Ketogenic Diet High in Saturated Fat Promotes Colonic Claudin Expression without Changes in Intestinal Permeability to Iohexol in Healthy Mice
Abstract
1. Introduction
2. Materials and Methods
2.1. Animal Experiment
2.2. Measurement of Intestinal Permeability
2.3. Collection of Samples
2.4. Histological Analyses
2.5. Biochemical Assays
2.6. Western Blot
2.7. Reverse Transcription Quantitative Polymerase Chain Reaction
| Gene | Forward Primer | Reverse Primer | Ref. |
|---|---|---|---|
| Actb | CTGAATGGCCCAGGTCTGAG | AAGTCAGTGTACAGGCCAGC | [28] |
| Eef2 | TGTCAGTCATCGCCCATGTG | CATCCTTGCGAGTGTCAGTGA | [29] |
| Rplp0 | TAACCCTGAAGTGCTCGACA | GGTACCCGATCTGCAGACA | [30] |
| Cldn1 | AGACCTGGATTTGCATCTTGGTG | TGCAACATAGGCAGGACAAGAGTTA | [31] |
| Cldn2 | GCAAACAGGCTCCGAAGATACT | GAGATGATGCCCAAGTACAGAG | [32] |
| Cldn4 | TGAGCGATGGCGTCTATGG | GATGTTGCTGCCGATGAAGG | |
| Ocln | CGGTACAGCAGCAATGGTAA | CTCCCCACCTGTCGTGTAGT | [33] |
| Il1b | CTCCAGCCAAGCTTCCTTGT | TCATCACTGTCAAAAGGTGGCA | [28] |
| Il6 | ATCGTGGAAATGAGAAAAGAGTTGT | CTGCAAGTGCATCATCGTTGT | |
| Tnf | TGGCACCACTAGTTGGTTGTCT | AGCCTGTAGCCCACGTCGTA | [34] |
| Lcn2 | CCACCACGGACTACAACCAG | AGCTCCTTGGTTCTTCCATACAG | |
| Akp6 | ACCGAAGCTCAGAGTGTTGAT | GCAAATATGGCCACGTCCTC |
2.8. Intestinal Alkaline Phosphatase Activity
2.9. Statistical Analyses
3. Results
3.1. Metabolic Parameters
3.2. Intestinal Permeability
3.2.1. Permeability to Iohexol
3.2.2. Tight Junctions
3.3. Epithelial Cell Vacuolation
3.4. Inflammation
3.5. Intestinal Alkaline Phosphatase
3.6. Lipopolysaccharide
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Fasano, A. All disease begins in the (leaky) gut: Role of zonulin-mediated gut permeability in the pathogenesis of some chronic inflammatory diseases. F1000Research 2020, 9, F1000 Faculty Rev-69. [Google Scholar] [CrossRef]
- Peng, X.; Yan, H.; You, Z.; Wang, P.; Wang, S. Effects of enteral supplementation with glutamine granules on intestinal mucosal barrier function in severe burned patients. Burns 2004, 30, 135–139. [Google Scholar] [CrossRef]
- Benjamin, J.; Makharia, G.; Ahuja, V.; Anand Rajan, K.D.; Kalaivani, M.; Gupta, S.D.; Joshi, Y.K. Glutamine and whey protein improve intestinal permeability and morphology in patients with Crohn’s disease: A randomized controlled trial. Dig. Dis. Sci. 2012, 57, 1000–1012. [Google Scholar] [CrossRef] [PubMed]
- Zhou, Q.; Verne, M.L.; Fields, J.Z.; Lefante, J.J.; Basra, S.; Salameh, H.; Verne, G.N. Randomised placebo-controlled trial of dietary glutamine supplements for postinfectious irritable bowel syndrome. Gut 2019, 68, 996–1002. [Google Scholar] [CrossRef] [PubMed]
- Drago, S.; El Asmar, R.; Di Pierro, M.; Grazia Clemente, M.; Tripathi, A.; Sapone, A.; Thakar, M.; Iacono, G.; Carroccio, A.; D’Agate, C.; et al. Gliadin, zonulin and gut permeability: Effects on celiac and non-celiac intestinal mucosa and intestinal cell lines. Scand. J. Gastroenterol. 2006, 41, 408–419. [Google Scholar] [CrossRef]
