Anti-Inflammatory Effects of Asian Fawn Lily (Erythronium japonicum) Extract on Lipopolysaccharide-Induced Depressive-Like Behavior in Mice
Abstract
1. Introduction
2. Materials and Methods
2.1. Sample Preparation
2.2. Animals
2.3. Experimental Design and Sample Administration
2.4. Open Field Test (OFT)
2.5. Passive Avoidance Test (PAT)
2.6. Tail Suspension Test (TST)
2.7. Forced Swim Test (FST)
2.8. Western Blotting
2.9. Quantitative Reverse Transcription Polymerase Chain Reaction (RT-qPCR)
2.10. Statistical Analysis
3. Results
3.1. Effect of EJE on the OFT
3.2. Effect on EJE on PAT
3.3. Effect of EJE on the TST
3.4. Effect of EJE on the FST
3.5. Effect of EJE on Cytokines
3.6. Effect of EJE on the BDNF-PI3K/Akt Signaling Pathway
4. Discussion
5. Conclusions
Author Contributions
Funding
Conflicts of Interest
References
- Simple questionnaire screens for common psychiatric disorders. This new tool helps identify anxiety disorders, depression and other mental health conditions. Duke Med. Health News 2010, 16, 7.
- Murray, C.J.; Lopez, A.D. Alternative projections of mortality and disability by cause 1990–2020: Global burden of disease study. Lancet 1997, 349, 1498–1504. [Google Scholar] [CrossRef]
- Czarny, P.; Wigner, P.; Galecki, P.; Sliwinski, T. The interplay between inflammation, oxidative stress, DNA damage, DNA repair and mitochondrial dysfunction in depression. Prog. Neuropsychopharmacol. Biol. Psychiatry 2018, 80, 309–321. [Google Scholar] [CrossRef]
- Pariante, C.M. Why are depressed patients inflamed? A reflection on 20 years of research on depression, glucocorticoid resistance and inflammation. Eur. Neuropsychopharmacol. 2017, 27, 554–559. [Google Scholar] [CrossRef] [PubMed]
- Dantzer, R.; O’Connor, J.C.; Lawson, M.A.; Kelley, K.W. Inflammation-associated depression: From serotonin to kynurenine. Psychoneuroendocrinology 2011, 36, 426–436. [Google Scholar] [CrossRef] [PubMed]
- Yoshimura, R.; Hori, H.; Ikenouchi-Sugita, A.; Umene-Nakano, W.; Ueda, N.; Nakamura, J. Higher plasma interleukin-6 (IL-6) level is associated with SSRI- or SNRI-refractory depression. Prog. Neuropsychopharmacol. Biol. Psychiatry 2009, 33, 722–726. [Google Scholar] [CrossRef] [PubMed]
- Jiménez-Fernández, S.; Gurpegui, M.; Díaz-Atienza, F.; Pérez-Costillas, L.; Gerstenberg, M.; Correll, C.U. Oxidative stress and antioxidant parameters in patients with major depressive disorder compared to healthy controls before and after antidepressant treatment. J. Clin. Psychiatry 2015, 76, 1658–1667. [Google Scholar] [CrossRef] [PubMed]
- Akhondzadeh, S.; Jafari, S.; Raisi, F.; Nasehi, A.A.; Ghoreishi, A.; Salehi, B.; Mohebbi-Rasa, S.; Raznahan, M.; Kamalipour, A. Clinical trial of adjunctive celecoxib treatment in patients with major depression: A double blind and placebo controlled trial. Depress. Anxiety 2009, 26, 607–611. [Google Scholar] [CrossRef]
- Saleh, L.A.; Hamza, M.; El Gayar, N.H.; El-Samad, A.A.A.; Nasr, E.A.; Masoud, S.I. Ibuprofen suppresses depressive like behavior induced by BCG inoculation in mice: Role of nitric oxide and prostaglandin. Pharmacol. Biochem. Behav. 2014, 125, 29–39. [Google Scholar] [CrossRef]
- Myint, A.M.; Steinbusch, H.W.; Goeghegan, L.; Luchtman, D.; Kim, Y.K.; Leonard, B.E. Effect of the COX-2 inhibitor celecoxib on behavioural and immune changes in an olfactory bulbectomised rat model of depression. Neuroimmunomodulation 2007, 14, 65–71. [Google Scholar] [CrossRef]
