IL-33 Induces a Switch in Intestinal Metabolites Revealing the Tryptophan Pathway as a Target for Inducing Allograft Survival
Abstract
1. Introduction
2. Materials and Methods
2.1. Mice
2.2. Skin Transplantation
2.3. IL-33 Treatment
2.4. RT-qPCR
2.5. Flow Cytometry
2.6. Fecal DNA Isolation and PCR
2.7. Fecal Sample Preparation for Ultra-Performance Liquid Chromatography–Mass Spectrometry (UPLC-MS)
2.8. UPLC-MS
2.9. Histology
3. Statistical Analysis
4. Results
4.1. IL-33’s Impacts on Treg Cell Frequencies and Phenotype
4.2. IL-33 Modulates Intestinal Microbiota and Metabolites
4.3. Kynurenic Acid, a Trp Metabolite, Induces Treg Cells and Favors Allograft Survival in Transplanted Animals
5. Discussion
6. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Carrasco, T.G.; Morales, R.A.; Pérez, F.; Terraza, C.; Yáñez, L.; Campos-Mora, M.; Pino-Lagos, K. Alarmin’ Immunologists: IL-33 as a Putative Target for Modulating T Cell-Dependent Responses. Front. Immunol. 2015, 6, 145484. [Google Scholar] [CrossRef] [PubMed]
- Schiering, C.; Krausgruber, T.; Chomka, A.; Fröhlich, A.; Adelmann, K.; Wohlfert, E.A.; Pott, J.; Griseri, T.; Bollrath, J.; Hegazy, A.N.; et al. The Alarmin IL-33 Promotes Regulatory T-Cell Function in the Intestine. Nature 2014, 513, 564–568. [Google Scholar] [CrossRef] [PubMed]
- Duan, L.; Chen, J.; Zhang, H.; Yang, H.; Zhu, P.; Xiong, A.; Xia, Q.; Zheng, F.; Tan, Z.; Gong, F.; et al. Interleukin-33 Ameliorates Experimental Colitis through Promoting Th2/Foxp3+ Regulatory T-Cell Responses in Mice. Mol. Med. 2012, 18, 753–761. [Google Scholar] [CrossRef]
- Hand, T.; Belkaid, Y. Microbial Control of Regulatory and Effector T Cell Responses in the Gut. Curr. Opin. Immunol. 2010, 22, 63–72. [Google Scholar] [CrossRef]
- Laursen, M.F.; Sakanaka, M.; von Burg, N.; Mörbe, U.; Andersen, D.; Moll, J.M.; Pekmez, C.T.; Rivollier, A.; Michaelsen, K.F.; Mølgaard, C.; et al. Bifidobacterium Species Associated with Breastfeeding Produce Aromatic Lactic Acids in the Infant Gut. Nat. Microbiol. 2021, 6, 1367–1382. [Google Scholar] [CrossRef] [PubMed]
- Campbell, C.; McKenney, P.T.; Konstantinovsky, D.; Isaeva, O.I.; Schizas, M.; Verter, J.; Mai, C.; Jin, W.B.; Guo, C.J.; Violante, S.; et al. Bacterial Metabolism of Bile Acids Promotes Generation of Peripheral Regulatory T Cells. Nature 2020, 581, 475–479. [Google Scholar] [CrossRef]
- Hang, S.; Paik, D.; Yao, L.; Kim, E.; Jamma, T.; Lu, J.; Ha, S.; Nelson, B.N.; Kelly, S.P.; Wu, L.; et al. Bile Acid Metabolites Control TH17 and Treg Cell Differentiation. Nature 2019, 576, 143–148. [Google Scholar] [CrossRef]
- Ohkura, N.; Kitagawa, Y.; Sakaguchi, S. Development and Maintenance of Regulatory T Cells. Immunity 2013, 38, 414–423. [Google Scholar] [CrossRef]
- Zhao, H.; Liao, X.; Kang, Y. Tregs: Where We Are and What Comes Next? Front. Immunol. 2017, 8, 1578. [Google Scholar] [CrossRef]
