koc, Z.C.; Murphy, T.; Kim, J.H.; Denvir, J.; Koc, E.C. Mitochondrial oxidative phosphorylation is impaired in TALLYHO mice, a new obesity and type 2 diabetes animal model. Int. J. Biochem. Cell Biol. 2019, 116, 105616. [Google Scholar] [CrossRef] [PubMed]
- Kawasaki, N.; Asada, R.; Saito, A.; Kanemoto, S.; Imaizumi, K. Obesity-induced endoplasmic reticulum stress causes chronic inflammation in adipose tissue. Sci. Rep. 2012, 2, 799. [Google Scholar] [CrossRef] [PubMed]
- Suzuki, T.; Gao, J.; Ishigaki, Y.; Kondo, K.; Sawada, S.; Izumi, T.; Uno, K.; Kaneko, K.; Tsukita, S.; Takahashi, K.; et al. ER stress protein CHOP mediates insulin resistance by modulating adipose tissue macrophage polarity. Cell Rep. 2017, 18, 2045–2057. [Google Scholar] [CrossRef]
- Martinelli, I.; Di Bonaventura, M.V.M.; Moruzzi, M.; Amantini, C.; Maggi, F.; Gabrielli, M.G.; Fruganti, A.; Marchegiani, A.; Dini, F.; Marini, C.; et al. Effects of Prunus cerasus L. seeds and juice on liver steatosis in an animal model of diet-induced obesity. Nutrients 2020, 12, 1308. [Google Scholar] [CrossRef]
- Ferreira, G.; Vieira, P.; Alves, A.; Nunes, S.; Preguiça, I.; Martins-Marques, T.; Ribeiro, T.; Girão, H.; Figueirinha, A.; Salgueiro, L.; et al. Effect of Blueberry Supplementation on a Diet-Induced Rat Model of Prediabetes—Focus on Hepatic Lipid Deposition, Endoplasmic Stress Response and Autophagy. Nutrients 2024, 16, 513. [Google Scholar] [CrossRef] [PubMed]
- Yang, W.; Chen, X.; Chen, M.; Li, Y.; Li, Q.; Jiang, X.; Yang, Y.; Ling, W. Fish oil supplementation inhibits endoplasmic reticulum stress and improves insulin resistance: Involvement of AMP-activated protein kinase. Food Funct. 2017, 8, 1481–1493. [Google Scholar] [CrossRef]
- Mizushima, N. Physiological functions of autophagy. Autophagy Infect. Immun. 2009, 335, 71–84. [Google Scholar]
- Rabinowitz, J.D.; White, E. Autophagy and metabolism. Science 2010, 330, 1344–1348. [Google Scholar] [CrossRef] [PubMed]
- Romero, M.; Zorzano, A. Role of autophagy in the regulation of adipose tissue biology. Cell Cycle 2019, 18, 1435–1445. [Google Scholar] [CrossRef] [PubMed]
- Menikdiwela, K.R.; Ramalingam, L.; Rasha, F.; Wang, S.; Dufour, J.M.; Kalupahana, N.S.; Sunahara, K.K.S.; Martins, J.O.; Moustaid-Moussa, N. Autophagy in metabolic syndrome: Breaking the wheel by targeting the renin–angiotensin system. Cell Death Dis. 2020, 11, 87. [Google Scholar] [CrossRef] [PubMed]
- Zhang, Y.; Sowers, J.R.; Ren, J. Targeting autophagy in obesity: From pathophysiology to management. Nat. Rev. Endocrinol. 2018, 14, 356–376. [Google Scholar] [CrossRef]
