Next Article in Journal
Low Serum 25-Hydroxyvitamin D Levels Are Related to Frailty and Sarcopenia in Patients with Chronic Liver Disease
Previous Article in Journal
The “Fortilat” Randomized Clinical Trial Follow-Up: Neurodevelopmental Outcome at 18 Months of Age
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Anti-Inflammatory Effects of Asian Fawn Lily (Erythronium japonicum) Extract on Lipopolysaccharide-Induced Depressive-Like Behavior in Mice

1
Research Division of Food Functionality, Korea Food Research Institute, Wanju 55365, Korea
2
Division of Food Biotechnology, University of Science & Technology, Daejeon 34113, Korea
*
Authors to whom correspondence should be addressed.
These authors contributed equally to this work.
Nutrients 2020, 12(12), 3809; https://doi.org/10.3390/nu12123809
Submission received: 2 November 2020 / Revised: 9 December 2020 / Accepted: 10 December 2020 / Published: 11 December 2020
(This article belongs to the Section Phytochemicals and Human Health)

Abstract

Neuroinflammation is associated with an increased risk of depression. Lipopolysaccharide (LPS) treatment is known to induce pro-inflammatory cytokine secretion and a depressive-like phenotype in mice. Although Erythronium japonicum exhibits various health benefits, the role of E. japonicum extract (EJE) in inflammation-associated depression is unknown. This study aimed to explore the anti-inflammatory effect of EJE on LPS-induced depressive symptoms in mice using the open field test (OFT), passive avoidance test (PAT), tail suspension test (TST), and forced swim test (FST). LPS-treated mice had significantly increased immobility time in the TST and FST, decreased step-through latency time in the PAT, and decreased locomotor activity in the OFT. However, administration of 100 and 300 mg/kg of EJE significantly improved these depressive-like behaviors. EJE also prevented the increase in mRNA levels of tumor necrosis factor-α (TNF-α), interleukin-1β (IL-1β), IL-6, and monocyte chemoattractant protein-1 (MCP-1), and the decrease in IL-10 levels by inhibiting nuclear factor-κB (NF-κB) subunit p65 phosphorylation. Additionally, LPS-treated mice showed markedly decreased brain-derived neurotrophic factor (BDNF) levels and phosphorylation of phosphoinositide 3-kinase (PI3K) and Akt, while EJE treatment significantly increased these levels in the hippocampus. These results suggest that EJE ameliorated LPS-induced depressive-like behavior by reducing LPS-induced neuroinflammation and activating the BDNF-PI3K/Akt pathway.

Graphical Abstract

1. Introduction

Depression is one of the most significant mental disorders worldwide. It is estimated that more than 350 million people have depression worldwide [1], and that depression will be the most important cause of disability by 2020 [2]. Although the pathogenesis of depression remains unclear, numerous studies have reported the importance of neuroinflammation in the development of depression [3,4]. Continuous inflammation with elevated levels of pro-inflammatory cytokines can cause depressive symptoms [5]. Pro-inflammatory cytokines including interleukin-6 (IL-6) and tumor necrosis factor-α (TNF-α) levels have been found to be higher in major depressive patients [6], whereas the antioxidant capacity was lower [7]. It was reported that the cyclooxygenase-2 (COX-2) inhibitor celecoxib may be an effective adjuvant agent in the management of patients with major depression [8]. Celecoxib or ibuprofen as non-steroidal anti-inflammatory drugs (NSAIDs) may have an antidepressant effect through inhibition of inflammatory mediators such as prostaglandin E2 (PGE2) and nitric oxide (NO) in in vivo models [9,10]. Furthermore, antidepressants such as fluoxetine have anti-inflammatory properties [11,12].
As currently available antidepressants are not completely effective and have numerous undesirable side effects [13], alternative therapies including traditional herbal extracts such as St. John’s Wort or dietary supplements have been continuously used as agents to control depression [14,15]. Erythronium japonicum is a plant widely distributed in Eastern Asia. The aerial part of this herb is an edible wild vegetable that is traditionally used as a folk medicine in Korea. Previous studies have reported that E. japonicum crude extract has free radical scavenging [16], antioxidant [17], and anti-asthma [18] activities. Recently, our research group reported that E. japonicum extract can ameliorate inflammatory pain by suppressing pro-inflammatory cytokines in Complete Freund’s Adjuvant (CFA)-induced paw edema in mice [19]. These reports indicate that E. japonicum extract has potential anti-inflammatory properties. However, the anti-inflammatory effects of E. japonicum extract on depressive-like behavior in mice is still not well defined.
This aim of the study was to determine the anti-inflammatory effects of E. japonicum extract (EJE) in a depressive mouse model induced by repeated lipopolysaccharide (LPS) injection [20]. Depressive-like behaviors were evaluated using the open field test (OFT), passive avoidance test (PAT), tail suspension test (TST), and forced swim test (FST). Moreover, LPS-induced neuroinflammatory response was assessed by real-time reverse transcription polymerase chain reaction (RT-PCR) and western blot analysis.

2. Materials and Methods

2.1. Sample Preparation

E. japonicum was extracted as previously described [19]. The dried aerial parts of E. japonicum were purchased from Seorak Saradeul (Inje, Korea). The powdered sample (500 g) was extracted in water (10 times, v/v) using a reflux apparatus at 70 °C for 6 h. The yield of the dried extract was approximately 24.1%. The dissolved extract (50% methanol) was filtered and injected into a high-performance liquid chromatography (HPLC) system (Jasco, Hachioji, Tokyo, Japan). HPLC chromatograms were analyzed with a Waters Symmetry C18 5-μm column (4.6 × 250 mm, at 30 °C) by gradient elution, with a mobile phase composed of water, 0.2% (v/v) formic acid (A), and MeOH solution (B). The gradient was reduced by 100% (A) from 0 to 15 min, 85% (A) from 15 to 20 min, 80% (A) from 20 to 35 min, 60% (A) from 35 to 45 min, 50% (A) from 45 to 50 min, and restored by 100% (A) from 50 to 60 min. The concentration of syringic acid as a standard compound was 7.6 ± 0.62 mg/g (Figure 1).

2.2. Animals

Four 7-week-old male ICR mice (20–25 g, Koatech Animal Inc., Pyeongtaek, Korea) were housed four mice per cage. Mice were provided with ad libitum access to food and water under a controlled temperature (21 ± 2 °C) with a 24 h (12 h:12 h) light–dark cycle: lights on at 07:00 and lights off at 19:00 The mice were acclimated for a minimum of one week prior to beginning the study. All animal experiments were approved by the Institutional Animal Care and Use Committee (IACUC) of the Korea Food Research Institute (KFRI-M-20015).