- Su, X.; Gao, Y.; Yang, R. Gut Microbiota-Derived Tryptophan Metabolites Maintain Gut and Systemic Homeostasis. Cells 2022, 11, 2296. [Google Scholar] [CrossRef]
- Roth, W.; Zadeh, K.; Vekariya, R.; Ge, Y.; Mohamadzadeh, M. Tryptophan Metabolism and Gut-Brain Homeostasis. Int. J. Mol. Sci. 2021, 22, 2973. [Google Scholar] [CrossRef] [PubMed]
- Modoux, M.; Rolhion, N.; Mani, S.; Sokol, H. Tryptophan Metabolism as a Pharmacological Target. Trends Pharmacol. Sci. 2021, 42, 60–73. [Google Scholar] [CrossRef] [PubMed]
- Klaessens, S.; Stroobant, V.; De Plaen, E.; Van den Eynde, B.J. Systemic Tryptophan Homeostasis. Front. Mol. Biosci. 2022, 9, 7929. [Google Scholar] [CrossRef]
- Turnquist, H.R.; Zhao, Z.; Rosborough, B.R.; Liu, Q.; Castellaneta, A.; Isse, K.; Wang, Z.; Lang, M.; Beer Stolz, D.; Zheng, X.X.; et al. IL-33 Expands Suppressive CD11b+ Gr-1int and Regulatory T Cells, Including ST2L+ Foxp3+ Cells, and Mediates Regulatory T Cell-Dependent Promotion of Cardiac Allograft Survival. J. Immunol. 2011, 187, 4598–4610. [Google Scholar] [CrossRef]
- Gajardo, T.; Morales, R.A.; Campos-Mora, M.; Campos-Acuña, J.; Pino-Lagos, K. Exogenous Interleukin-33 Targets Myeloid-Derived Suppressor Cells and Generates Periphery-Induced Foxp3+ Regulatory T Cells in Skin-Transplanted Mice. Immunology 2015, 146, 81–88. [Google Scholar] [CrossRef] [PubMed]
- Kawai, K.; Uchiyama, M.; Hester, J.; Issa, F. IL-33 Drives the Production of Mouse Regulatory T Cells with Enhanced in Vivo Suppressive Activity in Skin Transplantation. Am. J. Transplant. 2021, 21, 978–992. [Google Scholar] [CrossRef]
- Gajardo, T.; Campos-Mora, M.; Pino-Lagos, K. IL-33 Improves the Suppressive Capacity of Human Regulatory T Cells. Trends Transplant. 2017, 10, 238. [Google Scholar] [CrossRef]
- Resendiz-Nava, C.N.; Silva-Rojas, H.V.; Rebollar-Alviter, A.; Rivera-Pastrana, D.M.; Mercado-Silva, E.M.; Nava, G.M. A Comprehensive Evaluation of Enterobacteriaceae Primer Sets for Analysis of Host-Associated Microbiota. Pathogens 2022, 11, 17. [Google Scholar] [CrossRef]
- Engevik, M.A.; Aihara, E.; Montrose, M.H.; Shull, G.E.; Hassett, D.J.; Worrell, R.T. Loss of NHE3 Alters Gut Microbiota Composition and Influences Bacteroides Thetaiotaomicron Growth. Am. J. Physiol. Gastrointest. Liver Physiol. 2013, 305, 697–711. [Google Scholar] [CrossRef]
- Atif, S.M.; Winter, S.E.; Winter, M.G.; McSorley, S.J.; Bäumler, A.J. Salmonella Enterica Serovar Typhi Impairs CD4 T Cell Responses by Reducing Antigen Availability. Infect. Immun. 2014, 82, 2247–2254. [Google Scholar] [CrossRef]
- Chan, K.G.; Atkinson, S.; Mathee, K.; Sam, C.K.; Chhabra, S.R.; Cmara, M.; Koh, C.L.; Williams, P. Characterization of N-Acylhomoserine Lactone-Degrading Bacteria Associated with the Zingiber Officinale (Ginger) Rhizosphere: Co-Existence of Quorum Quenching and Quorum Sensing in Acinetobacter and Burkholderia. BMC Microbiol. 2011, 11, 51. [Google Scholar] [CrossRef] [PubMed]
