Soy Isoflavone Genistein Impedes Cancer Stemness and Mesenchymal Transition in Head and Neck Cancer through Activating miR-34a/RTCB Axis
Abstract
:1. Introduction
2. Materials and Methods
2.1. Cell Culture and Chemical Compounds
2.2. Cell Proliferation Assay
2.3. Secondary Sphere Assay
2.4. Flow Cytometry
2.5. Migration and Invasion Assays
2.6. Colony Formation Analysis
2.7. Real-Time qRT-PCR
2.8. Western Blotting
2.9. Self-Renewal Assay
2.10. Overexpression of miR-34a and miR-34a Inhibitor
2.11. Assessment of Apoptosis
2.12. ROS Analysis
2.13. Analysis of Luciferase Activity
2.14. Subcutaneous Xenografts in Nude Mice
2.15. Statistical Analysis
3. Results
3.1. Genistein Inhibits the Cell Growth of HNC-TIC
3.2. Genistein Suppresses the Stemness Phenotypes and Epithelial-Mesenchymal Transition (EMT) Traits of HNC-TIC
3.3. Genistein Increases the Chemosensitivities and Downregulates the Stemness Features of HNC-TIC
3.4. Genistein Induces Apoptosis of HNC-TIC via miR-34a-Mediated Oxidative Stress
3.5. The Repressed Stemness Phenotypes and EMT Traits by Genistein Is through Activation of miR-34a
3.6. The miR-34a-Depressed Stemness Properties Are via Downregulation of RTCB
3.7. Genistein Attenuates the Oncogenicity in Vivo through Upregulation of miR-34a
4. Discussion
5. Conclusions
Author Contributions
Funding
Conflicts of Interest
References
- Fitzmaurice, C.; Dicker, D.; Pain, A.; Hamavid, H.; Moradi-Lakeh, M.; MacIntyre, M.F.; Allen, C.; Hansen, G.; Woodbrook, R.; Wolfe, C.; et al. The global burden of cancer 2013. JAMA Oncol. 2015, 1, 505–527. [Google Scholar] [CrossRef] [PubMed]
- Bray, F.; Ferlay, J.; Soerjomataram, I.; Siegel, R.L.; Torre, L.A.; Jemal, A. Global cancer statistics 2018: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries. CA Cancer J. Clin. 2018, 68, 394–424. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Duprez, F.; Berwouts, D.; De Neve, W.; Bonte, K.; Boterberg, T.; Deron, P.; Huvenne, W.; Rottey, S.; Mareel, M. Distant metastases in head and neck cancer. Head Neck 2017, 39, 1733–1743. [Google Scholar] [CrossRef] [PubMed]
- Chiou, S.H.; Yu, C.C.; Huang, C.Y.; Lin, S.C.; Liu, C.J.; Tsai, T.H.; Chou, S.H.; Chien, C.S.; Ku, H.H.; Lo, J.F. Positive correlations of Oct-4 and Nanog in oral cancer stem-like cells and high-grade oral squamous cell carcinoma. Clin. Cancer Res. 2008, 14, 4085–4095. [Google Scholar] [CrossRef] [Green Version]
- Clay, M.R.; Tabor, M.; Owen, J.H.; Carey, T.E.; Bradford, C.R.; Wolf, G.T.; Wicha, M.S.; Prince, M.E. Single-marker identification of head and neck squamous cell carcinoma cancer stem cells with aldehyde dehydrogenase. Head Neck 2010, 32, 1195–1201. [Google Scholar] [CrossRef] [Green Version]
- Prince, M.E.; Sivanandan, R.; Kaczorowski, A.; Wolf, G.T.; Kaplan, M.J.; Dalerba, P.; Weissman, I.L.; Clarke, M.F.; Ailles, L.E. Identification of a subpopulation of cells with cancer stem cell properties in head and neck squamous cell carcinoma. Proc. Natl. Acad. Sci. USA 2007, 104, 973–978. [Google Scholar] [CrossRef] [Green Version]
- Gupta, S.C.; Hevia, D.; Patchva, S.; Park, B.; Koh, W.; Aggarwal, B.B. Upsides and downsides of reactive oxygen species for cancer: The roles of reactive oxygen species in tumorigenesis, prevention, and therapy. Antioxid. Redox Signal. 2012, 16, 1295–1322. [Google Scholar] [CrossRef] [Green Version]
- Vurusaner, B.; Poli, G.; Basaga, H. Tumor suppressor genes and ROS: Complex networks of interactions. Free Radic. Biol. Med. 2012, 52, 7–18. [Google Scholar] [CrossRef]
- Ozben, T. Oxidative stress and apoptosis: Impact on cancer therapy. J. Pharm. Sci. 2007, 96, 2181–2196. [Google Scholar] [CrossRef]