2.3. Experimental Design and Sample Administration

E. japonicum extract (EJE) and imipramine were dissolved in distilled water. To determine the relevant dose of EJE in the current study, we selected the dose for administration according to our previous reports [19,21,22]. EJE was treated by oral administration, while the sham and control groups were orally administered with an equal volume of distilled water. The mice were allocated to five groups of ten mice each as follows: (1) sham group (Sham), (2) control group (Con), (3) imipramine 30 mg/kg, (IMI) (4) EJE 100 mg/kg (low dosage of EJE (EJL)), and (5) EJE 300 mg/kg (high dosage of EJE (EJH)) treated group. The depressive-like behavior model was induced by repeated injection of LPS from Escherichia coli (055: B5, purified by phenol extraction, Sigma Aldrich, St. Louis, MO, USA), and LPS was dissolved in 0.9% (w/v) saline. LPS (0.5 mg/kg) was intraperitoneally injected to the control and EJE-treated groups, while the sham group received an equal volume of saline. To determine relevant dose of EJE in the current study, we selected the doses for in vivo according to previous our report [19]. The LPS dosage was selected based on previous reports [20,23]. After seven days of sample treatment, the mice underwent behavior experiments starting 90 min after sample treatment, as shown in the experimental scheme (Figure 2). Mice were anesthetized with 2% isoflurane, and were sacrificed for hippocampus collection. The underlying mechanism was further detected by western blot analysis. Behavioral testing was conducted between 09:00 and 14:00.

2.4. Open Field Test (OFT)

The OFT was performed according to the protocol previously described [24]. Briefly, mice were tested in an open field and their movements were measured. Specifically, the duration of time spent in the zone center and periphery as well as the total movement were recorded for 5 min. The mice locomotor-related activity was analyzed by SMART v3.0 software (Panlab SL, Barcelona, Spain).

2.5. Passive Avoidance Test (PAT)

The PAT was conducted as previously described for depression-related cognitive function [22]. The mice were tested in the GEMINI avoidance system (SD instruments, San Diego, CA, USA). In the training trial, the mice were placed in the safe section, and the door between the two sections (safe and dark sections) were opened. When the mice were allowed to enter the dark section, the door closed automatically, and the mice received an inescapable electrical foot shock (0.5 mA for 3 s). The next day, the mice were placed in the safe section again, and the step-through latency time to enter the dark section was measured.

2.6. Tail Suspension Test (TST)

To verify whether EJE had antidepressant-like effects, TST was performed as previously described [21]. Briefly, mice were hung by their tails using adhesive tape and attached to a hook. Immobility time was evaluated in the 4 min using an automated device (BioSeb, Chaville, France).

2.7. Forced Swim Test (FST)

The FST was conducted 24 h after TST, as previously described [25]. Briefly, mice were placed in a clear cylinder (height; 13 cm, diameter; 24 cm) with water (depth; 10 cm, 22–24 °C) for 6 min. The immobility and activity times were analyzed during the last 4 min by SMART v3.0 software (Panlab SL, Barcelona, Spain).

2.8. Western Blotting

To study the underlying effect of EJE on antidepressants, western blot was performed according to a previous study [19]. The membrane was incubated with each specific antibody (phosphor-PI3K; 4228; CST, PI3K; 4255; CST, phosphor-Akt; 9271; CST, Akt; 9272; CST, BDNF; ab108319; Abcam, phospho-p65; 3033; CST, p65; 8242; CST, and β-actin; sc-47778; Santa Cruz) overnight at 4 °C. After washing three times with TBS-T, the membrane was incubated with each secondary antibody (Mouse; A90-116P, Rabbit; A120-101P, BETHYL) in a 5% skim milk solution for 1 h at room temperature. Proteins were detected using ECL Western Blotting Substrate (32106, Thermo Scientific, Rockford, IL, USA).

2.9. Quantitative Reverse Transcription Polymerase Chain Reaction (RT-qPCR)

To investigate whether EJE regulated cytokine expression in hippocampus, we conducted RT-qPCR, as previously described [19]. The cytokines were detected with each primer (Table 1). Thermal cycling was carried out in a QuantStudio™ Flex Real-Time PCR system (Applied Biosystems) according to the manufacturer’s protocol. Gene expression levels were normalized to the expression levels of the β-actin housekeeping gene. Relative changes in gene expression, calculated using the 2-∆∆CT method, are reported as number-fold changes compared to those in the sham group.

2.10. Statistical Analysis

Data are presented as mean ± standard error of the mean (SEM) and analyzed using one-way analysis of variance (ANOVA), followed by Dunnett’s test for post-hoc comparisons using Prism 8 (GraphPad Software v8.0, Inc., San Diego, CA, USA). Statistical significance was considered at a p-value less than 0.05.

3. Results

3.1. Effect of EJE on the OFT

First, we examined the effect of EJE on LPS-induced abnormal behaviors in the OFT. As shown in Figure 3, LPS-injected mice exhibited depressive or anxiety-like behaviors, with a decreased total distance and time in the center zone, and increased time in the periphery zone when compared with the sham mice (Figure 3A). As expected, IMI-treated mice showed significant improvements in these LPS-induced depressive-like behaviors. EJE treatment induced significant behavioral alternations with LPS treatment, with a significant increase in the total distance (Figure 3B) (total distance (cm); Sham, 162.6 ± 11.57; Control (Con), 69.8 ± 19.19; IMI, 132.3 ± 8.58; EJL, 127.4 ± 6.52; EJH, 135.7 ± 4.89; p-values; F (DFn, DFd) = 1.778 (4, 20); Sham vs Con (p < 0.0001); Con vs IMI (p = 0.0033), EJL (p = 0.0067), and EJH (p = 0.0021)), and improved time in the open field center (time in the center (%); Sham, 16.3 ± 1.80; Con, 7.3 ± 1.22; IMI, 14.0 ± 3.33; EJL, 18.5 ± 2.55; EJH, 20.0 ± 1.90; p-values; F (DFn, DFd) = 0.3338 (4, 20); Sham vs Con (p = 0.0160); Con vs IMI (p = 0.0157), EJL (p = 0.0026), and EJH (p = 0.0007)) (Figure 3C) and periphery areas (time in the periphery (%); Sham, 83.7 ± 1.80; Con, 92.7 ± 1.22; IMI, 86.0 ± 3.33; EJL, 81.5 ± 2.55; EJH, 80.0 ± 1.95; p-values; F (DFn, DFd) = 0.3729 (4, 20); Sham vs Con (p = 0.0145); Con vs. IMI (p = 0.0143), EJL (p = 0.0025), and EJH (p = 0.0017)) (Figure 3D).

3.2. Effect on EJE on PAT

To investigate the effect of EJE on LPS-induced cognitive dysfunction, one of the depressive symptoms, we performed a PAT. As expected, IMI treatment in mice recovered the LPS-induced decrease in step-through latency time. EJE treatment also significantly ameliorated the LPS-induced memory loss, indicating that EJE could alleviate depressive-like behaviors including memory deficiency in LPS-treated mice (step-through latency time (s); Sham, 240.5 ± 34.24; Con, 57.34 ± 15.98; IMI, 165.1 ± 28.21; EJL, 151.3 ± 20.11; EJH, 151.7 ± 21.17; p-values; F (DFn, DFd) = 0.4679 (4, 35); Sham vs Con (p < 0.0001); Con vs IMI (p = 0.045), EJL (p = 0.0378), and EJH (p = 0.0369)) (Figure 4).