- Stenman, L.K.; Holma, R.; Korpela, R. High-fat-induced intestinal permeability dysfunction associated with altered fecal bile acids. World J. Gastroenterol. 2012, 18, 923–929. [Google Scholar] [CrossRef] [PubMed]
- Cani, P.D.; Bibiloni, R.; Knauf, C.; Waget, A.; Neyrinck, A.M.; Delzenne, N.M.; Burcelin, R. Changes in gut microbiota control metabolic endotoxemia-induced inflammation in high-fat diet-induced obesity and diabetes in mice. Diabetes 2008, 57, 1470–1481. [Google Scholar] [CrossRef] [PubMed]
- Muller, V.M.; Zietek, T.; Rohm, F.; Fiamoncini, J.; Lagkouvardos, I.; Haller, D.; Clavel, T.; Daniel, H. Gut barrier impairment by high-fat diet in mice depends on housing conditions. Mol. Nutr. Food Res. 2016, 60, 897–908. [Google Scholar] [CrossRef]
- Wells, J.; Swaminathan, A.; Paseka, J.; Hanson, C. Efficacy and Safety of a Ketogenic Diet in Children and Adolescents with Refractory Epilepsy-A Review. Nutrients 2020, 12, 1809. [Google Scholar] [CrossRef]
- Phillips, M.C.L.; Deprez, L.M.; Mortimer, G.M.N.; Murtagh, D.K.J.; McCoy, S.; Mylchreest, R.; Gilbertson, L.J.; Clark, K.M.; Simpson, P.V.; McManus, E.J.; et al. Randomized crossover trial of a modified ketogenic diet in Alzheimer’s disease. Alzheimers Res. Ther. 2021, 13, 51. [Google Scholar] [CrossRef]
- Choi, Y.J.; Jeon, S.M.; Shin, S. Impact of a Ketogenic Diet on Metabolic Parameters in Patients with Obesity or Overweight and with or without Type 2 Diabetes: A Meta-Analysis of Randomized Controlled Trials. Nutrients 2020, 12, 2005. [Google Scholar] [CrossRef]
- Graff, E.C.; Fang, H.; Wanders, D.; Judd, R.L. Anti-inflammatory effects of the hydroxycarboxylic acid receptor 2. Metabolism 2016, 65, 102–113. [Google Scholar] [CrossRef]
- Windmueller, H.G.; Spaeth, A.E. Identification of ketone bodies and glutamine as the major respiratory fuels in vivo for postabsorptive rat small intestine. J. Biol. Chem. 1978, 253, 69–76. [Google Scholar] [CrossRef]
- Ma, D.; Wang, A.C.; Parikh, I.; Green, S.J.; Hoffman, J.D.; Chlipala, G.; Murphy, M.P.; Sokola, B.S.; Bauer, B.; Hartz, A.M.S.; et al. Ketogenic diet enhances neurovascular function with altered gut microbiome in young healthy mice. Sci. Rep. 2018, 8, 6670. [Google Scholar] [CrossRef]
- Ang, Q.Y.; Alexander, M.; Newman, J.C.; Tian, Y.; Cai, J.; Upadhyay, V.; Turnbaugh, J.A.; Verdin, E.; Hall, K.D.; Leibel, R.L.; et al. Ketogenic Diets Alter the Gut Microbiome Resulting in Decreased Intestinal Th17 Cells. Cell 2020, 181, 1263–1275.e16. [Google Scholar] [CrossRef]
- Olson, C.A.; Vuong, H.E.; Yano, J.M.; Liang, Q.Y.; Nusbaum, D.J.; Hsiao, E.Y. The Gut Microbiota Mediates the Anti-Seizure Effects of the Ketogenic Diet. Cell 2018, 173, 1728–1741.e13. [Google Scholar] [CrossRef]
