The Modulation of Phase II Drug-Metabolizing Enzymes in Proliferating and Differentiated CaCo-2 Cells by Hop-Derived Prenylflavonoids
Abstract
:1. Introduction
2. Materials and Methods
2.1. Chemicals and Reagents
2.2. Cultivation of the CaCo-2 Cell Line
2.3. Treatment of CaCo-2 Cells with Prenylated Flavonoids
2.4. Preparation of Subcellular Fractions
2.5. Enzymatic Activity Assessment
2.6. Determination of mRNA Expression
2.7. Statistical Analysis
3. Results
3.1. Cytotoxicity of Prenylflavonoids
3.2. The Enzymatic Activity and mRNA Expression of DMEs in Proliferating and Differentiated CaCo-2 Cells
3.3. Modulation of DMEs Expression by Prenylflavonoids
3.4. Effect of Prenylflavonoids on DMEs Activities
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
References
- Bennett, B.J.; Hall, K.D.; Hu, F.B.; McCartney, A.L.; Roberto, C. Nutrition and the science of disease prevention: A systems approach to support metabolic health. Ann. N. Y. Acad. Sci. 2015, 1352, 1–12. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Koch, W. Dietary Polyphenols-Important Non-Nutrients in the Prevention of Chronic Noncommunicable Diseases. A Systematic Review. Nutrients 2019, 11, 1039. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Yuan, Y.; Qiu, X.; Nikolic, D.; Chen, S.N.; Huang, K.; Li, G.; Pauli, G.F.; van Breemen, R.B. Inhibition of human cytochrome P450 enzymes by hops (Humulus lupulus) and hop prenylphenols. Eur. J. Pharm. Sci. 2014, 53, 55–61. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Bolton, J.L.; Dunlap, T.L.; Hajirahimkhan, A.; Mbachu, O.; Chen, S.N.; Chadwick, L.; Nikolic, D.; van Breemen, R.B.; Pauli, G.F.; Dietz, B.M. The Multiple Biological Targets of Hops and Bioactive Compounds. Chem. Res. Toxicol. 2019, 32, 222–233. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Mukai, R. Prenylation enhances the biological activity of dietary flavonoids by altering their bioavailability. Biosci. Biotechnol. Biochem. 2018, 82, 207–215. [Google Scholar] [CrossRef] [Green Version]
- Mukai, R.; Fujikura, Y.; Murota, K.; Uehara, M.; Minekawa, S.; Matsui, N.; Kawamura, T.; Nemoto, H.; Terao, J. Prenylation enhances quercetin uptake and reduces efflux in Caco-2 cells and enhances tissue accumulation in mice fed long-term. J. Nutr. 2013, 143, 1558–1564. [Google Scholar] [CrossRef] [Green Version]
- Hisanaga, A.; Mukai, R.; Sakao, K.; Terao, J.; Hou, D.X. Anti-inflammatory effects and molecular mechanisms of 8-prenyl quercetin. Mol. Nutr. Food Res. 2016, 60, 1020–1032. [Google Scholar] [CrossRef]
- Ambroz, M.; Lnenickova, K.; Matouskova, P.; Skalova, L.; Bousova, I. Antiproliferative Effects of Hop-derived Prenylflavonoids and Their Influence on the Efficacy of Oxaliplatine, 5-fluorouracil and Irinotecan in Human ColorectalC Cells. Nutrients 2019, 11, 879. [Google Scholar] [CrossRef] [Green Version]
- Legette, L.; Karnpracha, C.; Reed, R.L.; Choi, J.; Bobe, G.; Christensen, J.M.; Rodriguez-Proteau, R.; Purnell, J.Q.; Stevens, J.F. Human pharmacokinetics of xanthohumol, an antihyperglycemic flavonoid from hops. Mol. Nutr. Food Res. 2014, 58, 248–255. [Google Scholar] [CrossRef]