- Chang, C.W.; Chen, Y.S.; Chou, S.H.; Han, C.L.; Chen, Y.J.; Yang, C.C.; Huang, C.Y.; Lo, J.F. Distinct subpopulations of head and neck cancer cells with different levels of intracellular reactive oxygen species exhibit diverse stemness, proliferation, and chemosensitivity. Cancer Res. 2014, 74, 6291–6305. [Google Scholar] [CrossRef] [Green Version]
- Nassar, D.; Blanpain, C. Cancer stem cells: Basic Concepts and therapeutic implications. Annu. Rev. Pathol. 2016, 11, 47–76. [Google Scholar] [CrossRef] [PubMed]
- Liu, J.; Wang, Z. Increased oxidative stress as a selective anticancer therapy. Oxid. Med. Cell Longev. 2015, 2015, 294303. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Gorrini, C.; Harris, I.S.; Mak, T.W. Modulation of oxidative stress as an anticancer strategy. Nat. Rev. Drug Discov. 2013, 12, 931–947. [Google Scholar] [CrossRef] [PubMed]
- Coward, L.; Barnes, N.C.; Setchell, K.D.R.; Barnes, S. Genistein, Daidzein, and their -Glycoside Conjugates: Antitumor isoflavones in soybean foods from American and Asian diets. J. Agric. Food Chem. 1993, 41, 1961–1967. [Google Scholar] [CrossRef]
- Kapiotis, S.; Hermann, M.; Held, I.; Seelos, C.; Ehringer, H.; Gmeiner, B.M. Genistein, the dietary-derived angiogenesis inhibitor, prevents LDL oxidation and protects endothelial cells from damage by atherogenic LDL. Arterioscler. Thromb. Vasc. Biol. 1997, 17, 2868–2874. [Google Scholar] [CrossRef]
- Russo, M.; Russo, G.L.; Daglia, M.; Kasi, P.D.; Ravi, S.; Nabavi, S.F.; Nabavi, S.M. Understanding genistein in cancer: The “good” and the “bad” effects: A review. Food Chem. 2016, 196, 589–600. [Google Scholar] [CrossRef]
- de Oliveira, M.R. Evidence for genistein as a mitochondriotropic molecule. Mitochondrion 2016, 29, 35–44. [Google Scholar] [CrossRef]
- Alhasan, S.A.; Aranha, O.; Sarkar, F.H. Genistein elicits pleiotropic molecular effects on head and neck cancer cells. Clin. Cancer Res. 2001, 7, 4174–4181. [Google Scholar]
- Alhasan, S.A.; Ensley, J.F.; Sarkar, F.H. Genistein induced molecular changes in a squamous cell carcinoma of the head and neck cell line. Int. J. Oncol. 2000, 16, 333–338. [Google Scholar] [CrossRef]
- Alhasan, S.A.; Pietrasczkiwicz, H.; Alonso, M.D.; Ensley, J.; Sarkar, F.H. Genistein-induced cell cycle arrest and apoptosis in a head and neck squamous cell carcinoma cell line. Nutr. Cancer 1999, 34, 12–19. [Google Scholar] [CrossRef]
- Ye, F.; Wu, J.; Dunn, T.; Yi, J.; Tong, X.; Zhang, D. Inhibition of cyclooxygenase-2 activity in head and neck cancer cells by genistein. Cancer Lett. 2004, 211, 39–46. [Google Scholar] [CrossRef] [PubMed]
- Myoung, H.; Hong, S.P.; Yun, P.Y.; Lee, J.H.; Kim, M.J. Anti-cancer effect of genistein in oral squamous cell carcinoma with respect to angiogenesis and in vitro invasion. Cancer Sci. 2003, 94, 215–220. [Google Scholar] [CrossRef] [PubMed]
- Fan, P.; Fan, S.; Wang, H.; Mao, J.; Shi, Y.; Ibrahim, M.M.; Ma, W.; Yu, X.; Hou, Z.; Wang, B.; et al. Genistein decreases the breast cancer stem-like cell population through Hedgehog pathway. Stem Cell Res. Ther. 2013, 4, 146. [Google Scholar] [CrossRef] [Green Version]
- Zhang, L.; Li, L.; Jiao, M.; Wu, D.; Wu, K.; Li, X.; Zhu, G.; Yang, L.; Wang, X.; Hsieh, J.T.; et al. Genistein inhibits the stemness properties of prostate cancer cells through targeting Hedgehog-Gli1 pathway. Cancer Lett. 2012, 323, 48–57. [Google Scholar] [CrossRef] [PubMed]
- Yu, D.; Shin, H.S.; Lee, Y.S.; Lee, D.; Kim, S.; Lee, Y.C. Genistein attenuates cancer stem cell characteristics in gastric cancer through the downregulation of Gli1. Oncol. Rep. 2014, 31, 673–678. [Google Scholar] [CrossRef] [PubMed]