- Liu, D.; Wang, Z.; Liu, S.; Wang, F.; Zhao, S.; Hao, A. Anti-inflammatory effects of fluoxetine in lipopolysaccharide(LPS)-stimulated microglial cells. Neuropharmacology 2011, 61, 592–599. [Google Scholar] [CrossRef] [PubMed]
- Roumestan, C.; Michel, A.; Bichon, F.; Portet, K.; Detoc, M.; Henriquet, C.; Jaffuel, D.; Mathieu, M. Anti-inflammatory properties of desipramine and fluoxetine. Respir. Res. 2007, 8, 35. [Google Scholar] [CrossRef] [PubMed]
- Sidor, M.M.; MacQueen, G.M. Antidepressants for the acute treatment of bipolar depression. J. Clin. Psychiatry 2010, 72, 156–167. [Google Scholar] [CrossRef] [PubMed]
- Dome, P.; Tombor, L.; Lazary, J.; Gonda, X.; Rihmer, Z. Natural health products, dietary minerals and over-the-counter medications as add-on therapies to antidepressants in the treatment of major depressive disorder: A review. Brain Res. Bull. 2019, 146, 51–78. [Google Scholar] [CrossRef] [PubMed]
- Pirotta, M.; Willis, K.; Carter, M.; Forsdike, K.; Newton, D.; Gunn, J.; Forsdike-Young, K. ‘Less like a drug than a drug’: The use of St. John’s wort among people who self-identify as having depression and/or anxiety symptoms. Complement. Ther. Med. 2014, 22, 870–876. [Google Scholar] [CrossRef] [PubMed]
- Heo, B.-G.; Park, Y.-S.; Chon, S.-U.; Lee, S.-Y.; Cho, J.-Y.; Gorinstein, S. Antioxidant activity and cytotoxicity of methanol extracts from aerial parts of Korean salad plants. BioFactors 2007, 30, 79–89. [Google Scholar] [CrossRef]
- Bae, C.-S.; Yun, C.-H.; Ahn, T. Extracts from Erythronium japonicum and Corylopsis coreana Uyeki reduce 1,3-dichloro-2-propanol-mediated oxidative stress in human hepatic cells. Food Sci. Biotechnol. 2018, 28, 175–180. [Google Scholar] [CrossRef]
- Seo, J.-H.; Bang, M.-A.; Kim, G.; Cho, S.S.; Park, D.-H. Erythronium japonicum attenuates histopathological lung abnormalities in a mouse model of ovalbumin-induced asthma. Int. J. Mol. Med. 2016, 37, 1221–1228. [Google Scholar] [CrossRef][Green Version]
- Park, J.; Kim, Y.T. Erythronium japonicum alleviates inflammatory pain by inhibiting MAPK activation and by suppressing NF-κB activation via ERK/Nrf2/HO-1 signaling pathway. Antioxidants 2020, 9, 626. [Google Scholar] [CrossRef]
- Zhu, L.; Wei, T.; Gao, J.; Chang, X.; He, H.; Miao, M.; Yan, T. Salidroside attenuates lipopolysaccharide (LPS) induced serum cytokines and depressive-like behavior in mice. Neurosci. Lett. 2015, 606, 1–6. [Google Scholar] [CrossRef]
- Lim, D.W.; Han, T.; Jung, J.; Song, Y.; Um, M.Y.; Yoon, M.; Kim, Y.T.; Cho, S.; Kim, I.-H.; Han, D.; et al. Chlorogenic acid from Hawthorn berry (Crataegus pinnatifida fruit) prevents stress hormone-induced depressive behavior, through monoamine oxidase B-reactive oxygen species signaling in hippocampal astrocytes of mice. Mol. Nutr. Food Res. 2018, 62, e1800029. [Google Scholar] [CrossRef] [PubMed]
- Lim, D.W.; Han, T.; Um, M.Y.; Yoon, M.; Kim, T.-E.; Kim, Y.T.; Han, D.; Lee, J.; Lee, C.H. Administration of Asian herb bennet (Geum japonicum) extract reverses depressive-like behaviors in mouse model of depression induced by corticosterone. Nutrients 2019, 11, 2841. [Google Scholar] [CrossRef] [PubMed]