- Liu, M.; Hansen, P.E.; Wang, G.; Qiu, L.; Dong, J.; Yin, H.; Qian, Z.; Yang, M.; Miao, J. Pharmacological profile of xanthohumol, a prenylated flavonoid from hops (Humulus lupulus). Molecules 2015, 20, 754–779. [Google Scholar] [CrossRef]
- Seliger, J.M.; Martin, H.J.; Maser, E.; Hintzpeter, J. Potent inhibition of human carbonyl reductase 1 (CBR1) by the prenylated chalconoid xanthohumol and its related prenylflavonoids isoxanthohumol and 8-prenylnaringenin. Chem. Biol. Interact. 2019, 305, 156–162. [Google Scholar] [CrossRef] [PubMed]
- Seliger, J.M.; Misuri, L.; Maser, E.; Hintzpeter, J. The hop-derived compounds xanthohumol, isoxanthohumol and 8-prenylnaringenin are tight-binding inhibitors of human aldo-keto reductases 1B1 and 1B10. J. Enzyme Inhib. Med. Chem. 2018, 33, 607–614. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Henderson, M.C.; Miranda, C.L.; Stevens, J.F.; Deinzer, M.L.; Buhler, D.R. In vitro inhibition of human P450 enzymes by prenylated flavonoids from hops, Humulus lupulus. Xenobiotica 2000, 30, 235–251. [Google Scholar] [CrossRef] [PubMed]
- Dietz, B.M.; Hagos, G.K.; Eskra, J.N.; Wijewickrama, G.T.; Anderson, J.R.; Nikolic, D.; Guo, J.; Wright, B.; Chen, S.N.; Pauli, G.F.; et al. Differential regulation of detoxification enzymes in hepatic and mammary tissue by hops (Humulus lupulus) in vitro and in vivo. Mol. Nutr. Food Res. 2013, 57, 1055–1066. [Google Scholar] [CrossRef] [Green Version]
- Krajka-Kuzniak, V.; Paluszczak, J.; Baer-Dubowska, W. Xanthohumol induces phase II enzymes via Nrf2 in human hepatocytes in vitro. Toxicol. In Vitro 2013, 27, 149–156. [Google Scholar] [CrossRef]
- Radovic, B.; Hussong, R.; Gerhauser, C.; Meinl, W.; Frank, N.; Becker, H.; Kohrle, J. Xanthohumol, a prenylated chalcone from hops, modulates hepatic expression of genes involved in thyroid hormone distribution and metabolism. Mol. Nutr. Food Res. 2010, 54, S225–S235. [Google Scholar] [CrossRef]
- Lea, T. Caco-2 Cell Line. In The Impact of Food Bioactives on Health: In Vitro and Ex Vivo Models; Verhoeckx, K., Cotter, P., Lopez-Exposito, I., Kleiveland, C., Lea, T., Mackie, A., Requena, T., Swiatecka, D., Wichers, H., Eds.; Springer International Publishing: Cham, Switzerland, 2015. [Google Scholar]
- Lnenickova, K.; Prochazkova, E.; Skalova, L.; Matouskova, P.; Bartikova, H.; Soucek, P.; Szotakova, B. Catechins Variously Affect Activities of Conjugation Enzymes in Proliferating and Differentiated Caco-2 Cells. Molecules 2016, 21, 1186. [Google Scholar] [CrossRef] [Green Version]
- Habig, W.H.; Pabst, M.J.; Jakoby, W.B. Glutathione S-Transferases: The first enzymatic step in mercapturic acid formation. J. Biol. Chem. 1974, 249, 7130–7139. [Google Scholar]
- Lnenickova, K.; Dymakova, A.; Szotakova, B.; Bousova, I. Sulforaphane Alters beta-Naphthoflavone-Induced Changes in Activity and Expression of Drug-Metabolizing Enzymes in Rat Hepatocytes. Molecules 2017, 22, 1983. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Frame, L.T.; Ozawa, S.; Nowell, S.A.; Chou, H.C.; DeLongchamp, R.R.; Doerge, D.R.; Lang, N.P.; Kadlubar, F.F. A simple colorimetric assay for phenotyping the major human thermostable phenol sulfotransferase (SULT1A1) using platelet cytosols. Drug Metab. Dispos. 2000, 28, 1063–1068. [Google Scholar]
