Anti-Obesity Effects of Pleurotus ferulae Water Extract on 3T3-L1 Adipocytes and High-Fat-Diet-Induced Obese Mice
Abstract
:1. Introduction
2. Materials and Methods
2.1. Materials and Reagents
2.2. P. ferulae Extract Preparation
2.3. Animal Experiment
2.4. Histological Analysis
2.5. Cell Culture
2.6. Cell Viability Assay
2.7. ORO Staining
2.8. Western Blot Analysis
2.9. RNA Analysis
2.10. Total Phenolic Content
2.11. Total Flavonoid Content
2.12. Total Polysaccharide Content
2.13. Statistical Analysis
3. Results
3.1. Effects of the PWE on Body Weight Changes in HFD-Induced Obese Mice
3.2. Effects of PWE on Body Fat Mass and Adipocyte Area in HFD-Induced Obese Mice
3.3. Effects of PWE on Serum TC and LDL-C Levels in HFD-Induced Obese Mice
3.4. Effects of PWE on Lipid Accumulation in 3T3-L1 Adipocytes
3.5. Effects of PWE on Lipid Metabolism-Related Factors in 3T3-L1 Adipocytes
3.6. Analysis of the Major Bioactive Compounds in PWE
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Longo, M.; Zatterale, F.; Naderi, J.; Parrillo, L.; Formisano, P.; Raciti, G.A.; Beguinot, F.; Miele, C. Adipose Tissue Dysfunction as Determinant of Obesity-Associated Metabolic Complications. Int. J. Mol. Sci. 2019, 20, 2358. [Google Scholar] [CrossRef] [PubMed]
- Guo, L.; Li, X.; Tang, Q.-Q. Transcriptional regulation of adipocyte differentiation: A central role for CCAAT/enhancer-binding protein (C/EBP) β. J. Biol. Chem. 2015, 290, 755–761. [Google Scholar] [CrossRef] [PubMed]
- Zuo, Y.; Qiang, L.; Farmer, S.R. Activation of CCAAT/enhancer-binding protein (C/EBP) α expression by C/EBPβ during adipogenesis requires a peroxisome proliferator-activated receptor-γ-associated repression of HDAC1 at the C/ebpα gene promoter. J. Biol. Chem. 2006, 281, 7960–7967. [Google Scholar] [CrossRef] [PubMed]
- Audano, M.; Pedretti, S.; Caruso, D.; Crestani, M.; De Fabiani, E.; Mitro, N. Regulatory mechanisms of the early phase of white adipocyte differentiation: An overview. Cell Mol. Life Sci. 2022, 79, 139. [Google Scholar] [CrossRef]
- Pettinelli, P.; Videla, L.A. Up-regulation of PPAR-γ mRNA expression in the liver of obese patients: An additional reinforcing lipogenic mechanism to SREBP-1c induction. J. Clin. Endocrinol. Metab. 2011, 96, 1424–1430. [Google Scholar] [CrossRef]
- Vekic, J.; Zeljkovic, A.; Stefanovic, A.; Jelic-Ivanovic, Z.; Spasojevic-Kalimanovska, V. Obesity and dyslipidemia. Metabolism 2019, 92, 71–81. [Google Scholar] [CrossRef]
- Giudetti, A.M. Editorial: Lipid metabolism in obesity. Front. Physiol. 2023, 14, 1268288. [Google Scholar] [CrossRef]
- Vekic, J.; Stefanovic, A.; Zeljkovic, A. Obesity and Dyslipidemia: A Review of Current Evidence. Curr. Obes. Rep. 2023, 12, 207–222. [Google Scholar] [CrossRef]
- Stadler, J.T.; Marsche, G. Obesity-related changes in high-density lipoprotein metabolism and function. Int. J. Mol. Sci. 2020, 21, 8985. [Google Scholar] [CrossRef]
- Zhou, M.; Huang, J.; Zhou, J.; Zhi, C.; Bai, Y.; Che, Q.; Cao, H.; Guo, J.; Su, Z. Anti-Obesity Effect and Mechanism of Chitooligosaccharides Were Revealed Based on Lipidomics in Diet-Induced Obese Mice. Molecules 2023, 28, 5595. [Google Scholar] [CrossRef]
- Li, J.; Wu, H.; Liu, Y.; Yang, L. High fat diet induced obesity model using four strains of mice: Kunming, C57BL/6, BALB/c and ICR. Exp. Anim. 2020, 69, 326–335. [Google Scholar] [CrossRef] [PubMed]