- Qing, X.; Zeng, D.; Wang, H.; Ni, X.; Liu, L.; Lai, J.; Khalique, A.; Pan, K.; Jing, B. Preventing Subclinical Necrotic Enteritis through Lactobacillus Johnsonii BS15 by Ameliorating Lipid Metabolism and Intestinal Microflora in Broiler Chickens. AMB Express 2017, 7, 139. [Google Scholar] [CrossRef] [PubMed]
- Malik, A.; Sharma, D.; Zhu, Q.; Karki, R.; Guy, C.S.; Vogel, P.; Kanneganti, T.D. IL-33 Regulates the IgA-Microbiota Axis to Restrain IL-1α–Dependent Colitis and Tumorigenesis. J. Clin. Investig. 2016, 126, 4469–4481. [Google Scholar] [CrossRef] [PubMed]
- Xiao, Y.; Huang, X.; Zhao, Y.; Chen, F.; Sun, M.; Yang, W.; Chen, L.; Yao, S.; Peniche, A.; Dann, S.M.; et al. Interleukin-33 Promotes REG3γ Expression in Intestinal Epithelial Cells and Regulates Gut Microbiota. Cell. Mol. Gastroenterol. Hepatol. 2019, 8, 21–36. [Google Scholar] [CrossRef]
- Röwekamp, I.; Maschirow, L.; Rabes, A.; Vernengo, F.F.; Hamann, L.; Heinz, G.A.; Mashreghi, M.F.; Caesar, S.; Milek, M.; Fonseca, A.C.F.; et al. IL-33 Controls IL-22-Dependent Antibacterial Defense by Modulating the Microbiota. Proc. Natl. Acad. Sci. USA 2024, 121, e2310864121. [Google Scholar] [CrossRef]
- Yoon, J.H.; Do, J.S.; Velankanni, P.; Lee, C.G.; Kwon, H.K. Gut Microbial Metabolites on Host Immune Responses in Health and Disease. Immune Netw. 2023, 23, e6. [Google Scholar] [CrossRef]
- Atarashi, K.; Tanoue, T.; Shima, T.; Imaoka, A.; Kuwahara, T.; Momose, Y.; Cheng, G.; Yamasaki, S.; Saito, T.; Ohba, Y.; et al. Induction of Colonic Regulatory T Cells by Indigenous Clostridium Species. Science 2011, 331, 337–341. [Google Scholar] [CrossRef]
- Geuking, M.B.; Cahenzli, J.; Lawson, M.A.E.; Ng, D.C.K.; Slack, E.; Hapfelmeier, S.; McCoy, K.D.; Macpherson, A.J. Intestinal Bacterial Colonization Induces Mutualistic Regulatory T Cell Responses. Immunity 2011, 34, 794–806. [Google Scholar] [CrossRef]
- Smith, P.M.; Howitt, M.R.; Panikov, N.; Michaud, M.; Gallini, C.A.; Bohlooly, Y.M.; Glickman, J.N.; Garrett, W.S. The Microbial Metabolites, Short-Chain Fatty Acids, Regulate Colonic T Reg Cell Homeostasis. Science 2013, 341, 569–573. [Google Scholar] [CrossRef]
- Cristofori, F.; Dargenio, V.N.; Dargenio, C.; Miniello, V.L.; Barone, M.; Francavilla, R. Anti-Inflammatory and Immunomodulatory Effects of Probiotics in Gut Inflammation: A Door to the Body. Front. Immunol. 2021, 12, 578386. [Google Scholar] [CrossRef]
- Wang, J.; Simonavicius, N.; Wu, X.; Swaminath, G.; Reagan, J.; Tian, H.; Ling, L. Kynurenic Acid as a Ligand for Orphan G Protein-Coupled Receptor GPR35. J. Biol. Chem. 2006, 281, 22021–22028. [Google Scholar] [CrossRef] [PubMed]