- Huang, W.; Wan, C.; Luo, Q.; Huang, Z.; Luo, Q. Genistein-inhibited cancer stem cell-like properties and reduced chemoresistance of gastric cancer. Int. J. Mol. Sci. 2014, 15, 3432–3443. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Zhang, Q.; Cao, W.S.; Wang, X.Q.; Zhang, M.; Lu, X.M.; Chen, J.Q.; Chen, Y.; Ge, M.M.; Zhong, C.Y.; Han, H.Y. Genistein inhibits nasopharyngeal cancer stem cells through sonic hedgehog signaling. Phytother. Res. 2019, 33, 2783–2791. [Google Scholar] [CrossRef]
- Xia, J.; Duan, Q.; Ahmad, A.; Bao, B.; Banerjee, S.; Shi, Y.; Ma, J.; Geng, J.; Chen, Z.; Rahman, K.M.; et al. Genistein inhibits cell growth and induces apoptosis through up-regulation of miR-34a in pancreatic cancer cells. Curr. Drug Targets 2012, 13, 1750–1756. [Google Scholar] [CrossRef]
- Chiyomaru, T.; Yamamura, S.; Fukuhara, S.; Yoshino, H.; Kinoshita, T.; Majid, S.; Saini, S.; Chang, I.; Tanaka, Y.; Enokida, H.; et al. Genistein inhibits prostate cancer cell growth by targeting miR-34a and oncogenic HOTAIR. PLoS ONE 2013, 8, e70372. [Google Scholar] [CrossRef]
- Hsieh, P.L.; Liao, Y.W.; Pichler, M.; Yu, C.C. MicroRNAs as theranostics targets in oral carcinoma stem cells. Cancers 2020, 12, 340. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Liu, C.; Kelnar, K.; Liu, B.; Chen, X.; Calhoun-Davis, T.; Li, H.; Patrawala, L.; Yan, H.; Jeter, C.; Honorio, S.; et al. The microRNA miR-34a inhibits prostate cancer stem cells and metastasis by directly repressing CD44. Nat. Med. 2011, 17, 211–215. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kang, L.; Mao, J.; Tao, Y.; Song, B.; Ma, W.; Lu, Y.; Zhao, L.; Li, J.; Yang, B.; Li, L. MicroRNA-34a suppresses the breast cancer stem cell-like characteristics by downregulating Notch1 pathway. Cancer Sci. 2015, 106, 700–708. [Google Scholar] [CrossRef] [PubMed]
- Smulow, J.B.; Glickman, I. An epithelial-like cell line in continuous culture from normal adult human gingiva. Proc. Soc. Exp. Biol. Med. 1966, 121, 1294–1296. [Google Scholar] [CrossRef] [PubMed]
- Mendez, M.G.; Kojima, S.-I.; Goldman, R.D. Vimentin Induces Changes in Cell Shape, Motility, and Adhesion During the Epithelial to Mesenchymal Transition. FASEB J. 2010, 24, 1838–1851. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Lu, Y.; Liang, F.X.; Wang, X. A synthetic biology approach identifies the mammalian UPR RNA ligase RtcB. Mol. Cell 2014, 55, 758–770. [Google Scholar] [CrossRef] [Green Version]
- Madden, E.; Logue, S.E.; Healy, S.J.; Manie, S.; Samali, A. The Role of the Unfolded Protein Response in Cancer Progression: From Oncogenesis to Chemoresistance. Biol. Cell 2019, 111, 1–17. [Google Scholar] [CrossRef]
- Rigalli, J.P.; Ciriaci, N.; Mottino, A.D.; Catania, V.A.; Ruiz, M.L. Modulation of expression and activity of ABC Transporters by the phytoestrogen genistein. Impact on drug disposition. Curr. Med. Chem. 2016, 23, 1370–1389. [Google Scholar] [CrossRef]
- Saxena, M.; Stephens, M.A.; Pathak, H.; Rangarajan, A. Transcription factors that mediate epithelial-mesenchymal transition lead to multidrug resistance by upregulating ABC transporters. Cell Death Dis. 2011, 2, e179. [Google Scholar] [CrossRef] [Green Version]
- Tarasov, V.; Jung, P.; Verdoodt, B.; Lodygin, D.; Epanchintsev, A.; Menssen, A.; Meister, G.; Hermeking, H. Differential regulation of microRNAs by p53 revealed by massively parallel sequencing: miR-34a is a p53 target that induces apoptosis and G1-arrest. Cell Cycle 2007, 6, 1586–1593. [Google Scholar] [CrossRef] [Green Version]
