Perinatal Propionate Supplementation Protects Adult Male Offspring from Maternal Chronic Kidney Disease-Induced Hypertension
Abstract
:1. Introduction
2. Materials and Methods
2.1. Animals and Study Design
2.2. Gas Chromatography–Mass Spectrometry (GC–MS)
2.3. Measurement of Cytokines in the Offspring Kidneys
2.4. Quantitative PCR
2.5. 16S rRNA Gene Sequencing
2.6. Statistical Analysis
3. Results
3.1. Body Weight and Blood Pressure
3.2. Plasma SCFA Levels and SCFA Receptors
3.3. Cytokine Concentrations in the Kidneys
3.4. Gut Microbiota Composition
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Lynch, S.V.; Pedersen, O. The Human Intestinal Microbiome in Health and Disease. N. Engl. J. Med. 2016, 375, 2369–2379. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Matamoros, S.; Gras-Leguen, C.; Le Vacon, F.; Potel, G.; De La Cochetiere, M.-F. Development of intestinal microbiota in infants and its impact on health. Trends Microbiol. 2013, 21, 167–173. [Google Scholar] [CrossRef] [PubMed]
- Vandenplas, Y.; Carnielli, V.P.; Ksiazyk, J.; Luna, M.S.; Migacheva, N.; Mosselmans, J.M.; Picaud, J.C.; Possner, M.; Singhal, A.; Wabitsch, M. Factors affecting early-life intestinal microbiota development. Nutrition 2020, 78, 110812. [Google Scholar] [CrossRef]
- Munkhaugen, J.; Lydersen, S.; Romundstad, P.R.; Widerøe, T.-E.; Vikse, B.E.; Hallan, S. Kidney function and future risk for adverse pregnancy outcomes: A population-based study from HUNT II, Norway. Nephrol. Dial. Transplant. 2009, 24, 3744–3750. [Google Scholar] [CrossRef] [Green Version]
- Piccoli, G.B.; Alrukhaimi, M.; Liu, Z.H.; Zakharova, E.; Levin, A.; World Kidney Day Steering Committee. What we do and do not know about women and kidney diseases; Questions unanswered and answers unquestioned: Reflection on World Kidney Day and International Woman’s Day. Physiol. Int. 2018, 105, 1–18. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Yang, T.; Richards, E.M.; Pepine, C.J.; Raizada, M.K. The gut microbiota and the brain-gut-kidney axis in hypertension and chronic kidney disease. Nat. Rev. Nephrol. 2018, 14, 442–456. [Google Scholar] [CrossRef] [PubMed]
- Hsu, C.N.; Yang, H.W.; Hou, C.Y.; Chang-Chien, G.P.; Lin, S.; Tain, Y.L. Maternal Adenine-Induced Chronic Kidney Disease Programs Hypertension in Adult Male Rat Offspring: Implications of Nitric Oxide and Gut Microbiome Derived Metabolites. Int. J. Mol. Sci. 2020, 21, 7237. [Google Scholar] [CrossRef] [PubMed]
- Pluznick, J.L. Microbial Short-Chain Fatty Acids and Blood Pressure Regulation. Curr. Hypertens. Rep. 2017, 19, 25. [Google Scholar] [CrossRef] [Green Version]
- Marques, F.Z.; Mackay, C.R.; Kaye, D.M. Beyond gut feelings: How the gut microbiota regulates blood pressure. Nat. Rev. Cardiol. 2018, 15, 20–32. [Google Scholar] [CrossRef]
- Felizardo, R.J.F.; Watanabe, I.K.M.; Dardi, P.; Rossoni, L.V.; Câmara, N.O.S. The interplay among gut microbiota, hypertension and kidney diseases: The role of short-chain fatty acids. Pharmacol. Res. 2019, 141, 366–377. [Google Scholar] [CrossRef]
- Hosseini, E.; Grootaert, C.; Verstraete, W.; Van de Wiele, T. Propionate as a health-promoting microbial metabolite in the human gut. Nutr. Rev. 2011, 69, 245–258. [Google Scholar] [CrossRef] [PubMed]