- Daneshyar, S.; Tavoosidana, G.; Bahmani, M.; Basir, S.S.; Delfan, M.; Laher, I.; Saeidi, A.; Granacher, U.; Zouhal, H. Combined effects of high fat diet and exercise on autophagy in white adipose tissue of mice. Life Sci. 2023, 314, 121335. [Google Scholar] [CrossRef] [PubMed]
- Budi, Y.P.; Li, Y.-H.; Huang, C.; Wang, M.-E.; Lin, Y.-C.; Jong, D.-S.; Chiu, C.-H.; Jiang, Y.-F. The role of autophagy in high-fat diet-induced insulin resistance of adipose tissues in mice. PeerJ 2022, 10, e13867. [Google Scholar] [CrossRef] [PubMed]
- Deng, Y.; Xu, J.; Zhang, X.; Yang, J.; Zhang, D.; Huang, J.; Lv, P.; Shen, W.; Yang, Y. Berberine attenuates autophagy in adipocytes by targeting BECN1. Autophagy 2014, 10, 1776–1786. [Google Scholar] [CrossRef] [PubMed]
- Mizunoe, Y.; Sudo, Y.; Okita, N.; Hiraoka, H.; Mikami, K.; Narahara, T.; Negishi, A.; Yoshida, M.; Higashibata, R.; Watanabe, S.; et al. Involvement of lysosomal dysfunction in autophagosome accumulation and early pathologies in adipose tissue of obese mice. Autophagy 2017, 13, 642–653. [Google Scholar] [CrossRef]
- Ju, L.; Han, J.; Zhang, X.; Deng, Y.; Yan, H.; Wang, C.; Li, X.; Chen, S.; Alimujiang, M.; Li, X.; et al. Obesity-associated inflammation triggers an autophagy–lysosomal response in adipocytes and causes degradation of perilipin 1. Cell Death Dis. 2019, 10, 121. [Google Scholar] [CrossRef]
- Zhang, T.; Liu, J.; Tong, Q.; Lin, L. SIRT3 acts as a positive autophagy regulator to promote lipid mobilization in adipocytes via activating AMPK. Int. J. Mol. Sci. 2020, 21, 372. [Google Scholar] [CrossRef] [PubMed]
- Sakane, S.; Hikita, H.; Shirai, K.; Myojin, Y.; Sasaki, Y.; Kudo, S.; Fukumoto, K.; Mizutani, N.; Tahata, Y.; Makino, Y.; et al. White adipose tissue autophagy and adipose-liver crosstalk exacerbate nonalcoholic fatty liver disease in mice. Cell. Mol. Gastroenterol. Hepatol. 2021, 12, 1683–1699. [Google Scholar] [CrossRef] [PubMed]
- López-Vicario, C.; Alcaraz-Quiles, J.; García-Alonso, V.; Rius, B.; Hwang, S.H.; Titos, E.; Lopategi, A.; Hammock, B.D.; Arroyo, V.; Clària, J. Inhibition of soluble epoxide hydrolase modulates inflammation and autophagy in obese adipose tissue and liver: Role for omega-3 epoxides. Proc. Natl. Acad. Sci. USA 2015, 112, 536–541. [Google Scholar] [CrossRef] [PubMed]
- Baseggio, A.M.; Nuñez, C.E.C.; Dragano, N.R.V.; Lamas, C.A.; Braga, P.A.d.C.; Lenquiste, S.A.; Reyes, F.G.R.; Cagnon, V.H.A.; Júnior, M.R.M. Jaboticaba peel extract decrease autophagy in white adipose tissue and prevents metabolic disorders in mice fed with a high-fat diet. PharmaNutrition 2018, 6, 147–156. [Google Scholar] [CrossRef]
LF | HF | HF | HF | HF | |
---|---|---|---|---|---|
TC | FO | TC + FO | |||