- Sousa Rodrigues, F.T.; de Souza, M.R.M.; de Carvalho Lima, C.N.; da Silva, F.E.R.; da Silca Costa, D.V.; Costa Dos Santos, C.; Miyajima, F.; de Sousa, F.C.F.; Mendes Vasconcelos, S.M.; Barichello, T.; et al. Major depression model induced by repeated and intermittent lipopolysaccharide administration: Long-lasting behavioral, neuroimmune and neuroprogressive alterations. J. Psychiatr. Res. 2018, 107, 57–67. [Google Scholar] [CrossRef] [PubMed]
- Akihisa, T.; Kawashima, K.; Orido, M.; Akazawa, H.; Matsumoto, M.; Yamamoto, A.; Ogihara, E.; Fukatsu, M.; Tokuda, H.; Fuji, J. Antioxidative and melanogenesis-inhibitory activities of caffeoylquinic acids and other compounds from moxa. Chem. Biodivers. 2013, 10, 313–327. [Google Scholar] [CrossRef] [PubMed]
- Petit-Demouliere, B.; Chenu, F.; Bourin, M. Forced swimming test in mice: A review of antidepressant activity. Psychopharmacology 2005, 177, 245–255. [Google Scholar] [CrossRef] [PubMed]
- Jeon, S.W.; Kim, Y.K. Neuroinflammation and cytokine abnormality in major depression: Cause or consequence in that illness? World J. Psychiatry 2016, 6, 283–293. [Google Scholar] [CrossRef]
- Montini, M.; Levoni, P.; Ongaro, A.; Pagani, G. Controlled application of cynarin in the treatment of hyperlipemic syndrome. Observations in 60 cases. Arzneimittelforschung 1975, 25, 1311–1314. [Google Scholar]
- Miller, A.H.; Maletic, V.; Raison, C.L. Inflammation and its discontents: The role of cytokines in the pathophysiology of major depression. Biol. Psychiatry 2009, 65, 732–741. [Google Scholar] [CrossRef]
- Hannestad, J.; DellaGioia, N.; Bloch, M.H. The effect of antidepressant medication treatment on serum levels of inflammatory cytokines: A meta-analysis. Neuropsychopharmacology 2011, 36, 2452–2459. [Google Scholar] [CrossRef]
- Yong-Ku, K.; Na, K.-S.; Myint, A.-M.; Leonard, B.E. The role of pro-inflammatory cytokines in neuroinflammation, neurogenesis and the neuroendocrine system in major depression. Prog. Neuropsychopharmacol. Biol. Psychiatry 2016, 64, 277–284. [Google Scholar] [CrossRef]
- Felger, J.C.; Lotrich, F.E. Inflammatory cytokines in depression: Neurobiological mechanisms and therapeutic implications. Neuroscience 2013, 246, 199–229. [Google Scholar] [CrossRef] [PubMed]
- He, Y.; Li, W.; Wang, Y.; Tian, Y.; Chen, X.; Wu, Z.; Lan, T.; Li, Y.; Bai, M.; Liu, J.; et al. Major depression accompanied with inflammation and multiple cytokines alterations: Evidences from clinical patients to macaca fascicularis and LPS-induced depressive mice model. J. Affect. Disord. 2020, 271, 262–271. [Google Scholar] [CrossRef] [PubMed]
- Li, M.; Li, C.; Yu, H.; Cai, X.; Shen, X.; Sun, X.; Wang, J.; Zhang, Y.; Wang, C. Lentivirus-mediated interleukin-1β (IL-1β) knock-down in the hippocampus alleviates lipopolysaccharide (LPS)-induced memory deficits and anxiety- and depression-like behaviors in mice. J. Neuroinflamm. 2017, 14, 1–12. [Google Scholar] [CrossRef] [PubMed]
- Yamada, K.; Iida, R.; Miyamoto, Y.; Saito, K.; Sekikawa, K.; Seishima, M.; Nabeshima, T. Neurobehavioral alterations in mice with a targeted deletion of the tumor necrosis factor-α gene: Implications for emotional behavior. J. Neuroimmunol. 2000, 111, 131–138. [Google Scholar] [CrossRef]
- Chourbaji, S.; Urani, A.; Inta, I.; Sanchis-Segura, C.; Brandwein, C.; Zink, M.; Schwaninger, M.; Gass, P. IL-6 knockout mice exhibit resistance to stress-induced development of depression-like behaviors. Neurobiol. Dis. 2006, 23, 587–594. [Google Scholar] [CrossRef]