3.3. Effect of EJE on the TST

Immobility on the TST or FST is representative of a depressive-like phenotype. LPS-injected mice showed significantly increased immobility and decreased activity compared with the sham mice, while IMI treatment in mice significantly improved these depressive-like symptoms. The increased immobility caused by LPS treatment was significantly reduced by treatment with EJE (immobility time (s); Sham, 46.08 ± 13.37; Con, 144.6 ± 13.96; IMI, 71.31 ± 13.73; EJL, 91.69 ± 7.82; EJH, 85.30 ± 15.76; p-values; F (DFn, DFd) = 0.7969 (4, 35); Sham vs Con (p < 0.0001); Con vs IMI (p = 0.0015), EJL (p = 0.0497), and EJH (p = 0.0083)) (Figure 5A). An increase in activity was also observed in the EJE-treated group (activity time (s); Sham, 194.0 ± 13.37; Con, 95.40 ± 13.96; IMI, 168.7 ± 13.73; EJL, 154.7 ± 15.76; EJH, 148 ± 7.82; p-values; F (DFn, DFd) = 0.1681 (4, 35); Sham vs Con (p < 0.0001); Con vs IMI (p = 0.0054), EJL (p = 0.0225), and EJH (p = 0.0027)) (Figure 5B).

3.4. Effect of EJE on the FST

As shown in Figure 6, the FST results showed a similar trend to the previous TST results. The increased immobility associated with LPS was significantly reduced by the treatment with EJE (immobility time (s); Sham, 132.1 ± 15.0; Con, 212.4 ± 3.70; IMI, 149.3 ± 6.63; EJL, 150.2 ± 9.96; EJH, 138.5 ± 7.91; p-values; F (DFn, DFd) = 0.8466 (4, 35); Sham vs Con (p = 0.0006); Con vs IMI (p = 0.0098), EJL (p = 0.0051), and EJH (p = 0.0025)) (Figure 6A). The increasing of swimming was also observed in EJE treated group (swimming time (s); Sham, 108.0 ± 15.0; Con, 27.62 ± 3.71; IMI, 90.73 ± 6.63; EJL, 89.86 ± 9.96; EJH, 101.6 ± 7.91; p-values; F (DFn, DFd) = 1.516 (4, 35); Sham vs Con (p = 0.0003); Con vs IMI (p = 0.0010), EJL (p = 0.0005), and EJH (p = 0.0002)) (Figure 6B).

3.5. Effect of EJE on Cytokines

Clinical and preclinical studies revealed that inflammatory cytokines were increased, while anti-inflammatory cytokines were decreased in the hippocampus of depressed patients and animals [26]. Inflammatory cytokines include TNF-α, IL-1β, IL-6, and MCP-1, and anti-inflammatory cytokines include IL-10. Recovery of these cytokines in the hippocampus might attenuate depressive symptoms. The results showed that administration of EJE significantly reduced LPS-induced mRNA levels of inflammatory cytokines (TNF-α; Sham, 1.00 ± 0.02; Con, 1.38 ± 0.11; EJH, 0.96 ± 0.03; F (DFn, DFd) = 1.397 (2, 9);/IL-1β; Sham, 1.00 ± 0.01; Con, 5.23 ± 0.3; EJH, 0.96 ± 0.02; F (DFn, DFd) = 15.62 (2, 9)/IL-6; Sham, 1.00 ± 0.02; Con, 1.82 ± 0.08; EJH, 0.91 ± 0.02; F (DFn, DFd) = 13.66 (2, 9)/MCP1; Sham, 1.00 ± 0.04; Con, 12.1 ± 0.43; EJH, 0.89 ± 0.07; F (DFn, DFd) = 5.538 (2, 9); p-values, Con vs. other groups (p < 0.0001)) (Figure 7A) and ameliorated the LPS-induced decrease in IL-10 mRNA levels (IL-10; Sham, 1.00 ± 0.06; Con, 0.64 ± 0.04; EJH, 0.97 ± 0.04; F (DFn, DFd) = 0.1473 (2, 9); p-values, Con vs other groups (p < 0.0001)) (Figure 7B) in the mouse hippocampus. NF-κB is strongly involved in regulating the expression of cytokines. To investigate the inhibitory effects on LPS-induced phosphorylation of p65, the end protein of NF-κB signaling, we performed western blotting. The results revealed that LPS-induced phosphorylation of p65 was inhibited by the administration of EJE in the hippocampus (phosphorylation of p65; Sham, 1.00 ± 0.09; Con, 1.95 ± 0.1; EJH, 1.26 ± 0.06; F (DFn, DFd) = 0.8673 (2, 6); p-values, Con vs other groups (p < 0.0001)) (Figure 7C).

3.6. Effect of EJE on the BDNF-PI3K/Akt Signaling Pathway

To further investigate the potential mechanism of EJE in LPS-induced depression., the BDNF-PI3K/Akt pathway in the hippocampus of LPS-treated mice was confirmed by western blotting. As shown in Figure 8, EJE treatment significantly ameliorated the LPS-induced decrease in BDNF-PI3K/Akt signaling in the (phosphorylation of PI3K; Sham, 1.00 ± 0.06; Con, 0.61 ± 0.02; EJH, 0.77 ± 0.06; F (DFn, DFd) = 0.3150 (2, 6); p-values; Sham vs. Con (p = 0.0002); Con vs. EJH (p = 0.0151)/phosphorylation of AKT; Sham, 1.00 ± 0.06; Con, 0.36 ± 0.01; EJH, 0.56 ± 0.01; F (DFn, DFd) = 1.132 (2, 6); p-values values; Sham vs. Con (p < 0.0001); Con vs. EJH (p = 0.0011)/BDNF; Sham, 1.00 ± 0.02; Con, 0.8 ± 0.02; EJH, 1.15 ± 0.05; F (DFn, DFd) = 1.007 (2, 6); p-values values; Sham vs. Con (p = 0.0006); Con vs. EJH (p < 0.0001)) (Figure 8).