- Ratajczak, W.; Rył, A.; Mizerski, A.; Walczakiewicz, K.; Sipak, O.; Laszczynska, M. Immunomodulatory potential of gut microbiome-derived short-chain fatty acids (SCFAs). Acta Biochim. Pol. 2019, 66, 1–12. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Hsu, C.N.; Tain, Y.L. Chronic Kidney Disease and Gut Microbiota: What Is Their Connection in Early Life? Int. J. Mol. Sci. 2022, 23, 3954. [Google Scholar] [CrossRef]
- Zółkiewicz, J.; Marzec, A.; Ruszczyn’ski, M.; Feleszko, W. Postbiotics-A step beyond pre- and probiotics. Nutrients 2020, 12, 2189. [Google Scholar] [CrossRef]
- Hsu, C.N.; Chang-Chien, G.P.; Lin, S.; Hou, C.Y.; Tain, Y.L. Targeting on Gut Microbial Metabolite Trimethylamine-N-Oxide and Short-Chain Fatty Acid to Prevent Maternal High-Fructose-Diet-Induced Developmental Programming of Hypertension in Adult Male Offspring. Mol. Nutr. Food Res. 2019, 63, e1900073. [Google Scholar] [CrossRef] [PubMed]
- Hsu, C.N.; Yu, H.R.; Lin, I.C.; Tiao, M.M.; Huang, L.T.; Hou, C.Y.; Chang-Chien, G.P.; Lin, S.; Tain, Y.L. Sodium butyrate modulates blood pressure and gut microbiota in maternal tryptophan-free diet-induced hypertension rat offspring. J. Nutr. Biochem. 2022, 108, 109090. [Google Scholar] [CrossRef]
- Bartolomaeus, H.; Balogh, A.; Yakoub, M.; Homann, S.; Markó, L.; Höges, S.; Tsvetkov, D.; Krannich, A.; Wundersitz, S.; Avery, E.G.; et al. Short-Chain Fatty Acid Propionate Protects from Hypertensive Cardiovascular Damage. Circulation 2019, 139, 1407–1421. [Google Scholar] [CrossRef]
- Reckelhoff, J.F. Gender differences in the regulation of blood pressure. Hypertension 2001, 37, 1199–1208. [Google Scholar] [CrossRef] [Green Version]
- Hsu, C.N.; Hou, C.Y.; Chang-Chien, G.P.; Lin, S.; Tain, Y.L. Maternal garlic oil supplementation prevents high-fat diet-induced hypertension in adult rat offspring: Implications of H2S-generating pathway in the gut and kidneys. Mol. Nutr. Food Res. 2021, 65, e2001116. [Google Scholar] [CrossRef]
- Paauw, N.D.; Van Rijn, B.B.; Lely, A.T.; Joles, J.A. Pregnancy as a critical window for blood pressure regulation in mother and child: Programming and reprogramming. Acta Physiol. 2016, 219, 241–259. [Google Scholar] [CrossRef] [Green Version]
- Hsu, C.N.; Tain, Y.L. Animal Models for DOHaD Research: Focus on Hypertension of Developmental Origins. Biomedicines 2021, 9, 623. [Google Scholar] [CrossRef] [PubMed]
- Natarajan, N.; Hori, D.; Flavahan, S.; Steppan, J.; Flavahan, N.A.; Berkowitz, D.E.; Pluznick, J.L. Microbial short chain fatty acid metabolites lower blood pressure via endothelial G protein-coupled receptor 41. Physiol. Genom. 2016, 48, 826–834. [Google Scholar] [CrossRef] [PubMed]
- Dan, X.; Mushi, Z.; Baili, W.; Han, L.; Enqi, W.; Huanhu, Z.; Shuchun, L. Differential Analysis of Hypertension-Associated Intestinal Microbiota. Int. J. Med. Sci. 2019, 16, 872–881. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Palmu, J.; Salosensaari, A.; Havulinna, A.S.; Cheng, S.; Inouye, M.; Jain, M.; Salido, R.A.; Sanders, K.; Brennan, C.; Humphrey, G.C.; et al. Association between the Gut Microbiota and Blood Pressure in a Population Cohort of 6953 Individuals. J. Am. Heart Assoc. 2020, 9, e016641. [Google Scholar] [CrossRef]
- Kim, S.; Goel, R.; Kumar, A.; Qi, Y.; Lobaton, G.; Hosaka, K.; Mohammed, M.; Handberg, E.M.; Richards, E.M.; Pepine, C.J.; et al. Imbalance of gut microbiome and intestinal epithelial barrier dysfunction in patients with high blood pressure. Clin. Sci. 2018, 132, 701–718. [Google Scholar] [CrossRef] [Green Version]