- Worthen, R.J.; Zighelboim, S.S.G.; Jaramillo, C.S.T.; Beurel, E. Anti-inflammatory IL-10 administration rescues depression-associated learning and memory deficits in mice. J. Neuroinflamm. 2020, 17, 1–16. [Google Scholar] [CrossRef]
- Okamoto, T. NF-kappaB and rheumatic diseases. Endocr. Metab. Immune Disord. Drug Targets 2006, 6, 359–372. [Google Scholar] [CrossRef]
- Atreya, I.; Atreya, R.; Neurath, M.F. NF-κB in inflammatory bowel disease. J. Intern. Med. 2008, 263, 591–596. [Google Scholar] [CrossRef]
- Liu, T.; Zhang, L.; Joo, D.; Sun, S.-C. NF-κB signaling in inflammation. Signal. Transduct. Target. Ther. 2017, 2, 17023. [Google Scholar] [CrossRef]
- Koo, J.W.; Russo, S.J.; Ferguson, D.; Nestler, E.J.; Duman, R.S. Nuclear factor-κB is a critical mediator of stress-impaired neurogenesis and depressive behavior. Proc. Natl. Acad. Sci. USA 2010, 107, 2669–2674. [Google Scholar] [CrossRef]
- Wang, Y.; Xu, J.; Liu, Y.; Li, Z.; Li, X.-H. TLR4-NF-κB signal involved in depressive-like behaviors and cytokine expression of frontal cortex and hippocampus in stressed C57BL/6 and ob/ob mice. Neural Plast. 2018, 2018, 1–12. [Google Scholar] [CrossRef] [PubMed]
- Song, M.-T.; Ruan, J.; Zhang, R.-Y.; Deng, J.; Ma, Z.; Ma, S. Astragaloside IV ameliorates neuroinflammation-induced depressive-like behaviors in mice via the PPARγ/NF-κB/NLRP3 inflammasome axis. Acta Pharmacol. Sin. 2018, 39, 1559–1570. [Google Scholar] [CrossRef] [PubMed]
- Wang, Q.; Dong, X.; Li, N.; Wang, Y.; Guan, X.; Lin, Y.; Kang, J.; Zhang, X.; Zhang, Y.; Li, X.; et al. JSH-23 prevents depressive-like behaviors in mice subjected to chronic mild stress: Effects on inflammation and antioxidant defense in the hippocampus. Pharmacol. Biochem. Behav. 2018, 169, 59–66. [Google Scholar] [CrossRef] [PubMed]
- Li, K.; Yan, L.; Zhang, Y.; Yang, Z.; Zhang, C.; Li, Y.; Kalueff, A.V.; Li, W.; Song, C. Seahorse treatment improves depression-like behavior in mice exposed to CUMS through reducing inflammation/oxidants and restoring neurotransmitter and neurotrophin function. J. Ethnopharmacol. 2020, 250, 112487. [Google Scholar] [CrossRef]
- Depino, A.M. Early prenatal exposure to LPS results in anxiety- and depression-related behaviors in adulthood. Neuroscience 2015, 299, 56–65. [Google Scholar] [CrossRef]
- André, C.; Dinel, A.-L.; Ferreira, G.; Layé, S.; Castanon, N. Diet-induced obesity progressively alters cognition, anxiety-like behavior and lipopolysaccharide-induced depressive-like behavior: Focus on brain indoleamine 2,3-dioxygenase activation. Brain Behav. Immun. 2014, 41, 10–21. [Google Scholar] [CrossRef]
- Zhao, J.; Bi, W.; Xiao, S.; Lan, X.; Cheng, X.; Zhang, J.; Lu, D.; Wei, W.; Wang, Y.; Li, H.; et al. Neuroinflammation induced by lipopolysaccharide causes cognitive impairment in mice. Sci. Rep. 2019, 9, 5790. [Google Scholar] [CrossRef]
- Jaeger, L.B.; Dohgu, S.; Sultana, R.; Lynch, J.L.; Owen, J.B.; Erickson, M.A.; Shah, G.N.; Price, T.O.; Fleegal-Demotta, M.A.; Butterfiled, D.A.; et al. Lipopolysaccharide alters the blood–brain barrier transport of amyloid β protein: A mechanism for inflammation in the progression of Alzheimer’s disease. Brain Behav. Immun. 2009, 23, 507–517. [Google Scholar] [CrossRef]