- Letelier, M.E.; Pimentel, A.; Pino, P.; Lepe, A.M.; Faundez, M.; Aracena, P.; Speisky, H. Microsomal UDP-glucuronyltransferase in rat liver: Oxidative activation. Basic Clin. Pharmacol. Toxicol. 2005, 96, 480–486. [Google Scholar] [CrossRef] [PubMed]
- Aoyama, N.; Tsunoda, M.; Imai, K. Improved assay for catechol-O-methyltransferase activity utilizing norepinephrine as an enzymatic substrate and reversed-phase high-performance liquid chromatography with fluorescence detection. J. Chromatogr. A 2005, 1074, 47–51. [Google Scholar] [CrossRef] [PubMed]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [PubMed]
- Coughtrie, M.W. Ontogeny of Human Conjugating Enzymes. Drug Metab. Lett. 2015, 9, 99–108. [Google Scholar] [CrossRef] [PubMed]
- Stierum, R.; Gaspari, M.; Dommels, Y.; Ouatas, T.; Pluk, H.; Jespersen, S.; Vogels, J.; Verhoeckx, K.; Groten, J.; van Ommen, B. Proteome analysis reveals novel proteins associated with proliferation and differentiation of the colorectal cancer cell line Caco-2. Biochim. Biophys. Acta 2003, 1650, 73–91. [Google Scholar] [CrossRef]
- Mariadason, J.M.; Arango, D.; Corner, G.A.; Aranes, M.J.; Hotchkiss, K.A.; Yang, W.; Augenlicht, L.H. A gene expression profile that defines colon cell maturation in vitro. Cancer Res. 2002, 62, 4791–4804. [Google Scholar] [PubMed]
- Kusano, Y.; Horie, S.; Morishita, N.; Shibata, T.; Uchida, K. Constitutive expression of an antioxidant enzyme, glutathione S-transferase P1, during differentiation of human intestinal Caco-2 cells. Free Radic Biol. Med. 2012, 53, 347–356. [Google Scholar] [CrossRef]
- Kusano, Y.; Horie, S.; Shibata, T.; Satsu, H.; Shimizu, M.; Hitomi, E.; Nishida, M.; Kurose, H.; Itoh, K.; Kobayashi, A.; et al. Keap1 regulates the constitutive expression of GST A1 during differentiation of Caco-2 cells. Biochemistry 2008, 47, 6169–6177. [Google Scholar] [CrossRef]
- Adnan, H.; Quach, H.; MacIntosh, K.; Antenos, M.; Kirby, G.M. Low levels of GSTA1 expression are required for Caco-2 cell proliferation. PLoS ONE 2012, 7, e51739. [Google Scholar] [CrossRef] [Green Version]
- Pshezhetsky, A.V.; Fedjaev, M.; Ashmarina, L.; Mazur, A.; Budman, L.; Sinnett, D.; Labuda, D.; Beaulieu, J.F.; Menard, D.; Nifant’ev, I.; et al. Subcellular proteomics of cell differentiation: Quantitative analysis of the plasma membrane proteome of Caco-2 cells. Proteomics 2007, 7, 2201–2215. [Google Scholar] [CrossRef]
- Bartmanska, A.; Tronina, T.; Poplonski, J.; Milczarek, M.; Filip-Psurska, B.; Wietrzyk, J. Highly Cancer Selective Antiproliferative Activity of Natural Prenylated Flavonoids. Molecules 2018, 23, 2922. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Hudcova, T.; Bryndova, J.; Fialova, K.; Fiala, J.; Karabin, M.; Jelinek, L.; Dostalek, P. Antiproliferative effects of prenylflavonoids from hops on human colon cancer cell lines. J. Inst. Brew. 2014, 120, 225–230. [Google Scholar] [CrossRef]
- Dorn, C.; Kraus, B.; Motyl, M.; Weiss, T.S.; Gehrig, M.; Scholmerich, J.; Heilmann, J.; Hellerbrand, C. Xanthohumol, a chalcon derived from hops, inhibits hepatic inflammation and fibrosis. Mol. Nutr. Food Res. 2010, 54, S205–S213. [Google Scholar] [CrossRef] [PubMed]