4. Discussion

To the best of our knowledge, this is the first study to demonstrate that the anti-inflammatory effect of EJE significantly improves LPS-induced depressive-like behavior by activating the BDNF-PI3K/Akt pathway in the hippocampus of mice.
It is well known that macrophage-induced inflammation plays an important role in the pathophysiology of depression [27]. Activated microglia initiate an inflammatory cascade whereby the release of relevant cytokines and excessive exposure to cytokines directly affect neurons, causing cell death and decreased production of neurotransmitters or neurotrophic factors [28]. Several studies have reported increased levels of inflammatory cytokines and other mediators in patients with depression [29]. A growing body of research indicates that cytokines contribute to the development of depression [30]. Cytokines, primarily produced by glial cells, play an important role in the brain such as in development, protection, and synaptic remodeling. Cytokine expression is regulated to maintain homeostasis in the brain. However, if the microenvironment in the CNS is altered by infection, toxic stimuli, inflammation, and tissue injury, expression of pro-inflammatory cytokines increases and anti-inflammatory cytokines decreases, leading to depression [31,32]. TNF-α, IL-1β, IL-6, and MCP1 are well-known pro-inflammatory cytokines, whereas IL-10 is the most widely investigated anti-inflammatory cytokine. Previous in vivo studies have reported that inhibition of pro-inflammatory cytokines alleviated depressive symptoms [33,34,35]. Furthermore, depressive-like behaviors were attenuated by the administration of IL-10 in mice [36]. These data demonstrate that the regulation of cytokine expression can attenuate depressive symptoms. The regulation of cytokine expression is strongly involved in the NF-κB signaling pathway. In the NF-κB signaling pathway, p65 is finally phosphorylated, and the phosphorylated p65 then translocates to the nucleus to initiate transcription. The NF-κB signaling pathway is known to be associated with the pathogenesis of inflammatory diseases such as rheumatism, inflammatory bowel disease, atherosclerosis, diabetes, and pain [37,38,39]. Hence, inhibition of the NF-κB signaling pathway might be a good target to treat inflammation-related diseases such as depression. NF-κB signaling plays a critical role in the development of depression, and inhibiting NF-κB signaling can prevent depression [40,41]. In addition, many previous studies have reported that the increase in pro-inflammatory cytokines and the decrease in anti-inflammatory cytokines were attenuated by inhibition of NF-κB signaling in the hippocampus [42,43,44]. In our results, administration of EJE significantly improved LPS-induced depressive-like behavioral symptoms. Cognitive impairment or anxiety- and depression-like behaviors have been reported to occur after LPS injection [45,46,47]. It has been well known that systemic inflammatory events can induce neuroinflammation in the central nervous system [48]. Jain et al. [49] reported that systemically administered LPS increased immobility in the FST in mice. The increase in immobility in the TST or FST is reported to involve the depression behavior and can be reversed by antidepressant agents [50]. Moreover, the LPS-injected mice exhibited decreased total distance and time spent in the center area and a significant increase in total immobility time, indicating that LPS induces a number of behavioral alterations such as decreased locomotor activity [51]. The LPS-mediated cognitive dysfunction was also observed in the PAT [52]. Lee et al. [53] showed that systemic inflammation by treatment with LPS caused elevation of amyloidogenesis and neuronal cell death, which finally resulted in memory impairment. As expected, in the present study, we observed a significant reduction in locomotor and cognitive activities and increased immobility in LPS-injected mice during the OFT, PAT, TST, and FST compared to the results for the sham mice. These results are in accordance with those described in a previous report [54]. Meanwhile, EJE treatment prevented the LPS-induced depressive-like behavior in the behavioral tests. EJE also prevented the increase in mRNA levels of TNF-α, IL-1β, IL-6, and MCP-1, and the decrease in IL-10 by the inhibition of NF-κB subunit p65 phosphorylation. Therefore, our findings indicate that the LPS-induced changes in cytokines are attenuated by EJE-induced NF-κB inhibition, leading to alleviation of depression.
BDNF, a protein synthesized in the brain, has a neuroprotective function. A decreased level of BDNF in the brain, particularly the hippocampus, is a well-known symptom of depression, clinically and pre-clinically [55,56]. This is especially involved in PI3K/Akt signaling [57]. PI3K/Akt signaling is also activated by BDNF and could regulate neuronal survival and anti-apoptotic biological functions of glial cells [58]. It has been reported that PI3K/Akt signaling regulation is an important factor in the onset of depression [59]. Under depressive conditions, it was found that BDNF-PI3K/Akt signaling activity is notably reduced. Previous research has implicated that phosphorylation of PI3K/Akt signaling was reduced in the hippocampus of depressed mice [60]. In addition, depressive behavior was significantly increased in Akt-knockout mice than in wild-type mice [61]. Chen et al. [62] reported that chronic stress-induced depressive-like behaviors were inhibited by the activation of BDNF-PI3K/Akt signaling. The activation of BDNF-PI3K/Akt signaling is suggested to be therapeutically effective for depression. In our results, LPS-treated mice showed markedly decreased BDNF levels and phosphorylation of PI3K and Akt, while EJE treatment significantly increased these levels in the hippocampus. Thus, EJE attenuated depression symptoms by activating BDNF-PI3K/Akt signaling.
We found that syringic acid was contained as major components in EJE by HPLC. A growing body of evidence has shown that syringic acid had anti-inflammatory effects in various inflammation-related diseases such as obesity [63] and colitis [64]. These studies revealed that syringic acid had an anti-inflammatory effect via decreasing NF-κB activation. Indeed, brain disorders were remarkably attenuated by reducing neuroinflammation with the treatment of syringic acid in animal studies [65,66]. Oral administration of Morus nigra extracts, known to contain syringic acid as major components, and syringic acid significantly alleviated depressive-like behaviors in mice via regulated PI3K/Akt signaling in hippocampus [67,68]. Therefore, it might be that syringic acid is an active compound that plays a major role in EJE’s antidepressant effect. However, further studies are necessary to investigate the antidepressant-like effect of syringic acid on a LPS-induced depressive behavior model.

5. Conclusions

In conclusion, our findings strongly indicate that EJE ameliorated LPS-induced depressive-like behavior by activating the BDNF-PI3K/Akt pathway in the hippocampus, and this effect may be mediated by preventing LPS-induced neuroinflammation through the inhibition of NF-κB subunit p65 phosphorylation. Thus, EJE could potentially improve depressive symptoms including the inflammatory-mediated response.

Author Contributions

C.L. and Y.T.K. designed the study; D.W.L. and J.P. performed cell and animal experiments; D.W.L., J.P. and J.L. analyzed the data; D.W.L. and J.P. wrote the manuscript; D.H. and J.L. contributed expert opinions to manuscript correction. All authors reviewed the manuscript and approved the final version. All authors have read and agreed to the published version of the manuscript.