- Tain, Y.L.; Hsu, C.N. Hypertension of Developmental Origins: Consideration of Gut Microbiome in Animal Models. Biomedicines 2022, 10, 875. [Google Scholar] [CrossRef]
- Reichardt, N.; Duncan, S.H.; Young, P.; Belenguer, A.; McWilliam Leitch, C.; Scott, K.P.; Louis, P. Phylogenetic distribution of three pathways for propionate production within the human gut microbiota. ISME J. 2014, 8, 1323–1335. [Google Scholar] [CrossRef] [Green Version]
- Fadhlaoui, K.; Ben Hania, W.; Postec, A.; Fauque, G.; Hamdi, M.; Ollivier, B.; Fardeau, M.L. Fusibacter fontis sp. nov., a sulfur-reducing, anaerobic bacterium isolated from a mesothermic Tunisian spring. Int. J. Syst. Evol. Microbiol. 2015, 65, 3501–3506. [Google Scholar] [CrossRef]
- Hsu, C.N.; Tain, Y.L. Preventing Developmental Origins of Cardiovascular Disease: Hydrogen Sulfide as a Potential Target? Antioxidants 2021, 10, 247. [Google Scholar] [CrossRef]
- Mikami, D.; Kobayashi, M.; Uwada, J.; Yazawa, T.; Kamiyama, K.; Nishimori, K.; Nishikawa, Y.; Nishikawa, S.; Yokoi, S.; Kimura, H.; et al. Short-chain fatty acid mitigates adenine-induced chronic kidney disease via FFA2 and FFA3 pathways. Biochim. Biophys. Acta Mol. Cell Biol. Lipids 2020, 1865, 158666. [Google Scholar] [CrossRef]
Gene | 5′ Primer | 3′ Primer |
---|---|---|
GPR41 | 5 tcttcaccaccgtctatctcac 3 | 5 cacaagtcctgccaccctc 3 |
GPR43 | 5 ctgcctgggatcgtctgtg 3 | 5 cataccctcggccttctgg 3 |
GPR109A | 5 cggtggtctactatttctcc 3 | 5 cccctggaatacttctgatt 3 |
Olfr78 | 5 gaggaagctcacttttggtttgg 3 | 5 cagcttcaatgtccttgtcacag 3 |
R18S | 5 gccgcggtaattccagctcca 3 | 5 cccgcccgctcccaagatc 3 |
Groups | C | CKD | CP | CKDP |
---|---|---|---|---|
Mortality | 0% | 0% | 0% | 0% |
Body weight (BW) (g) | 281 ± 8 a | 304 ± 18 a | 319 ± 11 a | 269 ± 7 b |
Left kidney weight (KW) (g) | 1.31 ± 0.05 b | 1.62 ± 0.08 a | 1.40 ± 0.05 b | 1.33 ± 0.06 b |
Left KW/100 g BW | 0.47 ± 0.01 | 0.55 ± 0.05 | 0.4 ± 0.01 | 0.49 ± 0.01 |
Systolic BP (mmHg) | 132 ± 1 b | 144 ± 1 a | 133 ± 1 b | 135 ± 1 b |
Diastolic BP (mmHg) | 87 ± 2 | 95 ± 2 | 86 ± 2 | 91 ± 1 |
Mean arterial pressure (mmHg) | 102 ± 1 b | 112 ± 2 a | 101 ± 1 b | 106 ± 1 b |
Groups | C | CKD | CP | CKDP |
---|---|---|---|---|
Acetic acid (μM) | 401.4 ± 14.5 | 413.8 ± 18.1 | 425.6 ± 13.9 | 389.8 ± 17.7 |
Propionic acid (μM) | 4.1 ± 0.27 b | 4.24 ± 0.37 b | 9.73 ± 0.34 a | 10.19 ± 0.55 a |
Isobutyric acid (μM) | 4.48 ± 0.19 | 4.34 ± 0.13 | 4.55 ± 0.11 | 4.67 ± 0.15 |
Butyric acid (μM) | 5.44 ± 0.66 | 5.54 ± 0.61 | 7.52 ± 1.03 | 4.98 ± 0.99 |
Isovaleric acid (μM) | 6.98 ± 0.27 | 7.89 ± 0.29 | 7.08 ± 0.48 | 7.17 ± 0.42 |
Valeric acid (μM) | 5.26 ± 0.42 | 5.79 ± 0.29 | 5.33 ± 0.63 | 5.75 ± 0.44 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Tain, Y.-L.; Hou, C.-Y.; Chang-Chien, G.-P.; Lin, S.-F.; Hsu, C.-N. Perinatal Propionate Supplementation Protects Adult Male Offspring from Maternal Chronic Kidney Disease-Induced Hypertension. Nutrients 2022, 14, 3435. https://doi.org/10.3390/nu14163435
Tain Y-L, Hou C-Y, Chang-Chien G-P, Lin S-F, Hsu C-N. Perinatal Propionate Supplementation Protects Adult Male Offspring from Maternal Chronic Kidney Disease-Induced Hypertension. Nutrients. 2022; 14(16):3435. https://doi.org/10.3390/nu14163435
Chicago/Turabian StyleTain, You-Lin, Chih-Yao Hou, Guo-Ping Chang-Chien, Su-Fan Lin, and Chien-Ning Hsu. 2022. "Perinatal Propionate Supplementation Protects Adult Male Offspring from Maternal Chronic Kidney Disease-Induced Hypertension" Nutrients 14, no. 16: 3435. https://doi.org/10.3390/nu14163435