- Agudelo, L.Z.; Ferreira, D.M.S.; Cervenka, I.; Bryzgalova, G.; Dadvar, S.; Jannig, P.R.; Pettersson-Klein, A.T.; Lakshmikanth, T.; Sustarsic, E.G.; Porsmyr-Palmertz, M.; et al. Kynurenic Acid and Gpr35 Regulate Adipose Tissue Energy Homeostasis and Inflammation. Cell Metab. 2018, 27, 378–392.e5. [Google Scholar] [CrossRef] [PubMed]
- Garrett, W.S.; Gallini, C.A.; Yatsunenko, T.; Michaud, M.; Dubois, A.; Delaney, M.L.; Punit, S.; Karlsson, M.; Bry, L.; Glickman, J.N.; et al. Enterobacteriaceae Act in Concert with the Gut Microbiota to Induce Spontaneous and Maternally Transmitted Colitis. Cell Host Microbe 2010, 8, 292–300. [Google Scholar] [CrossRef] [PubMed]
- Baldelli, V.; Scaldaferri, F.; Putignani, L.; Del Chierico, F. The Role of Enterobacteriaceae in Gut Microbiota Dysbiosis in Inflammatory Bowel Diseases. Microorganisms 2021, 9, 697. [Google Scholar] [CrossRef] [PubMed]
- Wang, K.; Dong, H.; Qi, Y.; Pei, Z.; Yi, S.; Yang, X.; Zhao, Y.; Meng, F.; Yu, S.; Zhou, T.; et al. Lactobacillus casei Regulates Differentiation of Th17/Treg Cells to Reduce Intestinal Inflammation in Mice. Can. J. Vet. Res. 2017, 81, 122. [Google Scholar] [PubMed]
- Telesford, K.M.; Yan, W.; Ochoa-Reparaz, J.; Pant, A.; Kircher, C.; Christy, M.A.; Begum-Haque, S.; Kasper, D.L.; Kasper, L.H. A Commensal Symbiotic Factor Derived from Bacteroides Fragilis Promotes Human CD39+Foxp3+ T Cells and Treg Function. Gut Microbes 2015, 6, 234–242. [Google Scholar] [CrossRef]
- Fu, L.; Peng, J.; Zhao, S.; Zhang, Y.; Su, X.; Wang, Y. Lactic Acid Bacteria-Specific Induction of CD4+Foxp3+T Cells Ameliorates Shrimp Tropomyosin-Induced Allergic Response in Mice via Suppression of MTOR Signaling. Sci. Rep. 2017, 7, 1987. [Google Scholar] [CrossRef]
- Ding, Y.-H.; Qian, L.-Y.; Pang, J.; Lin, J.-Y.; Xu, Q.; Wang, L.-H.; Huang, D.-S.; Zou, H.; Ding, Y.-H.; Qian, L.-Y.; et al. The Regulation of Immune Cells by Lactobacilli: A Potential Therapeutic Target for Anti-Atherosclerosis Therapy. Oncotarget 2017, 8, 59915–59928. [Google Scholar] [CrossRef]
- Roager, H.M.; Licht, T.R. Microbial Tryptophan Catabolites in Health and Disease. Nat. Commun. 2018, 9, 3294. [Google Scholar] [CrossRef]
- Mahdavi, J.; Royer, P.J.; Sjölinder, H.S.; Azimi, S.; Self, T.; Stoof, J.; Wheldon, L.M.; Brännström, K.; Wilson, R.; Moreton, J.; et al. Pro-Inflammatory Cytokines Can Act as Intracellular Modulators of Commensal Bacterial Virulence. Open Biol. 2013, 3, 130048. [Google Scholar] [CrossRef]
- O’Mahony, L.; O’Callaghan, L.; McCarthy, J.; Shilling, D.; Scully, P.; Sibartie, S.; Kavanagh, E.; Kirwan, W.O.; Redmond, H.P.; Collins, J.K.; et al. Differential Cytokine Response from Dendritic Cells to Commensal and Pathogenic Bacteria in Different Lymphoid Compartments in Humans. Am. J. Physiol. Gastrointest. Liver Physiol. 2006, 290, 839–845. [Google Scholar] [CrossRef] [PubMed]