Ingredient (g) | |||||
Casein | 200 | 200 | 195.6 | 200 | 195.6 |
Corn starch | 427 | 38 | 35.5 | 38 | 35.5 |
Sucrose | 172.8 | 172.8 | 144 | 172.8 | 144 |
Soybean oil | 25 | 25 | 25 | 25 | 25 |
Lard | 20 | 193 | 193 | 144 | 144 |
Menhaden oil | 0 | 0 | 0 | 49 | 49 |
Tart cherry powder | 0 | 0 | 43 | 0 | 43 |
Total | 1055 | 849 | 855 | 849 | 855 |
g% | |||||
Protein | 17.0 | 21.1 | 20.9 | 21.1 | 20.9 |
Carbohydrate | 66.3 | 37.8 | 37.5 | 37.8 | 37.5 |
Fat | 4.5 | 26.0 | 25.8 | 26.0 | 25.8 |
Fiber | 4.7 | 5.9 | 6.3 | 5.9 | 6.3 |
Tart cherry powder | 0.0 | 0.0 | 5.0 | 0.0 | 5.0 |
Kcal% | |||||
Protein | 18 | 18 | 18 | 18 | 18 |
Carbohydrate | 71 | 32 | 32 | 32 | 32 |
Fat | 11 | 50 | 50 | 50 | 50 |
Gene | Forward | Reverse |
---|---|---|
Il6 | AACCGCTATGAAGTTCCTCTC | TCCTCTGTGAAGTCTCCTCTC |
Tnfa | CGTGGAACTGGCAGAAGAG | TGAGAAGAGGCTGAGACATAGG |
Mcp1 | ACTTCTATGCCTCCTGCTCAT | GCTGCTTGTGATTCTCCTGTAG |
Tlr4 | AGTAGCACTGACACCTTCCTT | GCCTTAGCCTCTTCTCCTTCA |
Il1β | GTCACAAGAAACCATGGCACAT | GCCCATCAGAGGCAAGGA |
Cd80 | GTCGTCGTCATCGTTGTCAT | CCGAAGGTAAGGCTGTTGTT |
Arg1 | CCTATCACCGCAGAACCT | GCATCATACAACGAGGAGTG |
Fasn | TGCAGAAGATGTAGATTGTGTGATGA | GGGTCCGGGTGCAGTTTATT |
Acaca | GCAGCAGTTACACCACATACA | CATTACCTCAATCTCAGCATAGCA |
Cpt1a | GAGACAGACACCATCCAACAC | GAGCCAGACCTTGAAGTAACG |
TXbp1 | TGGCCGGGTCTGCTGAGTCCG | GTCCATGGGAAGATGTTCTGG |
Bip | TTCAGCCAATTATCAGCAAACTCT | TTTTCTGATGTATCCTCTTCACCAGT |
Chop | CCACCACACCTGAAAGCAGAA | AGGTGAAAGGCAGGGACTCA |
Atf4 | GGGTTCTGTCTTCCACTCCA | AAGCAGCAGAGTCAGGCTTTC |
Atg5 | TCAGAAGGTTATGAGACAAGAAGA | GGATGGACAGTGTAGAAGGT |
Atg12 | AGCAGGAAGAGTGAACCA | AAGCACATAGAGACGAGAAGT |
Beclin1 | GAGATTGGACCAGGAGGAA | AGGTGGCATTGAAGACATTG |
LF vs. HF | Main Effects | Interactions | ||
---|---|---|---|---|
Variable | Statistic | Sex (S) | Diet (D) | S × D |
Il6 | p | 0.0005 | 0.0141 | 0.0136 |
F (1, 18) | 17.59 | 7.388 | 7.489 | |
Tnfα | p | 0.1472 | 0.0191 | 0.0336 |
F (1, 17) | 2.307 | 6.702 | 5.341 | |
Mcp1 | p | 0.1163 | 0.0546 | 0.2293 |
F (1, 14) | 2.803 | 4.398 | 1.580 | |
Tlr4 | p | 0.8333 | <0.0001 | 0.1185 |
F (1, 15) | 0.04587 | 39.04 | 2.742 | |
Il1β | p | 0.0782 | 0.0074 | 0.0804 |
F (1, 17) | 3.512 | 9.251 | 3.456 | |
Cd80 | p | 0.0419 | 0.0019 | 0.2910 |
F (1, 18) | 4.796 | 13.23 | 1.184 | |
Arg1 | p | 0.0002 | <0.0001 | 0.0178 |
F (1, 16) | 23.74 | 43.20 | 6.978 | |
Fasn | p | 0.1998 | 0.0008 | 0.9311 |
F (1, 17) | 1.779 | 16.40 | 0.007694 | |
Acaca | p | 0.0593 | 0.0100 | 0.9628 |
F (1, 18) | 4.054 | 8.290 | 0.002242 | |
Cpt1 | p | 0.0001 | 0.0014 | 0.3152 |
F (1, 18) | 24.11 | 14.28 | 1.067 | |
TXbp1 | p | 0.6466 | 0.0208 | 0.0162 |
F (1, 17) | 0.2178 | 6.493 | 7.128 | |