Funding

This research was supported by the Main Research Program (E0164501-05 and E0164502-05) of the Korea Food Research Institute (KFRI) funded by the Korean Ministry of Science and ICT.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Simple questionnaire screens for common psychiatric disorders. This new tool helps identify anxiety disorders, depression and other mental health conditions. Duke Med. Health News 2010, 16, 7.
  2. Murray, C.J.; Lopez, A.D. Alternative projections of mortality and disability by cause 1990–2020: Global burden of disease study. Lancet 1997, 349, 1498–1504. [Google Scholar] [CrossRef]
  3. Czarny, P.; Wigner, P.; Galecki, P.; Sliwinski, T. The interplay between inflammation, oxidative stress, DNA damage, DNA repair and mitochondrial dysfunction in depression. Prog. Neuropsychopharmacol. Biol. Psychiatry 2018, 80, 309–321. [Google Scholar] [CrossRef]
  4. Pariante, C.M. Why are depressed patients inflamed? A reflection on 20 years of research on depression, glucocorticoid resistance and inflammation. Eur. Neuropsychopharmacol. 2017, 27, 554–559. [Google Scholar] [CrossRef] [PubMed]
  5. Dantzer, R.; O’Connor, J.C.; Lawson, M.A.; Kelley, K.W. Inflammation-associated depression: From serotonin to kynurenine. Psychoneuroendocrinology 2011, 36, 426–436. [Google Scholar] [CrossRef] [PubMed]
  6. Yoshimura, R.; Hori, H.; Ikenouchi-Sugita, A.; Umene-Nakano, W.; Ueda, N.; Nakamura, J. Higher plasma interleukin-6 (IL-6) level is associated with SSRI- or SNRI-refractory depression. Prog. Neuropsychopharmacol. Biol. Psychiatry 2009, 33, 722–726. [Google Scholar] [CrossRef] [PubMed]
  7. Jiménez-Fernández, S.; Gurpegui, M.; Díaz-Atienza, F.; Pérez-Costillas, L.; Gerstenberg, M.; Correll, C.U. Oxidative stress and antioxidant parameters in patients with major depressive disorder compared to healthy controls before and after antidepressant treatment. J. Clin. Psychiatry 2015, 76, 1658–1667. [Google Scholar] [CrossRef] [PubMed]
  8. Akhondzadeh, S.; Jafari, S.; Raisi, F.; Nasehi, A.A.; Ghoreishi, A.; Salehi, B.; Mohebbi-Rasa, S.; Raznahan, M.; Kamalipour, A. Clinical trial of adjunctive celecoxib treatment in patients with major depression: A double blind and placebo controlled trial. Depress. Anxiety 2009, 26, 607–611. [Google Scholar] [CrossRef]
  9. Saleh, L.A.; Hamza, M.; El Gayar, N.H.; El-Samad, A.A.A.; Nasr, E.A.; Masoud, S.I. Ibuprofen suppresses depressive like behavior induced by BCG inoculation in mice: Role of nitric oxide and prostaglandin. Pharmacol. Biochem. Behav. 2014, 125, 29–39. [Google Scholar] [CrossRef]
  10. Myint, A.M.; Steinbusch, H.W.; Goeghegan, L.; Luchtman, D.; Kim, Y.K.; Leonard, B.E. Effect of the COX-2 inhibitor celecoxib on behavioural and immune changes in an olfactory bulbectomised rat model of depression. Neuroimmunomodulation 2007, 14, 65–71. [Google Scholar] [CrossRef]
  11. Liu, D.; Wang, Z.; Liu, S.; Wang, F.; Zhao, S.; Hao, A. Anti-inflammatory effects of fluoxetine in lipopolysaccharide(LPS)-stimulated microglial cells. Neuropharmacology 2011, 61, 592–599. [Google Scholar] [CrossRef] [PubMed]
  12. Roumestan, C.; Michel, A.; Bichon, F.; Portet, K.; Detoc, M.; Henriquet, C.; Jaffuel, D.; Mathieu, M. Anti-inflammatory properties of desipramine and fluoxetine. Respir. Res. 2007, 8, 35. [Google Scholar] [CrossRef] [PubMed]
  13. Sidor, M.M.; MacQueen, G.M. Antidepressants for the acute treatment of bipolar depression. J. Clin. Psychiatry 2010, 72, 156–167. [Google Scholar] [CrossRef] [PubMed]
  14. Dome, P.; Tombor, L.; Lazary, J.; Gonda, X.; Rihmer, Z. Natural health products, dietary minerals and over-the-counter medications as add-on therapies to antidepressants in the treatment of major depressive disorder: A review. Brain Res. Bull. 2019, 146, 51–78. [Google Scholar] [CrossRef] [PubMed]
  15. Pirotta, M.; Willis, K.; Carter, M.; Forsdike, K.; Newton, D.; Gunn, J.; Forsdike-Young, K. ‘Less like a drug than a drug’: The use of St. John’s wort among people who self-identify as having depression and/or anxiety symptoms. Complement. Ther. Med. 2014, 22, 870–876. [Google Scholar] [CrossRef] [PubMed]
  16. Heo, B.-G.; Park, Y.-S.; Chon, S.-U.; Lee, S.-Y.; Cho, J.-Y.; Gorinstein, S. Antioxidant activity and cytotoxicity of methanol extracts from aerial parts of Korean salad plants. BioFactors 2007, 30, 79–89. [Google Scholar] [CrossRef]
  17. Bae, C.-S.; Yun, C.-H.; Ahn, T. Extracts from Erythronium japonicum and Corylopsis coreana Uyeki reduce 1,3-dichloro-2-propanol-mediated oxidative stress in human hepatic cells. Food Sci. Biotechnol. 2018, 28, 175–180. [Google Scholar] [CrossRef]
  18. Seo, J.-H.; Bang, M.-A.; Kim, G.; Cho, S.S.; Park, D.-H. Erythronium japonicum attenuates histopathological lung abnormalities in a mouse model of ovalbumin-induced asthma. Int. J. Mol. Med. 2016, 37, 1221–1228. [Google Scholar] [CrossRef][Green Version]
  19. Park, J.; Kim, Y.T. Erythronium japonicum alleviates inflammatory pain by inhibiting MAPK activation and by suppressing NF-κB activation via ERK/Nrf2/HO-1 signaling pathway. Antioxidants 2020, 9, 626. [Google Scholar] [CrossRef]
  20. Zhu, L.; Wei, T.; Gao, J.; Chang, X.; He, H.; Miao, M.; Yan, T. Salidroside attenuates lipopolysaccharide (LPS) induced serum cytokines and depressive-like behavior in mice. Neurosci. Lett. 2015, 606, 1–6. [Google Scholar] [CrossRef]
  21. Lim, D.W.; Han, T.; Jung, J.; Song, Y.; Um, M.Y.; Yoon, M.; Kim, Y.T.; Cho, S.; Kim, I.-H.; Han, D.; et al. Chlorogenic acid from Hawthorn berry (Crataegus pinnatifida fruit) prevents stress hormone-induced depressive behavior, through monoamine oxidase B-reactive oxygen species signaling in hippocampal astrocytes of mice. Mol. Nutr. Food Res. 2018, 62, e1800029. [Google Scholar] [CrossRef] [PubMed]
  22. Lim, D.W.; Han, T.; Um, M.Y.; Yoon, M.; Kim, T.-E.; Kim, Y.T.; Han, D.; Lee, J.; Lee, C.H. Administration of Asian herb bennet (Geum japonicum) extract reverses depressive-like behaviors in mouse model of depression induced by corticosterone. Nutrients 2019, 11, 2841. [Google Scholar] [CrossRef] [PubMed]
  23. Sousa Rodrigues, F.T.; de Souza, M.R.M.; de Carvalho Lima, C.N.; da Silva, F.E.R.; da Silca Costa, D.V.; Costa Dos Santos, C.; Miyajima, F.; de Sousa, F.C.F.; Mendes Vasconcelos, S.M.; Barichello, T.; et al. Major depression model induced by repeated and intermittent lipopolysaccharide administration: Long-lasting behavioral, neuroimmune and neuroprogressive alterations. J. Psychiatr. Res. 2018, 107, 57–67. [Google Scholar] [CrossRef] [PubMed]