- Stompor, M.; Uram, L.; Podgorski, R. In Vitro Effect of 8-Prenylnaringenin and Naringenin on Fibroblasts and Glioblastoma Cells-Cellular Accumulation and Cytotoxicity. Molecules 2017, 22, 1092. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Sastre-Serra, J.; Ahmiane, Y.; Roca, P.; Oliver, J.; Pons, D.G. Xanthohumol, a hop-derived prenylflavonoid present in beer, impairs mitochondrial functionality of SW620 colon cancer cells. Int. J. Food Sci. Nutr. 2019, 70, 396–404. [Google Scholar] [CrossRef] [PubMed]
- Allsopp, P.; Possemiers, S.; Campbell, D.; Gill, C.; Rowland, I. A comparison of the anticancer properties of isoxanthohumol and 8-prenylnaringenin using in vitro models of colon cancer. Biofactors 2013, 39, 441–447. [Google Scholar] [CrossRef] [PubMed]
- Shen, G.; Kong, A.N. Nrf2 plays an important role in coordinated regulation of Phase II drug metabolism enzymes and Phase III drug transporters. Biopharm. Drug Dispos. 2009, 30, 345–355. [Google Scholar] [CrossRef] [Green Version]
- Jirasko, R.; Holcapek, M.; Vrublova, E.; Ulrichova, J.; Simanek, V. Identification of new phase II metabolites of xanthohumol in rat in vivo biotransformation of hop extracts using high-performance liquid chromatography electrospray ionization tandem mass spectrometry. J. Chromatogr. A 2010, 1217, 4100–4108. [Google Scholar] [CrossRef]
- Legette, L.; Ma, L.; Reed, R.L.; Miranda, C.L.; Christensen, J.M.; Rodriguez-Proteau, R.; Stevens, J.F. Pharmacokinetics of xanthohumol and metabolites in rats after oral and intravenous administration. Mol. Nutr. Food Res. 2012, 56, 466–474. [Google Scholar] [CrossRef] [Green Version]
- Pang, Y.; Nikolic, D.; Zhu, D.; Chadwick, L.R.; Pauli, G.F.; Farnsworth, N.R.; van Breemen, R.B. Binding of the hop (Humulus lupulus L.) chalcone xanthohumol to cytosolic proteins in Caco-2 intestinal epithelial cells. Mol. Nutr. Food Res. 2007, 51, 872–879. [Google Scholar] [CrossRef]
- Liu, H.; Yang, Z.; Zang, L.; Wang, G.; Zhou, S.; Jin, G.; Yang, Z.; Pan, X. Downregulation of Glutathione S-transferase A1 suppressed tumor growth and induced cell apoptosis in A549 cell line. Oncol. Lett. 2018, 16, 467–474. [Google Scholar] [CrossRef] [PubMed]
- Pichler, C.; Ferk, F.; Al-Serori, H.; Huber, W.; Jager, W.; Waldherr, M.; Misik, M.; Kundi, M.; Nersesyan, A.; Herbacek, I.; et al. Xanthohumol Prevents DNA Damage by Dietary Carcinogens: Results of a Human Intervention Trial. Cancer Prev. Res. 2017, 10, 153–160. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Lnenickova, K.; Skalova, L.; Stuchlikova, L.; Szotakova, B.; Matouskova, P. Induction of xenobiotic-metabolizing enzymes in hepatocytes by beta-naphthoflavone: Time-dependent changes in activities, protein and mRNA levels. Acta Pharm. 2018, 68, 75–85. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Tornio, A.; Filppula, A.M.; Niemi, M.; Backman, J.T. Clinical Studies on Drug-Drug Interactions Involving Metabolism and Transport: Methodology, Pitfalls, and Interpretation. Clin. Pharmacol. Ther. 2019, 105, 1345–1361. [Google Scholar] [CrossRef]