- Wang, J.; Zhu, N.; Su, X.; Gao, Y.; Yang, R. Gut-Microbiota-Derived Metabolites Maintain Gut and Systemic Immune Homeostasis. Cells 2023, 12, 793. [Google Scholar] [CrossRef] [PubMed]
- Rosser, E.C.; Piper, C.J.M.; Matei, D.E.; Blair, P.A.; Rendeiro, A.F.; Orford, M.; Alber, D.G.; Krausgruber, T.; Catalan, D.; Klein, N.; et al. Microbiota-Derived Metabolites Suppress Arthritis by Amplifying Aryl-Hydrocarbon Receptor Activation in Regulatory B Cells. Cell Metab. 2020, 31, 837–851.e10. [Google Scholar] [CrossRef] [PubMed]
- Wirthgen, E.; Hoeflich, A.; Rebl, A.; Günther, J. Kynurenic Acid: The Janus-Faced Role of an Immunomodulatory Tryptophan Metabolite and Its Link to Pathological Conditions. Front. Immunol. 2018, 8, 312707. [Google Scholar] [CrossRef]
- Mezrich, J.D.; Fechner, J.H.; Zhang, X.; Johnson, B.P.; Burlingham, W.J.; Bradfield, C.A. An Interaction between Kynurenine and the Aryl Hydrocarbon Receptor Can Generate Regulatory T Cells. J. Immunol. 2010, 185, 3190–3198. [Google Scholar] [CrossRef]





| Target | Sequence (5′–3′) |
|---|---|
| Salmonella | F: TGTTGTGGTTAATAACCGCA |
| R: GACTACCAGGGTATCTAATCC | |
| Lactobacillus | F: AGCAGTAGGGAATCTTCCA |
| R: CACCGCTACACATGGAG | |
| Clostridium | F: ACTCCTACGGGAGGCAGC |
| R: GCTTCTTAGTCAGGTACCGTCAT | |
| Bacteroides | F: GGTTCTGAGAGGAGGTCCC |
| R: GCTGCCTCCCGTAGGAGT | |
| Enterobacteria | F: GTGCCAGCMGCCGCGGTAA |
| R: GCCTCAAGGGCACAACCTCCAAG | |
| 16S | F: AGAGTTTGATCMTGGCTCAG |
| R: AAGGAGGTGWTCCARCC |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Pinto, C.; Carrasco-Loncharic, T.; González-Mienert, E.; de Solminihac, J.; Gálvez-Jirón, F.; Cifuentes, F.; Pino-Lagos, K. IL-33 Induces a Switch in Intestinal Metabolites Revealing the Tryptophan Pathway as a Target for Inducing Allograft Survival. Nutrients 2024, 16, 3655. https://doi.org/10.3390/nu16213655
Pinto C, Carrasco-Loncharic T, González-Mienert E, de Solminihac J, Gálvez-Jirón F, Cifuentes F, Pino-Lagos K. IL-33 Induces a Switch in Intestinal Metabolites Revealing the Tryptophan Pathway as a Target for Inducing Allograft Survival. Nutrients. 2024; 16(21):3655. https://doi.org/10.3390/nu16213655
Chicago/Turabian StylePinto, Camila, Tomás Carrasco-Loncharic, Eduardo González-Mienert, Javiera de Solminihac, Felipe Gálvez-Jirón, Federico Cifuentes, and Karina Pino-Lagos. 2024. "IL-33 Induces a Switch in Intestinal Metabolites Revealing the Tryptophan Pathway as a Target for Inducing Allograft Survival" Nutrients 16, no. 21: 3655. https://doi.org/10.3390/nu16213655
APA StylePinto, C., Carrasco-Loncharic, T., González-Mienert, E., de Solminihac, J., Gálvez-Jirón, F., Cifuentes, F., & Pino-Lagos, K. (2024). IL-33 Induces a Switch in Intestinal Metabolites Revealing the Tryptophan Pathway as a Target for Inducing Allograft Survival. Nutrients, 16(21), 3655. https://doi.org/10.3390/nu16213655