- Sumaira, S.; Muhammad, S.; Muhammad, M.; Sumia, A.; Ayoub, R. Wild Mushrooms: A Potential Source of Nutritional and Antioxidant Attributes with Acceptable Toxicity. Prev. Nutr. Food Sci. 2017, 22, 124–130. [Google Scholar]
- Ganesan, K.; Xu, B. Anti-Obesity Effects of Medicinal and Edible Mushrooms. Molecules 2018, 23, 2880. [Google Scholar] [CrossRef] [PubMed]
- Cirlincione, F.; Gargano, M.L.; Venturella, G.; Mirabile, G. Conservation Strategies of the Culinary-Medicinal Mushroom Pleurotus nebrodensis (Basidiomycota, Fungi). In Proceedings of the 2nd International Electronic Conference on Diversity (IECD 2022)—New Insights into the Biodiversity of Plants, Animals and Microbes, Online, 15–31 March 2022. [Google Scholar]
- Wang, W.; Chen, K.; Liu, Q.; Johnston, N.; Ma, Z.; Zhang, F.; Zheng, X. Suppression of tumor growth by Pleurotus ferulae ethanol extract through induction of cell apoptosis, and inhibition of cell proliferation and migration. PLoS ONE 2014, 9, e102673. [Google Scholar] [CrossRef] [PubMed]
- Gutfinger, T. Polyphenols in olive oils. J. Am. Oil Chem. Soc. 1981, 58, 966–968. [Google Scholar] [CrossRef]
- Moreno, M.I.N.; Isla, M.I.; Sampietro, A.R.; Vattuone, M.A. Comparison of the free radical-scavenging activity of propolis from several regions of Argentina. J. Ethnopharmacol. 2000, 71, 109–114. [Google Scholar] [CrossRef]
- DuBois, M.; Gilles, K.A.; Hamilton, J.K.; Rebers, P.t.; Smith, F. Colorimetric method for determination of sugars and related substances. Anal. Chem. 1956, 28, 350–356. [Google Scholar] [CrossRef]
- Björntorp, P. Metabolic implications of body fat distribution. Diabetes Care 1991, 14, 1132–1143. [Google Scholar] [CrossRef]
- Sarma, S.; Sockalingam, S.; Dash, S. Obesity as a multisystem disease: Trends in obesity rates and obesity-related complications. Diabetes Obes. Metab. 2021, 23 (Suppl. S1), 3–16. [Google Scholar] [CrossRef]
- Gasmi, A.; Noor, S.; Menzel, A.; Pivina, L.; Bjørklund, G. Obesity and insulin resistance: Associations with chronic inflammation, genetic and epigenetic factors. Curr. Med. Chem. 2021, 28, 800–826. [Google Scholar] [CrossRef]
- Hwang, I.; Kim, J.B. Two faces of white adipose tissue with heterogeneous adipogenic progenitors. Diabetes Metab. J. 2019, 43, 752–762. [Google Scholar] [CrossRef] [PubMed]
- Ambele, M.A.; Dhanraj, P.; Giles, R.; Pepper, M.S. Adipogenesis: A complex interplay of multiple molecular determinants and pathways. Int. J. Mol. Sci. 2020, 21, 4283. [Google Scholar] [CrossRef] [PubMed]
- Oger, F.; Dubois-Chevalier, J.; Gheeraert, C.; Avner, S.; Durand, E.; Froguel, P.; Salbert, G.; Staels, B.; Lefebvre, P.; Eeckhoute, J. Peroxisome proliferator-activated receptor γ regulates genes involved in insulin/insulin-like growth factor signaling and lipid metabolism during adipogenesis through functionally distinct enhancer classes. J. Biol. Chem. 2014, 289, 708–722. [Google Scholar] [CrossRef] [PubMed]
- Kopchick, J.J.; Berryman, D.E.; Puri, V.; Lee, K.Y.; Jorgensen, J.O. The effects of growth hormone on adipose tissue: Old observations, new mechanisms. Nat. Rev. Endocrinol. 2020, 16, 135–146. [Google Scholar] [CrossRef] [PubMed]