- Gigante, I.; Tutino, V.; Russo, F.; De Nunzio, V.; Coletta, S.; Armentano, R.; Crovace, A.; Caruso, M.G.; Orlando, A.; Notarnicola, M. Cannabinoid Receptors Overexpression in a Rat Model of Irritable Bowel Syndrome (IBS) after Treatment with a Ketogenic Diet. Int. J. Mol. Sci. 2021, 22, 2880. [Google Scholar] [CrossRef]
- Dmitrieva-Posocco, O.; Wong, A.C.; Lundgren, P.; Golos, A.M.; Descamps, H.C.; Dohnalova, L.; Cramer, Z.; Tian, Y.; Yueh, B.; Eskiocak, O.; et al. beta-Hydroxybutyrate suppresses colorectal cancer. Nature 2022, 605, 160–165. [Google Scholar] [CrossRef]
- Kong, C.; Yan, X.; Liu, Y.; Huang, L.; Zhu, Y.; He, J.; Gao, R.; Kalady, M.F.; Goel, A.; Qin, H.; et al. Ketogenic diet alleviates colitis by reduction of colonic group 3 innate lymphoid cells through altering gut microbiome. Signal Transduct. Target. Ther. 2021, 6, 154. [Google Scholar] [CrossRef]
- Li, S.; Zhuge, A.; Wang, K.; Lv, L.; Bian, X.; Yang, L.; Xia, J.; Jiang, X.; Wu, W.; Wang, S.; et al. Ketogenic diet aggravates colitis, impairs intestinal barrier and alters gut microbiota and metabolism in DSS-induced mice. Food Funct. 2021, 12, 10210–10225. [Google Scholar] [CrossRef]
- Kono, H.; Fujii, H.; Asakawa, M.; Yamamoto, M.; Matsuda, M.; Maki, A.; Matsumoto, Y. Protective Effects of Medium-Chain Triglycerides on the Liver and Gut in Rats Administered Endotoxin. Ann. Surg. 2003, 237, 246–255. [Google Scholar] [CrossRef] [PubMed]
- Kirpich, I.A.; Feng, W.; Wang, Y.; Liu, Y.; Barker, D.F.; Barve, S.S.; McClain, C.J. The type of dietary fat modulates intestinal tight junction integrity, gut permeability, and hepatic toll-like receptor expression in a mouse model of alcoholic liver disease. Alcohol. Clin. Exp. Res. 2012, 36, 835–846. [Google Scholar] [CrossRef] [PubMed]
- Lam, Y.Y.; Ha, C.W.; Hoffmann, J.M.; Oscarsson, J.; Dinudom, A.; Mather, T.J.; Cook, D.I.; Hunt, N.H.; Caterson, I.D.; Holmes, A.J.; et al. Effects of dietary fat profile on gut permeability and microbiota and their relationships with metabolic changes in mice. Obesity 2015, 23, 1429–1439. [Google Scholar] [CrossRef] [PubMed]
- Marchix, J.; Alain, C.; David-Le Gall, S.; Acuna-Amador, L.A.; Druart, C.; Delzenne, N.M.; Barloy-Hubler, F.; Legrand, P.; Boudry, G. Maternal Linoleic Acid Overconsumption Alters Offspring Gut and Adipose Tissue Homeostasis in Young but Not Older Adult Rats. Nutrients 2020, 12, 3451. [Google Scholar] [CrossRef] [PubMed]
- Mani, V.; Hollis, J.H.; Gabler, N.K. Dietary oil composition differentially modulates intestinal endotoxin transport and postprandial endotoxemia. Nutr. Metab. 2013, 10, 6. [Google Scholar] [CrossRef] [PubMed]
- Candido, T.L.N.; da Silva, L.E.; Tavares, J.F.; Conti, A.C.M.; Rizzardo, R.A.G.; Goncalves Alfenas, R.C. Effects of dietary fat quality on metabolic endotoxaemia: A systematic review. Br. J. Nutr. 2020, 124, 654–667. [Google Scholar] [CrossRef] [PubMed]