Bip | p | 0.6358 | 0.0573 | 0.0063 |
F (1, 16) | 0.2331 | 4.197 | 9.891 | |
Chop | p | 0.2832 | 0.1055 | 0.2537 |
F (1, 18) | 1.224 | 2.905 | 1.390 | |
Atf4 | p | 0.0433 | 0.0051 | 0.9859 |
F (1, 18) | 4.726 | 10.18 | 0.0003198 | |
Atg5 | p | 0.3899 | 0.0114 | 0.0896 |
F (1, 20) | 0.7725 | 7.771 | 3.184 | |
Atg12 | p | 0.5629 | 0.1215 | 0.5454 |
F (1, 18) | 0.3474 | 2.641 | 0.3799 | |
Beclin1 | p | <0.0001 | <0.0001 | <0.0001 |
F (1, 18) | 88.08 | 316.6 | 252.2 |
LF vs. HF | Main Effects | Interactions | ||
---|---|---|---|---|
Variable | Statistic | Sex (S) | Diet (D) | S × D |
Il6 | p | 0.0007 | <0.0001 | 0.9186 |
F (1, 19) | 16.28 | 59.38 | 0.01073 | |
Tnfα | p | 0.3128 | 0.0823 | 0.1703 |
F (1, 18) | 1.079 | 3.386 | 2.040 | |
Mcp1 | p | 0.0114 | 0.0053 | 0.3187 |
F (1, 20) | 7.770 | 9.775 | 1.046 | |
Tlr4 | p | 0.0007 | 0.0094 | 0.9304 |
F (1, 20) | 16.14 | 8.244 | 0.007814 | |
Il1β | p | <0.0001 | 0.0006 | 0.0774 |
F (1, 18) | 39.10 | 17.23 | 3.509 | |
Cd80 | p | 0.1935 | <0.0001 | 0.6845 |
F (1, 20) | 1.810 | 40.65 | 0.1700 | |
Arg1 | p | 0.0033 | <0.0001 | 0.3014 |
F (1, 20) | 11.13 | 35.53 | 1.125 | |
Fasn | p | 0.0045 | <0.0001 | 0.0164 |
F (1, 20) | 10.26 | 27.04 | 6.860 | |
Acaca | p | 0.0003 | <0.0001 | 0.0034 |
F (1, 20) | 18.70 | 34.59 | 11.01 | |
Cpt1 | p | 0.7260 | 0.0074 | 0.7667 |
F (1, 19) | 0.1265 | 8.978 | 0.09060 | |
TXbp1 | p | 0.0004 | <0.0001 | 0.0484 |
F (1, 20) | 18.01 | 27.74 | 4.418 | |
Bip | p | 0.0660 | 0.0033 | 0.0052 |
F (1, 20) | 3.781 | 11.14 | 9.862 | |
Chop | p | 0.0037 | <0.0001 | 0.0015 |
F (1, 20) | 10.80 | 25.67 | 13.53 | |
Atf4 | p | 0.5831 | 0.2961 | 0.0017 |
F (1, 17) | 0.3131 | 1.162 | 13.87 | |
Atg5 | p | <0.0001 | <0.0001 | 0.2165 |
F (1, 20) | 44.64 | 25.39 | 1.629 | |
Atg12 | p | 0.0527 | <0.0001 | 0.0187 |
F (1, 19) | 4.272 | 33.39 | 6.608 | |
Beclin1 | p | 0.1516 | 0.0011 | 0.0329 |
F (1, 20) | 2.223 | 14.65 | 5.254 |
HF vs. Treatments | Main Effects | Interactions | ||
---|---|---|---|---|
Variable | Statistic | Sex (S) | Diet (D) | S × D |
Mcp1 | p | 0.9336 | 0.1660 | 0.0813 |
F (1, 30) | 0.007051 | |||
F (3, 30) | 1.813 | 2.467 | ||
Tlr4 | p | <0.0001 | 0.1599 | 0.0002 |
F (1, 30) | 34.97 | |||
F (3, 30) | 1.847 | 8.887 | ||
Il1β | p | 0.2391 | 0.0527 | 0.3453 |
F (1, 34) | 1.436 | |||
F (3, 34) | 2.834 | 1.144 | ||
Bip | p | 0.0016 | 0.9487 | 0.0001 |
F (1, 34) | 11.76 | |||
F (3, 34) | 0.1183 | 9.110 | ||
Chop | p | 0.0015 | 0.4290 | 0.0651 |
F (1, 36) | 11.77 | |||
F (3, 36) | 0.9452 | 2.627 | ||
TXbp1 | p | 0.1737 | 0.3852 | 0.0455 |
F (1, 34) | 1.931 | |||
F (3, 34) | 1.045 | 2.969 | ||
Beclin1 | p | 0.0025 | <0.0001 | <0.0001 |
F (1, 36) | 10.55 | |||