- Jain, N.; Kulkarni, S.; Singh, A. Lipopolysaccharide-mediated immobility in mice: Reversal by cyclooxygenase enzyme inhibitors. Methods Find. Exp. Clin. Pharmacol. 2001, 23, 441–444. [Google Scholar] [CrossRef]
- Renard, C.E.; Dailly, E.; David, D.J.; Hascoet, M.; Bourin, M. Monoamine metabolism changes following the mouse forced swimming test but not the tail suspension test. Fundam. Clin. Pharmacol. 2003, 17, 449–455. [Google Scholar] [CrossRef]
- Engeland, C.G.; Nielsen, D.V.; Kavaliers, M.; Ossenkopp, K. Locomotor activity changes following lipopolysaccharide treatment in mice: A multivariate assessment of behavioral tolerance. Physiol. Behav. 2001, 72, 481–491. [Google Scholar] [CrossRef]
- Choi, D.-Y.; Lee, J.W.; Lin, G.; Lee, Y.K.; Lee, Y.H.; Choi, I.S.; Han, S.-B.; Jung, J.-K.; Kim, Y.H.; Kim, K.H.; et al. Obovatol attenuates LPS-induced memory impairments in mice via inhibition of NF-κB signaling pathway. Neurochem. Int. 2012, 60, 68–77. [Google Scholar] [CrossRef] [PubMed]
- Lee, J.W.; Lee, Y.K.; Yuk, D.Y.; Choi, D.Y.; Han, S.-B.; Oh, K.W.; Hong, J.T. Neuro-inflammation induced by lipopolysaccharide causes cognitive impairment through enhancement of beta-amyloid generation. J. Neuroinflamm. 2008, 5, 37. [Google Scholar] [CrossRef] [PubMed]
- Dunn, A.J.; Swiergiel, A.H. Effects of interleukin-1 and endotoxin in the forced swim and tail suspension tests in mice. Pharmacol. Biochem. Behav. 2005, 81, 688–693. [Google Scholar] [CrossRef] [PubMed]
- Kurita, M.; Nishino, S.; Kato, M.; Numata, Y.; Sato, T. Plasma brain-derived neurotrophic factor levels predict the clinical outcome of depression treatment in a naturalistic study. PLoS ONE 2012, 7, e39212. [Google Scholar] [CrossRef] [PubMed]
- Fang, K.; Li, H.-R.; Chen, X.-X.; Gao, X.-R.; Huang, L.-L.; Du, A.-Q.; Jiang, C.; Ge, J.-F.; Ke, F.; Li, H. Quercetin alleviates LPS-induced depression-like behavior in rats via regulating BDNF-related imbalance of Copine 6 and TREM1/2 in the hippocampus and PFC. Front. Pharmacol. 2020, 10, 1544. [Google Scholar] [CrossRef] [PubMed]
- Jin, Y.; Sun, L.H.; Yang, W.; Cui, R.J.; Xu, S.B. The Role of BDNF in the neuroimmune axis regulation of mood disorders. Front. Neurol. 2019, 10, 515. [Google Scholar] [CrossRef]
- Brunet, A.; Datta, S.R.; Greenberg, M.E. Transcription-dependent and -independent control of neuronal survival by the PI3K–Akt signaling pathway. Curr. Opin. Neurobiol. 2001, 11, 297–305. [Google Scholar] [CrossRef]
- Kitagishi, Y.; Kobayashi, M.; Kikuta, K.; Matsuda, S. Roles of PI3K/AKT/GSK3/mTOR pathway in cell signaling of mental illnesses. Depress. Res. Treat. 2012, 2012, 1–8. [Google Scholar] [CrossRef]
- Deng, Z.; Yuan, C.; Yang, J.; Peng, Y.; Wang, W.; Wang, Y.; Gao, W. Behavioral defects induced by chronic social defeat stress are protected by Momordica charantia polysaccharides via attenuation of JNK3/PI3K/AKT neuroinflammatory pathway. Ann. Transl. Med. 2019, 7, 6. [Google Scholar] [CrossRef]
- Leibrock, C.; Ackermann, T.F.; Hierlmeier, M.; Lang, F.; Borgwardt, S.; Lang, U.E. Akt2 deficiency is associated with anxiety and depressive behavior in mice. Cell. Physiol. Biochem. 2013, 32, 766–777. [Google Scholar] [CrossRef] [PubMed]
- Weiwei, T.; Dong, Y.; Su, Q.; Wang, H.; Chen, Y.; Xue, W.; Chen, C.; Xia, B.; Duan, J.-A.; Chen, G. Liquiritigenin reverses depression-like behavior in unpredictable chronic mild stress-induced mice by regulating PI3K/Akt/mTOR mediated BDNF/TrkB pathway. Behav. Brain Res. 2016, 308, 177–186. [Google Scholar] [CrossRef]