- Vandesompele, J.; De Preter, K.; Pattyn, F.; Poppe, B.; Van Roy, N.; De Paepe, A.; Speleman, F. Accurate normalization of real-time quantitative RT-PCR data by geometric averaging of multiple internal control genes. Genome Biol. 2002, 3, research0034.1. [Google Scholar] [CrossRef]
- Salmenkari, H.; Laitinen, A.; Forsgard, R.A.; Holappa, M.; Linden, J.; Pasanen, L.; Korhonen, M.; Korpela, R.; Nystedt, J. The use of unlicensed bone marrow-derived platelet lysate-expanded mesenchymal stromal cells in colitis: A pre-clinical study. Cytotherapy 2019, 21, 175–188. [Google Scholar] [CrossRef]
- Eissa, N.; Hussein, H.; Wang, H.; Rabbi, M.F.; Bernstein, C.N.; Ghia, J.E. Stability of Reference Genes for Messenger RNA Quantification by Real-Time PCR in Mouse Dextran Sodium Sulfate Experimental Colitis. PLoS ONE 2016, 11, e0156289. [Google Scholar] [CrossRef]
- Salmenkari, H.; Pasanen, L.; Linden, J.; Korpela, R.; Vapaatalo, H. Beneficial anti-inflammatory effect of angiotensin-converting enzyme inhibitor and angiotensin receptor blocker in the treatment of dextran sulfate sodium-induced colitis in mice. J. Physiol. Pharmacol. 2018, 69, 4. [Google Scholar] [CrossRef]
- Li, G.Z.; Wang, Z.H.; Cui, W.; Fu, J.L.; Wang, Y.R.; Liu, P. Tumor necrosis factor alpha increases intestinal permeability in mice with fulminant hepatic failure. World J. Gastroenterol. 2012, 18, 5042–5050. [Google Scholar] [CrossRef] [PubMed]
- Zhang, Y.G.; Wu, S.; Lu, R.; Zhou, D.; Zhou, J.; Carmeliet, G.; Petrof, E.; Claud, E.C.; Sun, J. Tight junction CLDN2 gene is a direct target of the vitamin D receptor. Sci. Rep. 2015, 5, 10642. [Google Scholar] [CrossRef] [PubMed]
- Song, C.H.; Kim, N.; Sohn, S.H.; Lee, S.M.; Nam, R.H.; Na, H.Y.; Lee, D.H.; Surh, Y.J. Effects of 17beta-Estradiol on Colonic Permeability and Inflammation in an Azoxymethane/Dextran Sulfate Sodium-Induced Colitis Mouse Model. Gut Liver 2018, 12, 682–693. [Google Scholar] [CrossRef] [PubMed]
- Nakano, D.; Kitada, K.; Wan, N.; Zhang, Y.; Wiig, H.; Wararat, K.; Yanagita, M.; Lee, S.; Jia, L.; Titze, J.M.; et al. Lipopolysaccharide induces filtrate leakage from renal tubular lumina into the interstitial space via a proximal tubular Toll-like receptor 4-dependent pathway and limits sensitivity to fluid therapy in mice. Kidney Int. 2020, 97, 904–912. [Google Scholar] [CrossRef] [PubMed]
- Gross, E.C.; Klement, R.J.; Schoenen, J.; D’Agostino, D.P.; Fischer, D. Potential Protective Mechanisms of Ketone Bodies in Migraine Prevention. Nutrients 2019, 11, 811. [Google Scholar] [CrossRef] [PubMed]
- Ortin-Piqueras, V.; Freitag, T.L.; Andersson, L.C.; Lehtonen, S.H.; Meri, S.K.; Spillmann, T.; Frias, R. Urinary Excretion of Iohexol as a Permeability Marker in a Mouse Model of Intestinal Inflammation: Time Course, Performance and Welfare Considerations. Animals 2021, 11, 79. [Google Scholar] [CrossRef] [PubMed]