  24. Akihisa, T.; Kawashima, K.; Orido, M.; Akazawa, H.; Matsumoto, M.; Yamamoto, A.; Ogihara, E.; Fukatsu, M.; Tokuda, H.; Fuji, J. Antioxidative and melanogenesis-inhibitory activities of caffeoylquinic acids and other compounds from moxa. Chem. Biodivers. 2013, 10, 313–327. [Google Scholar] [CrossRef] [PubMed]
  25. Petit-Demouliere, B.; Chenu, F.; Bourin, M. Forced swimming test in mice: A review of antidepressant activity. Psychopharmacology 2005, 177, 245–255. [Google Scholar] [CrossRef] [PubMed]
  26. Jeon, S.W.; Kim, Y.K. Neuroinflammation and cytokine abnormality in major depression: Cause or consequence in that illness? World J. Psychiatry 2016, 6, 283–293. [Google Scholar] [CrossRef]
  27. Montini, M.; Levoni, P.; Ongaro, A.; Pagani, G. Controlled application of cynarin in the treatment of hyperlipemic syndrome. Observations in 60 cases. Arzneimittelforschung 1975, 25, 1311–1314. [Google Scholar]
  28. Miller, A.H.; Maletic, V.; Raison, C.L. Inflammation and its discontents: The role of cytokines in the pathophysiology of major depression. Biol. Psychiatry 2009, 65, 732–741. [Google Scholar] [CrossRef]
  29. Hannestad, J.; DellaGioia, N.; Bloch, M.H. The effect of antidepressant medication treatment on serum levels of inflammatory cytokines: A meta-analysis. Neuropsychopharmacology 2011, 36, 2452–2459. [Google Scholar] [CrossRef]
  30. Yong-Ku, K.; Na, K.-S.; Myint, A.-M.; Leonard, B.E. The role of pro-inflammatory cytokines in neuroinflammation, neurogenesis and the neuroendocrine system in major depression. Prog. Neuropsychopharmacol. Biol. Psychiatry 2016, 64, 277–284. [Google Scholar] [CrossRef]
  31. Felger, J.C.; Lotrich, F.E. Inflammatory cytokines in depression: Neurobiological mechanisms and therapeutic implications. Neuroscience 2013, 246, 199–229. [Google Scholar] [CrossRef] [PubMed]
  32. He, Y.; Li, W.; Wang, Y.; Tian, Y.; Chen, X.; Wu, Z.; Lan, T.; Li, Y.; Bai, M.; Liu, J.; et al. Major depression accompanied with inflammation and multiple cytokines alterations: Evidences from clinical patients to macaca fascicularis and LPS-induced depressive mice model. J. Affect. Disord. 2020, 271, 262–271. [Google Scholar] [CrossRef] [PubMed]
  33. Li, M.; Li, C.; Yu, H.; Cai, X.; Shen, X.; Sun, X.; Wang, J.; Zhang, Y.; Wang, C. Lentivirus-mediated interleukin-1β (IL-1β) knock-down in the hippocampus alleviates lipopolysaccharide (LPS)-induced memory deficits and anxiety- and depression-like behaviors in mice. J. Neuroinflamm. 2017, 14, 1–12. [Google Scholar] [CrossRef] [PubMed]
  34. Yamada, K.; Iida, R.; Miyamoto, Y.; Saito, K.; Sekikawa, K.; Seishima, M.; Nabeshima, T. Neurobehavioral alterations in mice with a targeted deletion of the tumor necrosis factor-α gene: Implications for emotional behavior. J. Neuroimmunol. 2000, 111, 131–138. [Google Scholar] [CrossRef]
  35. Chourbaji, S.; Urani, A.; Inta, I.; Sanchis-Segura, C.; Brandwein, C.; Zink, M.; Schwaninger, M.; Gass, P. IL-6 knockout mice exhibit resistance to stress-induced development of depression-like behaviors. Neurobiol. Dis. 2006, 23, 587–594. [Google Scholar] [CrossRef]
  36. Worthen, R.J.; Zighelboim, S.S.G.; Jaramillo, C.S.T.; Beurel, E. Anti-inflammatory IL-10 administration rescues depression-associated learning and memory deficits in mice. J. Neuroinflamm. 2020, 17, 1–16. [Google Scholar] [CrossRef]
  37. Okamoto, T. NF-kappaB and rheumatic diseases. Endocr. Metab. Immune Disord. Drug Targets 2006, 6, 359–372. [Google Scholar] [CrossRef]
  38. Atreya, I.; Atreya, R.; Neurath, M.F. NF-κB in inflammatory bowel disease. J. Intern. Med. 2008, 263, 591–596. [Google Scholar] [CrossRef]
  39. Liu, T.; Zhang, L.; Joo, D.; Sun, S.-C. NF-κB signaling in inflammation. Signal. Transduct. Target. Ther. 2017, 2, 17023. [Google Scholar] [CrossRef]
  40. Koo, J.W.; Russo, S.J.; Ferguson, D.; Nestler, E.J.; Duman, R.S. Nuclear factor-κB is a critical mediator of stress-impaired neurogenesis and depressive behavior. Proc. Natl. Acad. Sci. USA 2010, 107, 2669–2674. [Google Scholar] [CrossRef]
  41. Wang, Y.; Xu, J.; Liu, Y.; Li, Z.; Li, X.-H. TLR4-NF-κB signal involved in depressive-like behaviors and cytokine expression of frontal cortex and hippocampus in stressed C57BL/6 and ob/ob mice. Neural Plast. 2018, 2018, 1–12. [Google Scholar] [CrossRef] [PubMed]
  42. Song, M.-T.; Ruan, J.; Zhang, R.-Y.; Deng, J.; Ma, Z.; Ma, S. Astragaloside IV ameliorates neuroinflammation-induced depressive-like behaviors in mice via the PPARγ/NF-κB/NLRP3 inflammasome axis. Acta Pharmacol. Sin. 2018, 39, 1559–1570. [Google Scholar] [CrossRef] [PubMed]
  43. Wang, Q.; Dong, X.; Li, N.; Wang, Y.; Guan, X.; Lin, Y.; Kang, J.; Zhang, X.; Zhang, Y.; Li, X.; et al. JSH-23 prevents depressive-like behaviors in mice subjected to chronic mild stress: Effects on inflammation and antioxidant defense in the hippocampus. Pharmacol. Biochem. Behav. 2018, 169, 59–66. [Google Scholar] [CrossRef] [PubMed]
  44. Li, K.; Yan, L.; Zhang, Y.; Yang, Z.; Zhang, C.; Li, Y.; Kalueff, A.V.; Li, W.; Song, C. Seahorse treatment improves depression-like behavior in mice exposed to CUMS through reducing inflammation/oxidants and restoring neurotransmitter and neurotrophin function. J. Ethnopharmacol. 2020, 250, 112487. [Google Scholar] [CrossRef]
  45. Depino, A.M. Early prenatal exposure to LPS results in anxiety- and depression-related behaviors in adulthood. Neuroscience 2015, 299, 56–65. [Google Scholar] [CrossRef]
  46. André, C.; Dinel, A.-L.; Ferreira, G.; Layé, S.; Castanon, N. Diet-induced obesity progressively alters cognition, anxiety-like behavior and lipopolysaccharide-induced depressive-like behavior: Focus on brain indoleamine 2,3-dioxygenase activation. Brain Behav. Immun. 2014, 41, 10–21. [Google Scholar] [CrossRef]
  47. Zhao, J.; Bi, W.; Xiao, S.; Lan, X.; Cheng, X.; Zhang, J.; Lu, D.; Wei, W.; Wang, Y.; Li, H.; et al. Neuroinflammation induced by lipopolysaccharide causes cognitive impairment in mice. Sci. Rep. 2019, 9, 5790. [Google Scholar] [CrossRef]
  48. Jaeger, L.B.; Dohgu, S.; Sultana, R.; Lynch, J.L.; Owen, J.B.; Erickson, M.A.; Shah, G.N.; Price, T.O.; Fleegal-Demotta, M.A.; Butterfiled, D.A.; et al. Lipopolysaccharide alters the blood–brain barrier transport of amyloid β protein: A mechanism for inflammation in the progression of Alzheimer’s disease. Brain Behav. Immun. 2009, 23, 507–517. [Google Scholar] [CrossRef]