- Bolton, J.L.; Dunlap, T. Formation and Biological Targets of Quinones: Cytotoxic versus Cytoprotective Effects. Chem. Res. Toxicol. 2017, 30, 13–37. [Google Scholar] [CrossRef] [PubMed]
- Pinto, C.; Cestero, J.J.; Rodriguez-Galdon, B.; Macias, P. Xanthohumol, a prenylated flavonoid from hops (Humulus lupulus L.), protects rat tissues against oxidative damage after acute ethanol administration. Toxicol. Rep. 2014, 1, 726–733. [Google Scholar] [CrossRef] [Green Version]
- Harris, R.M.; Waring, R.H. Sulfotransferase inhibition: Potential impact of diet and environmental chemicals on steroid metabolism and drug detoxification. Curr. Drug Metab. 2008, 9, 269–275. [Google Scholar] [CrossRef] [PubMed]
- Sanchez-Spitman, A.B.; Dezentje, V.O.; Swen, J.J.; Moes, D.; Gelderblom, H.; Guchelaar, H.J. Genetic polymorphisms of 3’-untranslated region of SULT1A1 and their impact on tamoxifen metabolism and efficacy. Breast Cancer Res. Treat. 2018, 172, 401–411. [Google Scholar] [CrossRef] [Green Version]
- Semi, K.; Matsuda, Y.; Ohnishi, K.; Yamada, Y. Cellular reprogramming and cancer development. Int. J. Cancer 2013, 132, 1240–1248. [Google Scholar] [CrossRef]
- Long, M.D.; Campbell, M.J. Pan-cancer analyses of the nuclear receptor superfamily. Nucl. Receptor. Res 2015, 2. [Google Scholar] [CrossRef] [Green Version]
Gene | Forward Primer | Reverse Primer |
---|---|---|
Target genes | ||
COMT | CACCATCGAGATCAACCCCG | TCATACTTCTTCTTCAGCTGGG |
GSTA1/2 | GTGCAGACCAGAGCCATTC | TCACCCAAATCTGCTATACCTTC |
GSTP1 | AGCCTTTTGAGACCCTGCTG | GTCAGCGAAGGAGATCTGGTC |
SULT1A1/2 | ATGGTTCAGCACACGTCGTT | GGACGGTGGTGTAGTTGGTC |
UGT1A6 | CCGGGGTCATGAGATTGTAGT | AGCTCTTCTTGGTCATACGGC |
Reference genes | ||
B2M | TGCTGTCTCCATGTTTGATGTATC | TCTCTGCTCCCCACCTCTAAG |
GAPDH | GAGTCCACTGGCGTCTTCAC | GAGGCATTGCTGATGATCTTGAG |
Enzyme | Proliferating Cells | Differentiated Cells |
---|---|---|
GST | ||
Activity (nmol/min/mg) | 163.9 ± 10.4 | 400.5 ± 33.8 *** |
mRNA GSTA1/2 | 1.00 ± 0.16 | 1.46 ± 0.08 * |
mRNA GSTP1 | 1.00 ± 0.36 | 1.33 ± 0.25 |
SULT | ||
Activity (pmol/min/mg) | 86.6 ± 12.9 | 175.4 ± 52.3 * |
mRNA SULT1A1/2 | 1.00 ± 0.23 | 2.44 ± 0.55 * |
COMT | ||
Activity (nmol/min/mg) | 3.1 ± 2.5 | 9.6 ± 1.2 ** |
mRNA COMT | 1.00 ± 0.32 | 14.44 ± 4.83 ** |
UGT | ||
Activity | n.d. | n.d. |
mRNA UGT1A6 | n.d. |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Lněničková, K.; Šadibolová, M.; Matoušková, P.; Szotáková, B.; Skálová, L.; Boušová, I. The Modulation of Phase II Drug-Metabolizing Enzymes in Proliferating and Differentiated CaCo-2 Cells by Hop-Derived Prenylflavonoids. Nutrients 2020, 12, 2138. https://doi.org/10.3390/nu12072138
Lněničková K, Šadibolová M, Matoušková P, Szotáková B, Skálová L, Boušová I. The Modulation of Phase II Drug-Metabolizing Enzymes in Proliferating and Differentiated CaCo-2 Cells by Hop-Derived Prenylflavonoids. Nutrients. 2020; 12(7):2138. https://doi.org/10.3390/nu12072138
Chicago/Turabian StyleLněničková, Kateřina, Michaela Šadibolová, Petra Matoušková, Barbora Szotáková, Lenka Skálová, and Iva Boušová. 2020. "The Modulation of Phase II Drug-Metabolizing Enzymes in Proliferating and Differentiated CaCo-2 Cells by Hop-Derived Prenylflavonoids" Nutrients 12, no. 7: 2138. https://doi.org/10.3390/nu12072138