- Frias, R.; Strube, K.; Ternes, W.; Collado, M.C.; Spillmann, T.; Sankari, S.; Westermarck, E. Comparison of 51chromium-labeled ethylenediamine tetra-acetic acid and iohexol as blood markers for intestinal permeability testing in Beagle dogs. Vet. J. 2012, 192, 123–125. [Google Scholar] [CrossRef]
- Halme, L.; Turunen, U.; Tuominen, J.; Forsstrom, T.; Turpeinen, U. Comparison of iohexol and lactulose-mannitol tests as markers of disease activity in patients with inflammatory bowel disease. Scand. J. Clin. Lab. Investig. 2000, 60, 695–701. [Google Scholar] [CrossRef]
- Liskiewicz, D.; Liskiewicz, A.; Grabowski, M.; Nowacka-Chmielewska, M.M.; Jablonska, K.; Wojakowska, A.; Marczak, L.; Barski, J.J.; Malecki, A. Upregulation of hepatic autophagy under nutritional ketosis. J. Nutr. Biochem. 2021, 93, 108620. [Google Scholar] [CrossRef]
- Johnson, A.M.; Costanzo, A.; Gareau, M.G.; Armando, A.M.; Quehenberger, O.; Jameson, J.M.; Olefsky, J.M. High fat diet causes depletion of intestinal eosinophils associated with intestinal permeability. PLoS ONE 2015, 10, e0122195. [Google Scholar] [CrossRef]
- Schroeder, B.O.; Birchenough, G.M.H.; Stahlman, M.; Arike, L.; Johansson, M.E.V.; Hansson, G.C.; Backhed, F. Bifidobacteria or Fiber Protects against Diet-Induced Microbiota-Mediated Colonic Mucus Deterioration. Cell Host Microbe 2018, 23, 27–40.e7. [Google Scholar] [CrossRef] [PubMed]
- Tsukita, S.; Tanaka, H.; Tamura, A. The Claudins: From Tight Junctions to Biological Systems. Trends Biochem. Sci. 2019, 44, 141–152. [Google Scholar] [CrossRef] [PubMed]
- Furuse, M.; Hata, M.; Furuse, K.; Yoshida, Y.; Haratake, A.; Sugitani, Y.; Noda, T.; Kubo, A.; Tsukita, S. Claudin-based tight junctions are crucial for the mammalian epidermal barrier: A lesson from claudin-1-deficient mice. J. Cell Biol. 2002, 156, 1099–1111. [Google Scholar] [CrossRef] [PubMed]
- Michikawa, H.; Fujita-Yoshigaki, J.; Sugiya, H. Enhancement of barrier function by overexpression of claudin-4 in tight junctions of submandibular gland cells. Cell Tissue Res. 2008, 334, 255–264. [Google Scholar] [CrossRef]
- Weber, C.R.; Nalle, S.C.; Tretiakova, M.; Rubin, D.T.; Turner, J.R. Claudin-1 and claudin-2 expression is elevated in inflammatory bowel disease and may contribute to early neoplastic transformation. Lab. Investig. 2008, 88, 1110–1120. [Google Scholar] [CrossRef] [PubMed]
- Pope, J.L.; Bhat, A.A.; Sharma, A.; Ahmad, R.; Krishnan, M.; Washington, M.K.; Beauchamp, R.D.; Singh, A.B.; Dhawan, P. Claudin-1 regulates intestinal epithelial homeostasis through the modulation of Notch-signalling. Gut 2014, 63, 622–634. [Google Scholar] [CrossRef] [PubMed]