- Chang, T.C.; Wentzel, E.A.; Kent, O.A.; Ramachandran, K.; Mullendore, M.; Lee, K.H.; Feldmann, G.; Yamakuchi, M.; Ferlito, M.; Lowenstein, C.J.; et al. Transactivation of miR-34a by p53 broadly influences gene expression and promotes apoptosis. Mol. Cell 2007, 26, 745–752. [Google Scholar] [CrossRef] [Green Version]
- Bommer, G.T.; Gerin, I.; Feng, Y.; Kaczorowski, A.J.; Kuick, R.; Love, R.E.; Zhai, Y.; Giordano, T.J.; Qin, Z.S.; Moore, B.B.; et al. p53-mediated activation of miRNA34 candidate tumor-suppressor genes. Curr. Biol. 2007, 17, 1298–1307. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Swanton, E.; Savory, P.; Cosulich, S.; Clarke, P.; Woodman, P. Bcl-2 regulates a caspase-3/caspase-2 apoptotic cascade in cytosolic extracts. Oncogene 1999, 18, 1781–1787. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Liu, K.; Huang, J.; Xie, M.; Yu, Y.; Zhu, S.; Kang, R.; Cao, L.; Tang, D.; Duan, X. MIR34A regulates autophagy and apoptosis by targeting HMGB1 in the retinoblastoma cell. Autophagy 2014, 10, 442–452. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kumar, B.; Yadav, A.; Lang, J.; Teknos, T.N.; Kumar, P. Dysregulation of microRNA-34a expression in head and neck squamous cell carcinoma promotes tumor growth and tumor angiogenesis. PLoS ONE 2012, 7, e37601. [Google Scholar] [CrossRef]
- Siemens, H.; Jackstadt, R.; Hunten, S.; Kaller, M.; Menssen, A.; Gotz, U.; Hermeking, H. miR-34 and SNAIL form a double-negative feedback loop to regulate epithelial-mesenchymal transitions. Cell Cycle 2011, 10, 4256–4271. [Google Scholar] [CrossRef] [Green Version]
- Chakravarty, A.K.; Shuman, S. The sequential 2′,3′-cyclic phosphodiesterase and 3′-phosphate/5′-OH ligation steps of the RtcB RNA splicing pathway are GTP-dependent. Nucleic Acids Res. 2012, 40, 8558–8567. [Google Scholar] [CrossRef] [Green Version]
Primer Name | Forward Primers | Reverse Primers |
---|---|---|
E-cadherin | ATTCTGATTCTGCTGCTCTTG | AGTCCTGGTCCTCTTCTCC |
Vimentin | CAATGTTAAGATGGCCCTTG | GGGTATCAACCAGAGGGAGT |
Snail | GCAGCTATTTCAGCCTCCTG | GTTCTGGGAGACACATCGGT |
Slug | GTGATTATTTCCCCGTATCTCTAT | CAATGGCATGGGGGTCTGAAAG |
ZEB1 | AGCAGTGAAAGAGAAGGGAATGC | GGTCCTCTTCAGGTGCCTCAG |
GAPDH | CTCATGACCACAGTCCATGC | TTCAGCTCTGGGATGACCTT |
Antibody | Species | Dilution Ratio | Company |
---|---|---|---|
Snail | mouse | 1:1000 | Cell signaling technology |
ZEB1 | rabbit | 1:1000 | Santa cruz biotechnology |
Vimentin | mouse | 1:1000 | Santa cruz biotechnology |
Slug | mouse | 1:1000 | Santa cruz biotechnology |
E-cadherin | mouse | 1:1000 | Santa cruz biotechnology |
RTCB | rabbit | 1:1000 | Thermo fisher scientific |
GAPDH | mouse | 1:5000 | GeneTex |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Hsieh, P.-L.; Liao, Y.-W.; Hsieh, C.-W.; Chen, P.-N.; Yu, C.-C. Soy Isoflavone Genistein Impedes Cancer Stemness and Mesenchymal Transition in Head and Neck Cancer through Activating miR-34a/RTCB Axis. Nutrients 2020, 12, 1924. https://doi.org/10.3390/nu12071924
Hsieh P-L, Liao Y-W, Hsieh C-W, Chen P-N, Yu C-C. Soy Isoflavone Genistein Impedes Cancer Stemness and Mesenchymal Transition in Head and Neck Cancer through Activating miR-34a/RTCB Axis. Nutrients. 2020; 12(7):1924. https://doi.org/10.3390/nu12071924
Chicago/Turabian StyleHsieh, Pei-Ling, Yi-Wen Liao, Chang-Wei Hsieh, Pei-Ni Chen, and Cheng-Chia Yu. 2020. "Soy Isoflavone Genistein Impedes Cancer Stemness and Mesenchymal Transition in Head and Neck Cancer through Activating miR-34a/RTCB Axis" Nutrients 12, no. 7: 1924. https://doi.org/10.3390/nu12071924