- Ham, J.R.; Lee, H.-I.; Choi, R.-Y.; Sim, M.-O.; Seo, K.-I.; Lee, M.-K. Anti-steatotic and anti-inflammatory roles of syringic acid in high-fat diet-induced obese mice. Food Funct. 2016, 7, 689–697. [Google Scholar] [CrossRef] [PubMed]
- Fang, W.; Zhu, S.; Niu, Z.; Yin, Y. The protective effect of syringic acid on dextran sulfate sodium-induced experimental colitis in BALB/c mice. Drug Dev. Res. 2019, 80, 731–740. [Google Scholar] [CrossRef] [PubMed]
- Zhao, Y.; Dang, M.; Zhang, W.; Lei, Y.; Ramesh, T.; Veeraraghavan, V.P.; Hou, X. Neuroprotective effects of Syringic acid against aluminium chloride induced oxidative stress mediated neuroinflammation in rat model of Alzheimer’s disease. J. Funct. Foods 2020, 71, 104009. [Google Scholar] [CrossRef]
- Rekha, K.R.; Selvakumar, G.P.; Sivakamasundari, R.I. Effects of syringic acid on chronic MPTP/probenecid induced motor dysfunction, dopaminergic markers expression and neuroinflammation in C57BL/6 mice. Biomed. Aging Pathol. 2014, 4, 95–104. [Google Scholar] [CrossRef]
- Dalmagro, A.P.; Camargo, A.; Rodrigues, A.L.S.; Zeni, A.L.B. Involvement of PI3K/Akt/GSK-3β signaling pathway in the antidepressant-like and neuroprotective effects of Morus nigra and its major phenolic, syringic acid. Chem. Interact. 2019, 314, 108843. [Google Scholar] [CrossRef]
- Dalmagro, A.P.; Camargo, A.; Pedron, N.B.; Garcia, S.A.; Zeni, A.L.B. Morus nigra leaves extract revokes the depressive-like behavior, oxidative stress, and hippocampal damage induced by corticosterone: A pivotal role of the phenolic syringic acid. Behav. Pharmacol. 2020, 31, 397–406. [Google Scholar] [CrossRef]








| Species | Gene | Primer Sequence (5′-3′) | |
|---|---|---|---|
| Forward | Reverse | ||
| Mouse | TNF-α | CAGGCGGTGCCTATGTCTC | CGATCACCCCGAAGTTCAGTAG |
| IL-1β | TTCAGGCAGGCAGTATCACTC | GAAGGTCCACGGGAAAGACAC | |
| IL-6 | ACTCACCTCTTCAGAACGAATTG | CCATCTTTGGAAGGTTCAGGTTG | |
| MCP-1 | CAGCCAGATGCAATCAATGCC | TGGAATCCTGAACCCACTTCT | |
| IL-10 | GCTCTTACTGACTGGCATGAG | CGCAGCTCTAGGAGCATGTG | |
| β-actin | TCCGGCACTACCGAGTTATC | GATCCGGTGTAGCAGATCGC | |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Lim, D.W.; Park, J.; Han, D.; Lee, J.; Kim, Y.T.; Lee, C. Anti-Inflammatory Effects of Asian Fawn Lily (Erythronium japonicum) Extract on Lipopolysaccharide-Induced Depressive-Like Behavior in Mice. Nutrients 2020, 12, 3809. https://doi.org/10.3390/nu12123809
Lim DW, Park J, Han D, Lee J, Kim YT, Lee C. Anti-Inflammatory Effects of Asian Fawn Lily (Erythronium japonicum) Extract on Lipopolysaccharide-Induced Depressive-Like Behavior in Mice. Nutrients. 2020; 12(12):3809. https://doi.org/10.3390/nu12123809
Chicago/Turabian StyleLim, Dong Wook, Joon Park, Daeseok Han, Jaekwang Lee, Yun Tai Kim, and Changho Lee. 2020. "Anti-Inflammatory Effects of Asian Fawn Lily (Erythronium japonicum) Extract on Lipopolysaccharide-Induced Depressive-Like Behavior in Mice" Nutrients 12, no. 12: 3809. https://doi.org/10.3390/nu12123809
APA StyleLim, D. W., Park, J., Han, D., Lee, J., Kim, Y. T., & Lee, C. (2020). Anti-Inflammatory Effects of Asian Fawn Lily (Erythronium japonicum) Extract on Lipopolysaccharide-Induced Depressive-Like Behavior in Mice. Nutrients, 12(12), 3809. https://doi.org/10.3390/nu12123809