- Zhu, J.; Lee, B.; Buhman, K.K.; Cheng, J.X. A dynamic, cytoplasmic triacylglycerol pool in enterocytes revealed by ex vivo and in vivo coherent anti-Stokes Raman scattering imaging. J. Lipid Res. 2009, 50, 1080–1089. [Google Scholar] [CrossRef]
- D’Aquila, T.; Hung, Y.H.; Carreiro, A.; Buhman, K.K. Recent discoveries on absorption of dietary fat: Presence, synthesis, and metabolism of cytoplasmic lipid droplets within enterocytes. Biochim. Biophys. Acta 2016, 1861, 730–747. [Google Scholar] [CrossRef]
- Ko, C.W.; Qu, J.; Black, D.D.; Tso, P. Regulation of intestinal lipid metabolism: Current concepts and relevance to disease. Nat. Rev. Gastroenterol. Hepatol. 2020, 17, 169–183. [Google Scholar] [CrossRef]
- Li, X.; Liu, Q.; Pan, Y.; Chen, S.; Zhao, Y.; Hu, Y. New insights into the role of dietary triglyceride absorption in obesity and metabolic diseases. Front. Pharmacol. 2023, 14, 1097835. [Google Scholar] [CrossRef]
- van Greevenbroek, M.M.; Voorhout, W.F.; Erkelens, D.W.; van Meer, G.; de Bruin, T.W. Palmitic acid and linoleic acid metabolism in Caco-2 cells: Different triglyceride synthesis and lipoprotein secretion. J. Lipid Res. 1995, 36, 13–24. [Google Scholar] [CrossRef] [PubMed]
- van Greevenbroek, M.M.; van Meer, G.; Erkelens, D.W.; de Bruin, T.W. Effects of saturated, mono-, and polyunsaturated fatty acids on the secretion of apo B containing lipoproteins by Caco-2 cells. Atherosclerosis 1996, 121, 139–150. [Google Scholar] [CrossRef] [PubMed]
- Lalles, J.P. Recent advances in intestinal alkaline phosphatase, inflammation, and nutrition. Nutr. Rev. 2019, 77, 710–724. [Google Scholar] [CrossRef] [PubMed]
- Plaeke, P.; De Man, J.G.; Smet, A.; Malhotra-Kumar, S.; Pintelon, I.; Timmermans, J.P.; Nullens, S.; Jorens, P.G.; Hubens, G.; De Winter, B.Y. Effects of intestinal alkaline phosphatase on intestinal barrier function in a cecal ligation and puncture (CLP)-induced mouse model for sepsis. Neurogastroenterol. Motil. 2020, 32, e13754. [Google Scholar] [CrossRef] [PubMed]
- Zhou, W.; Davis, E.A.; Dailey, M.J. Obesity, independent of diet, drives lasting effects on intestinal epithelial stem cell proliferation in mice. Exp. Biol. Med. 2018, 243, 826–835. [Google Scholar] [CrossRef] [PubMed]
- Campbell, E.L.; MacManus, C.F.; Kominsky, D.J.; Keely, S.; Glover, L.E.; Bowers, B.E.; Scully, M.; Bruyninckx, W.J.; Colgan, S.P. Resolvin E1-induced intestinal alkaline phosphatase promotes resolution of inflammation through LPS detoxification. Proc. Natl. Acad. Sci. USA 2010, 107, 14298–14303. [Google Scholar] [CrossRef]
- Lecomte, M.; Couedelo, L.; Meugnier, E.; Plaisancie, P.; Letisse, M.; Benoit, B.; Gabert, L.; Penhoat, A.; Durand, A.; Pineau, G.; et al. Dietary emulsifiers from milk and soybean differently impact adiposity and inflammation in association with modulation of colonic goblet cells in high-fat fed mice. Mol. Nutr. Food Res. 2016, 60, 609–620. [Google Scholar] [CrossRef]