F (3, 36) | 30.41 | 48.30 | ||
Atg5 | p | 0.2895 | 0.3579 | 0.0422 |
F (1, 36) | 1.156 | |||
F (3, 36) | 1.110 | 3.020 | ||
Atg12 | p | 0.0322 | 0.2548 | 0.1505 |
F (1, 38) | 4.943 | |||
F (3, 38) | 1.410 | 1.873 |
HF vs. Treatments | Main Effects | Interactions | ||
---|---|---|---|---|
Variable | Statistic | Sex (S) | Diet (D) | S × D |
Mcp1 | p | 0.0019 | 0.0430 | 0.4679 |
F (1, 38) | 11.11 | |||
F (3, 38) | 2.988 | 0.8644 | ||
Tlr4 | p | 0.0088 | 0.0068 | 0.1877 |
F (1, 38) | 7.640 | |||
F (3, 38) | 4.721 | 1.679 | ||
Il1β | p | 0.0003 | 0.0891 | 0.0454 |
F (1, 35) | 15.76 | |||
F (3, 35) | 2.351 | 2.962 | ||
Bip | p | 0.4521 | 0.2923 | 0.3137 |
F (1, 39) | 0.5769 | |||
F (3, 39) | 1.287 | 1.225 | ||
Chop | p | 0.0013 | <0.0001 | 0.0012 |
F (1, 38) | 11.98 | |||
F (3, 38) | 10.65 | 6.515 | ||
TXbp1 | ps | <0.0001 | 0.0003 | 0.1131 |
F (1, 37) | 33.99 | |||
F (3, 37) | 7.985 | 2.129 | ||
Beclin1 | p | 0.1099 | 0.0026 | 0.5592 |
F (1, 39) | 2.677 | |||
F (3, 39) | 5.641 | 0.6975 | ||
Atg5 | p | <0.0001 | 0.0004 | 0.6903 |
F (1, 37) | 54.46 | |||
F (3, 37) | 7.852 | 0.4916 | ||
Atg12 | p | 0.0613 | 0.0007 | 0.4191 |
F (1, 37) | 3.725 | |||
F (3, 37) | 7.071 | 0.9658 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Seifishahpar, M.; Kim, J.H.; Parkman, J.K.; Rhode, A.; Menikdiwela, K.; Zu, Y.; Scoggin, S.; Freeman, L.; Kalupahana, N.S.; Moustaid-Moussa, N. Mechanisms Mediating Tart Cherry and Fish Oil Metabolic Effects in Diet-Induced (C57BL/6J) and Genetically (TALYHO/Jng) Obese Mice. Nutrients 2024, 16, 4179. https://doi.org/10.3390/nu16234179
Seifishahpar M, Kim JH, Parkman JK, Rhode A, Menikdiwela K, Zu Y, Scoggin S, Freeman L, Kalupahana NS, Moustaid-Moussa N. Mechanisms Mediating Tart Cherry and Fish Oil Metabolic Effects in Diet-Induced (C57BL/6J) and Genetically (TALYHO/Jng) Obese Mice. Nutrients. 2024; 16(23):4179. https://doi.org/10.3390/nu16234179
Chicago/Turabian StyleSeifishahpar, Maryam, Jung Han Kim, Jacaline K. Parkman, Ana Rhode, Kalhara Menikdiwela, Yujiao Zu, Shane Scoggin, Logan Freeman, Nishan Sudheera Kalupahana, and Naima Moustaid-Moussa. 2024. "Mechanisms Mediating Tart Cherry and Fish Oil Metabolic Effects in Diet-Induced (C57BL/6J) and Genetically (TALYHO/Jng) Obese Mice" Nutrients 16, no. 23: 4179. https://doi.org/10.3390/nu16234179
APA StyleSeifishahpar, M., Kim, J. H., Parkman, J. K., Rhode, A., Menikdiwela, K., Zu, Y., Scoggin, S., Freeman, L., Kalupahana, N. S., & Moustaid-Moussa, N. (2024). Mechanisms Mediating Tart Cherry and Fish Oil Metabolic Effects in Diet-Induced (C57BL/6J) and Genetically (TALYHO/Jng) Obese Mice. Nutrients, 16(23), 4179. https://doi.org/10.3390/nu16234179