- Mustafa, F.; Chopra, H.; Baig, A.A.; Avula, S.K.; Kumari, S.; Mohanta, T.K.; Saravanan, M.; Mishra, A.K.; Sharma, N.; Mohanta, Y.K. Edible Mushrooms as Novel Myco-Therapeutics: Effects on Lipid Level, Obesity and BMI. J. Fungi 2022, 8, 211. [Google Scholar] [CrossRef]
- Abdelshafy, A.M.; Belwal, T.; Liang, Z.; Wang, L.; Li, D.; Luo, Z.; Li, L. A comprehensive review on phenolic compounds from edible mushrooms: Occurrence, biological activity, application and future prospective. Crit. Rev. Food Sci. Nutr. 2022, 62, 6204–6224. [Google Scholar] [CrossRef]
- Bahadori, M.B.; Sarikurkcu, C.; Yalcin, O.U.; Cengiz, M.; Gungor, H. Metal concentration, phenolics profiling, and antioxidant activity of two wild edible Melanoleuca mushrooms (M. cognata and M. stridula). Microchem. J. 2019, 150, 104172. [Google Scholar] [CrossRef]
- Sezgin, S.; Dalar, A.; Uzun, Y. Determination of antioxidant activities and chemical composition of sequential fractions of five edible mushrooms from Turkey. J. Food Sci. Technol. 2020, 57, 1866–1876. [Google Scholar] [CrossRef]
- Hu, Q.; Yuan, B.; Xiao, H.; Zhao, L.; Wu, X.; Rakariyatham, K.; Zhong, L.; Han, Y.; Kimatu, B.M.; Yang, W. Polyphenols-rich extract from Pleurotus eryngii with growth inhibitory of HCT116 colon cancer cells and anti-inflammatory function in RAW264.7 cells. Food Funct. 2018, 9, 1601–1611. [Google Scholar] [CrossRef]
- Fukushima, M.; Nakano, M.; Morii, Y.; Ohashi, T.; Fujiwara, Y.; Sonoyama, K. Hepatic LDL Receptor mRNA in Rats Is Increased by Dietary Mushroom (Agaricus bisporus) Fiber and Sugar Beet Fiber. J. Nutr. 2000, 130, 2151–2156. [Google Scholar] [CrossRef]
- Hiwatashi, K.; Kosaka, Y.; Suzuki, N.; Hata, K.; Mukaiyama, T.; Sakamoto, K.; Shirakawa, H.; Komai, M. Yamabushitake mushroom (Hericium erinaceus) improved lipid metabolism in mice fed a high-fat diet. Biosci. Biotechnol. Biochem. 2010, 74, 1447–1451. [Google Scholar] [CrossRef] [PubMed]
- Yang, H.; Hwang, I.; Kim, S.; Hong, E.J.; Jeung, E.B. Lentinus edodes promotes fat removal in hypercholesterolemic mice. Exp. Ther. Med. 2013, 6, 1409–1413. [Google Scholar] [CrossRef] [PubMed]
- Hu, Y.; Xu, J.; Sheng, Y.; Liu, J.; Li, H.; Guo, M.; Xu, W.; Luo, Y.; Huang, K.; He, X. Pleurotus Ostreatus Ameliorates Obesity by Modulating the Gut Microbiota in Obese Mice Induced by High-Fat Diet. Nutrients 2022, 14, 1868. [Google Scholar] [CrossRef] [PubMed]
- Łysakowska, P.; Sobota, A.; Wirkijowska, A. Medicinal Mushrooms: Their Bioactive Components, Nutritional Value and Application in Functional Food Production—A Review. Molecules 2023, 28, 5393. [Google Scholar] [CrossRef] [PubMed]
- Kumar, K.; Mehra, R.; Guiné, R.P.; Lima, M.J.; Kumar, N.; Kaushik, R.; Ahmed, N.; Yadav, A.N.; Kumar, H. Edible mushrooms: A comprehensive review on bioactive compounds with health benefits and processing aspects. Foods 2021, 10, 2996. [Google Scholar] [CrossRef] [PubMed]
- Kiddane, A.T.; Kim, G.-D. Anticancer and immunomodulatory effects of polysaccharides. Nutr. Cancer 2021, 73, 2219–2231. [Google Scholar] [CrossRef]
- Chang, C.J.; Lin, C.S.; Lu, C.C.; Martel, J.; Ko, Y.F.; Ojcius, D.M.; Tseng, S.F.; Wu, T.R.; Chen, Y.Y.; Young, J.D.; et al. Ganoderma lucidum reduces obesity in mice by modulating the composition of the gut microbiota. Nat. Commun. 2015, 6, 7489. [Google Scholar] [CrossRef]