- Wang, Q.; Zhou, Y.; Rychahou, P.; Fan, T.W.; Lane, A.N.; Weiss, H.L.; Evers, B.M. Ketogenesis contributes to intestinal cell differentiation. Cell Death Differ. 2017, 24, 458–468. [Google Scholar] [CrossRef]
- DeCoffe, D.; Quin, C.; Gill, S.K.; Tasnim, N.; Brown, K.; Godovannyi, A.; Dai, C.; Abulizi, N.; Chan, Y.K.; Ghosh, S.; et al. Dietary Lipid Type, Rather Than Total Number of Calories, Alters Outcomes of Enteric Infection in Mice. J. Infect. Dis. 2016, 213, 1846–1856. [Google Scholar] [CrossRef]
- Youm, Y.H.; Nguyen, K.Y.; Grant, R.W.; Goldberg, E.L.; Bodogai, M.; Kim, D.; D’Agostino, D.; Planavsky, N.; Lupfer, C.; Kanneganti, T.D.; et al. The ketone metabolite beta-hydroxybutyrate blocks NLRP3 inflammasome-mediated inflammatory disease. Nat. Med. 2015, 21, 263–269. [Google Scholar] [CrossRef]
- Mohammadifard, N.; Haghighatdoost, F.; Rahimlou, M.; Rodrigues, A.P.S.; Gaskarei, M.K.; Okhovat, P.; de Oliveira, C.; Silveira, E.A.; Sarrafzadegan, N. The Effect of Ketogenic Diet on Shared Risk Factors of Cardiovascular Disease and Cancer. Nutrients 2022, 14, 3499. [Google Scholar] [CrossRef] [PubMed]







| CD | SFA-KD | LA-KD | |
|---|---|---|---|
| Protein (E%) | 9.7 | 9.4 | 9.4 |
| Carbohydrate (E%) | 77.8 | 0.5 | 0.5 |
| Fat (E%) | 12.5 | 90.1 | 90.1 |
| Saturated fat (E%) | 2.6 | 56.6 | 22.8 |
| Monounsaturated fat (E%) | 3.0 | 26.0 | 17.9 |
| Polyunsaturated fat (E%) | 6.9 | 4.5 | 49.3 |
| Linoleic acid (E%) | 6.4 | 4.0 | 44.5 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Toivio, L.; Launonen, H.; Lindén, J.; Lehto, M.; Vapaatalo, H.; Salmenkari, H.; Korpela, R. Ketogenic Diet High in Saturated Fat Promotes Colonic Claudin Expression without Changes in Intestinal Permeability to Iohexol in Healthy Mice. Nutrients 2024, 16, 18. https://doi.org/10.3390/nu16010018
Toivio L, Launonen H, Lindén J, Lehto M, Vapaatalo H, Salmenkari H, Korpela R. Ketogenic Diet High in Saturated Fat Promotes Colonic Claudin Expression without Changes in Intestinal Permeability to Iohexol in Healthy Mice. Nutrients. 2024; 16(1):18. https://doi.org/10.3390/nu16010018
Chicago/Turabian StyleToivio, Lotta, Hanna Launonen, Jere Lindén, Markku Lehto, Heikki Vapaatalo, Hanne Salmenkari, and Riitta Korpela. 2024. "Ketogenic Diet High in Saturated Fat Promotes Colonic Claudin Expression without Changes in Intestinal Permeability to Iohexol in Healthy Mice" Nutrients 16, no. 1: 18. https://doi.org/10.3390/nu16010018
APA StyleToivio, L., Launonen, H., Lindén, J., Lehto, M., Vapaatalo, H., Salmenkari, H., & Korpela, R. (2024). Ketogenic Diet High in Saturated Fat Promotes Colonic Claudin Expression without Changes in Intestinal Permeability to Iohexol in Healthy Mice. Nutrients, 16(1), 18. https://doi.org/10.3390/nu16010018