  49. Jain, N.; Kulkarni, S.; Singh, A. Lipopolysaccharide-mediated immobility in mice: Reversal by cyclooxygenase enzyme inhibitors. Methods Find. Exp. Clin. Pharmacol. 2001, 23, 441–444. [Google Scholar] [CrossRef]
  50. Renard, C.E.; Dailly, E.; David, D.J.; Hascoet, M.; Bourin, M. Monoamine metabolism changes following the mouse forced swimming test but not the tail suspension test. Fundam. Clin. Pharmacol. 2003, 17, 449–455. [Google Scholar] [CrossRef]
  51. Engeland, C.G.; Nielsen, D.V.; Kavaliers, M.; Ossenkopp, K. Locomotor activity changes following lipopolysaccharide treatment in mice: A multivariate assessment of behavioral tolerance. Physiol. Behav. 2001, 72, 481–491. [Google Scholar] [CrossRef]
  52. Choi, D.-Y.; Lee, J.W.; Lin, G.; Lee, Y.K.; Lee, Y.H.; Choi, I.S.; Han, S.-B.; Jung, J.-K.; Kim, Y.H.; Kim, K.H.; et al. Obovatol attenuates LPS-induced memory impairments in mice via inhibition of NF-κB signaling pathway. Neurochem. Int. 2012, 60, 68–77. [Google Scholar] [CrossRef] [PubMed]
  53. Lee, J.W.; Lee, Y.K.; Yuk, D.Y.; Choi, D.Y.; Han, S.-B.; Oh, K.W.; Hong, J.T. Neuro-inflammation induced by lipopolysaccharide causes cognitive impairment through enhancement of beta-amyloid generation. J. Neuroinflamm. 2008, 5, 37. [Google Scholar] [CrossRef] [PubMed]
  54. Dunn, A.J.; Swiergiel, A.H. Effects of interleukin-1 and endotoxin in the forced swim and tail suspension tests in mice. Pharmacol. Biochem. Behav. 2005, 81, 688–693. [Google Scholar] [CrossRef] [PubMed]
  55. Kurita, M.; Nishino, S.; Kato, M.; Numata, Y.; Sato, T. Plasma brain-derived neurotrophic factor levels predict the clinical outcome of depression treatment in a naturalistic study. PLoS ONE 2012, 7, e39212. [Google Scholar] [CrossRef] [PubMed]
  56. Fang, K.; Li, H.-R.; Chen, X.-X.; Gao, X.-R.; Huang, L.-L.; Du, A.-Q.; Jiang, C.; Ge, J.-F.; Ke, F.; Li, H. Quercetin alleviates LPS-induced depression-like behavior in rats via regulating BDNF-related imbalance of Copine 6 and TREM1/2 in the hippocampus and PFC. Front. Pharmacol. 2020, 10, 1544. [Google Scholar] [CrossRef] [PubMed]
  57. Jin, Y.; Sun, L.H.; Yang, W.; Cui, R.J.; Xu, S.B. The Role of BDNF in the neuroimmune axis regulation of mood disorders. Front. Neurol. 2019, 10, 515. [Google Scholar] [CrossRef]
  58. Brunet, A.; Datta, S.R.; Greenberg, M.E. Transcription-dependent and -independent control of neuronal survival by the PI3K–Akt signaling pathway. Curr. Opin. Neurobiol. 2001, 11, 297–305. [Google Scholar] [CrossRef]
  59. Kitagishi, Y.; Kobayashi, M.; Kikuta, K.; Matsuda, S. Roles of PI3K/AKT/GSK3/mTOR pathway in cell signaling of mental illnesses. Depress. Res. Treat. 2012, 2012, 1–8. [Google Scholar] [CrossRef]
  60. Deng, Z.; Yuan, C.; Yang, J.; Peng, Y.; Wang, W.; Wang, Y.; Gao, W. Behavioral defects induced by chronic social defeat stress are protected by Momordica charantia polysaccharides via attenuation of JNK3/PI3K/AKT neuroinflammatory pathway. Ann. Transl. Med. 2019, 7, 6. [Google Scholar] [CrossRef]
  61. Leibrock, C.; Ackermann, T.F.; Hierlmeier, M.; Lang, F.; Borgwardt, S.; Lang, U.E. Akt2 deficiency is associated with anxiety and depressive behavior in mice. Cell. Physiol. Biochem. 2013, 32, 766–777. [Google Scholar] [CrossRef] [PubMed]
  62. Weiwei, T.; Dong, Y.; Su, Q.; Wang, H.; Chen, Y.; Xue, W.; Chen, C.; Xia, B.; Duan, J.-A.; Chen, G. Liquiritigenin reverses depression-like behavior in unpredictable chronic mild stress-induced mice by regulating PI3K/Akt/mTOR mediated BDNF/TrkB pathway. Behav. Brain Res. 2016, 308, 177–186. [Google Scholar] [CrossRef]
  63. Ham, J.R.; Lee, H.-I.; Choi, R.-Y.; Sim, M.-O.; Seo, K.-I.; Lee, M.-K. Anti-steatotic and anti-inflammatory roles of syringic acid in high-fat diet-induced obese mice. Food Funct. 2016, 7, 689–697. [Google Scholar] [CrossRef] [PubMed]
  64. Fang, W.; Zhu, S.; Niu, Z.; Yin, Y. The protective effect of syringic acid on dextran sulfate sodium-induced experimental colitis in BALB/c mice. Drug Dev. Res. 2019, 80, 731–740. [Google Scholar] [CrossRef] [PubMed]
  65. Zhao, Y.; Dang, M.; Zhang, W.; Lei, Y.; Ramesh, T.; Veeraraghavan, V.P.; Hou, X. Neuroprotective effects of Syringic acid against aluminium chloride induced oxidative stress mediated neuroinflammation in rat model of Alzheimer’s disease. J. Funct. Foods 2020, 71, 104009. [Google Scholar] [CrossRef]
  66. Rekha, K.R.; Selvakumar, G.P.; Sivakamasundari, R.I. Effects of syringic acid on chronic MPTP/probenecid induced motor dysfunction, dopaminergic markers expression and neuroinflammation in C57BL/6 mice. Biomed. Aging Pathol. 2014, 4, 95–104. [Google Scholar] [CrossRef]
  67. Dalmagro, A.P.; Camargo, A.; Rodrigues, A.L.S.; Zeni, A.L.B. Involvement of PI3K/Akt/GSK-3β signaling pathway in the antidepressant-like and neuroprotective effects of Morus nigra and its major phenolic, syringic acid. Chem. Interact. 2019, 314, 108843. [Google Scholar] [CrossRef]
  68. Dalmagro, A.P.; Camargo, A.; Pedron, N.B.; Garcia, S.A.; Zeni, A.L.B. Morus nigra leaves extract revokes the depressive-like behavior, oxidative stress, and hippocampal damage induced by corticosterone: A pivotal role of the phenolic syringic acid. Behav. Pharmacol. 2020, 31, 397–406. [Google Scholar] [CrossRef]
Figure 1. High-performance liquid chromatography (HPLC) chromatogram for standardization of the E. japonicum extract (EJE). The concentration of syringic acid as a standard compound was 7.6 ± 0.62 mg/g. AU, area unit.
Figure 1. High-performance liquid chromatography (HPLC) chromatogram for standardization of the E. japonicum extract (EJE). The concentration of syringic acid as a standard compound was 7.6 ± 0.62 mg/g. AU, area unit.
Nutrients 12 03809 g001
Figure 2. Experimental design to evaluate the effect of EJE on LPS-induced depressive mice. (A) After seven days of sample treatments, the mice underwent the depression-related behavioral tests. (B) Mice were pretreated with the samples 30 min prior to LPS injection, then, OFT, PAT, TST, and FST tests were determined 60 min after LPS injection. After the last FST session, mice were sacrificed for western blot analysis. EJE, E. japonicum extract; LPS, lipopolysaccharide; OFT, open field test; PAT, passive avoidance test; TST, tail suspension test; FST, forced swim test; i.p., intraperitoneal; p.o., per oral.