- Huang, H.-Y.; Korivi, M.; Chaing, Y.-Y.; Chien, T.-Y.; Tsai, Y.-C. Pleurotus tuber-regium polysaccharides attenuate hyperglycemia and oxidative stress in experimental diabetic rats. Evid.-Based Complement. Altern. Med. 2012, 2012, 856381. [Google Scholar] [CrossRef]
- Ho Do, M.; Seo, Y.S.; Park, H.-Y. Polysaccharides: Bowel health and gut microbiota. Crit. Rev. Food Sci. Nutr. 2021, 61, 1212–1224. [Google Scholar] [CrossRef] [PubMed]
- Tang, C.; Wang, Y.; Chen, D.; Zhang, M.; Xu, J.; Xu, C.; Liu, J.; Kan, J.; Jin, C. Natural polysaccharides protect against diet-induced obesity by improving lipid metabolism and regulating the immune system. Food Res. Int. 2023, 113192. [Google Scholar] [CrossRef]
- Lee, H.-B.; Kim, Y.-S.; Park, H.-Y. Pectic polysaccharides: Targeting gut microbiota in obesity and intestinal health. Carbohydr. Polym. 2022, 287, 119363. [Google Scholar] [CrossRef]
- Gunness, P.; Flanagan, B.M.; Gidley, M.J. Molecular interactions between cereal soluble dietary fibre polymers and a model bile salt deduced from 13C NMR titration. J. Cereal Sci. 2010, 52, 444–449. [Google Scholar] [CrossRef]
- Espinal-Ruiz, M.; Restrepo-Sánchez, L.-P.; Narváez-Cuenca, C.-E.; McClements, D.J. Impact of pectin properties on lipid digestion under simulated gastrointestinal conditions: Comparison of citrus and banana passion fruit (Passiflora tripartita var. mollissima) pectins. Food Hydrocoll. 2016, 52, 329–342. [Google Scholar] [CrossRef]
Origin | Gene | Direction | Sequence (5′-3′) |
---|---|---|---|
Mouse | Acc | forward | TCTATTCGGGGTGACTTTC |
reverse | CTATCAGTCTGTCCAGCCC | ||
Fabp4 | forward | GGGAACCTGGAAGCTTGTCT | |
reverse | ACTCTCTGACCGGATGGTGA | ||
Fasn | forward | AGAAGCCATGTGGGGAAGATT | |
forward | AGCAGGGACAGGACAAGACAA | ||
Gpat | forward | GTAGTTGAACTCCTCCGACA | |
forward | ATCCACTACCACTGAGAGGA | ||
Scd1 | forward | TTCTTGCGATACACTCTGGTGC | |
reverse | CGGGATTGAATGTTCTTGTCGT | ||
Rplpo | forward | GTGCTGATGGGCAAGAAC | |
reverse | AGGTCCTCCTTGGTGAAC |
PWE | PEE | |
---|---|---|
Total phenolic content (μg GAE)/mg dried weight) | Not detected | Not detected |
Total flavonoid content (μg QE)/mg dried weight) | Not detected | Not detected |
Total polysaccharide content (μg GE)/mg dried weight) | 662.17 ± 8.78 | 549.59 ± 3.89 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Hong, S.; Park, S.; Lee, J.; Park, S.; Park, J.; Lee, Y. Anti-Obesity Effects of Pleurotus ferulae Water Extract on 3T3-L1 Adipocytes and High-Fat-Diet-Induced Obese Mice. Nutrients 2024, 16, 4139. https://doi.org/10.3390/nu16234139
Hong S, Park S, Lee J, Park S, Park J, Lee Y. Anti-Obesity Effects of Pleurotus ferulae Water Extract on 3T3-L1 Adipocytes and High-Fat-Diet-Induced Obese Mice. Nutrients. 2024; 16(23):4139. https://doi.org/10.3390/nu16234139
Chicago/Turabian StyleHong, Seulmin, Seonkyeong Park, Jangho Lee, Soohyun Park, Jaeho Park, and Yugeon Lee. 2024. "Anti-Obesity Effects of Pleurotus ferulae Water Extract on 3T3-L1 Adipocytes and High-Fat-Diet-Induced Obese Mice" Nutrients 16, no. 23: 4139. https://doi.org/10.3390/nu16234139
APA StyleHong, S., Park, S., Lee, J., Park, S., Park, J., & Lee, Y. (2024). Anti-Obesity Effects of Pleurotus ferulae Water Extract on 3T3-L1 Adipocytes and High-Fat-Diet-Induced Obese Mice. Nutrients, 16(23), 4139. https://doi.org/10.3390/nu16234139