Figure 2. Experimental design to evaluate the effect of EJE on LPS-induced depressive mice. (A) After seven days of sample treatments, the mice underwent the depression-related behavioral tests. (B) Mice were pretreated with the samples 30 min prior to LPS injection, then, OFT, PAT, TST, and FST tests were determined 60 min after LPS injection. After the last FST session, mice were sacrificed for western blot analysis. EJE, E. japonicum extract; LPS, lipopolysaccharide; OFT, open field test; PAT, passive avoidance test; TST, tail suspension test; FST, forced swim test; i.p., intraperitoneal; p.o., per oral.
Nutrients 12 03809 g002
Figure 3. Effect of EJE on locomotor activity in LPS-induced depressive mice. The tracing of the locomotion patterns for 5 min (A), LPS-injected mice exhibited depressive-like behaviors, while EJ extract led to markedly improved activity; total distance (cm) (B), time in zone center (%) (C), and time in zone periphery (%) (D). Results are presented as mean ± standard error of the mean (SEM). EJE, E. japonicum extract; LPS, lipopolysaccharide; Con, control; EJL, low dosage of EJE; EJH, high dosage of EJE; IMI, imipramine 30 mg/kg; EJL, EJE 100 mg/kg; EJH, EJE 300 mg/kg. *** p < 0.001, ** p < 0.01, * p < 0.05 versus the LPS-injected Con; ### p < 0.001, # p < 0.05, versus the Sham.
Figure 3. Effect of EJE on locomotor activity in LPS-induced depressive mice. The tracing of the locomotion patterns for 5 min (A), LPS-injected mice exhibited depressive-like behaviors, while EJ extract led to markedly improved activity; total distance (cm) (B), time in zone center (%) (C), and time in zone periphery (%) (D). Results are presented as mean ± standard error of the mean (SEM). EJE, E. japonicum extract; LPS, lipopolysaccharide; Con, control; EJL, low dosage of EJE; EJH, high dosage of EJE; IMI, imipramine 30 mg/kg; EJL, EJE 100 mg/kg; EJH, EJE 300 mg/kg. *** p < 0.001, ** p < 0.01, * p < 0.05 versus the LPS-injected Con; ### p < 0.001, # p < 0.05, versus the Sham.
Nutrients 12 03809 g003
Figure 4. Effect of EJE on memory in LPS-induced depressive mice. EJ extract significantly improved LPS-induced memory loss in mice, indicated through an increased step through latency time (s). Results are presented as mean ± SEM. EJE, E. japonicum extract; LPS, lipopolysaccharide; Con, control; IMI, imipramine 30 mg/kg; EJL, EJE 100 mg/kg; EJH, EJE 300 mg/kg. * p < 0.05 versus the LPS-injected Con; ### p < 0.001 versus the Sham.
Figure 4. Effect of EJE on memory in LPS-induced depressive mice. EJ extract significantly improved LPS-induced memory loss in mice, indicated through an increased step through latency time (s). Results are presented as mean ± SEM. EJE, E. japonicum extract; LPS, lipopolysaccharide; Con, control; IMI, imipramine 30 mg/kg; EJL, EJE 100 mg/kg; EJH, EJE 300 mg/kg. * p < 0.05 versus the LPS-injected Con; ### p < 0.001 versus the Sham.
Nutrients 12 03809 g004
Figure 5. Effect of EJE on the tail suspension test in LPS-induced depressive mice. LPS-injected mice had significantly increased immobility and decreased activity, while EJ extract treated-mice showed significant improvements, with a reduced immobility time (s) (A) and increased activity time (s) (B). Results are presented as mean ± SEM. TST, tail suspension test; EJE, E. japonicum extract; LPS, lipopolysaccharide; Con, control; IMI, imipramine 30 mg/kg; EJL, EJE 100 mg/kg; EJH, EJE 300 mg/kg., ** p < 0.01, * p < 0.05 versus the LPS-injected Con; ### p < 0.001 versus the Sham.
Figure 5. Effect of EJE on the tail suspension test in LPS-induced depressive mice. LPS-injected mice had significantly increased immobility and decreased activity, while EJ extract treated-mice showed significant improvements, with a reduced immobility time (s) (A) and increased activity time (s) (B). Results are presented as mean ± SEM. TST, tail suspension test; EJE, E. japonicum extract; LPS, lipopolysaccharide; Con, control; IMI, imipramine 30 mg/kg; EJL, EJE 100 mg/kg; EJH, EJE 300 mg/kg., ** p < 0.01, * p < 0.05 versus the LPS-injected Con; ### p < 0.001 versus the Sham.
Nutrients 12 03809 g005
Figure 6. Effect of EJE on the forced swim test in LPS-induced depressive mice. LPS-injected mice showed significantly increased immobility and decreased swimming, while EJ extract-treated mice showed significant improvements, with a reduced immobility time (s) (A) and increased swimming time (s) (B). Results are presented as mean ± SEM. FST, forced swim test; EJE, E. japonicum extract; LPS, lipopolysaccharide; Con, control; IMI, imipramine 30 mg/kg; EJL, EJE 100 mg/kg; EJH, EJE 300 mg/kg. *** p < 0.001, ** p < 0.01, versus the LPS-injected Con; ### p < 0.001 versus the Sham.
Figure 6. Effect of EJE on the forced swim test in LPS-induced depressive mice. LPS-injected mice showed significantly increased immobility and decreased swimming, while EJ extract-treated mice showed significant improvements, with a reduced immobility time (s) (A) and increased swimming time (s) (B). Results are presented as mean ± SEM. FST, forced swim test; EJE, E. japonicum extract; LPS, lipopolysaccharide; Con, control; IMI, imipramine 30 mg/kg; EJL, EJE 100 mg/kg; EJH, EJE 300 mg/kg. *** p < 0.001, ** p < 0.01, versus the LPS-injected Con; ### p < 0.001 versus the Sham.
Nutrients 12 03809 g006
Figure 7. Effect of EJE on cytokines and p65 phosphorylation in the hippocampus of LPS-induced depressive mice. LPS-induced changes in cytokine mRNA expression in the hippocampus were significantly recovered by oral administration of EJH (A), (B) EJH significantly reduced phosphorylation of p65 in the hippocampus (C). Results are presented as mean ± SEM. EJE, E. japonicum extract; LPS, lipopolysaccharide; Con, control; EJH, EJE 300 mg/kg. *** p < 0.001 versus the LPS-injected Con; ### p < 0.001 versus the Sham. TNF-α, tumor necrosis factor-α; IL-1β, interleukin-1β; IL-6, interleukin-6; MCP-1, monocyte chemoattractant protein-1; IL-10, interleukin-10.
Figure 7. Effect of EJE on cytokines and p65 phosphorylation in the hippocampus of LPS-induced depressive mice. LPS-induced changes in cytokine mRNA expression in the hippocampus were significantly recovered by oral administration of EJH (A), (B) EJH significantly reduced phosphorylation of p65 in the hippocampus (C). Results are presented as mean ± SEM. EJE, E. japonicum extract; LPS, lipopolysaccharide; Con, control; EJH, EJE 300 mg/kg. *** p < 0.001 versus the LPS-injected Con; ### p < 0.001 versus the Sham. TNF-α, tumor necrosis factor-α; IL-1β, interleukin-1β; IL-6, interleukin-6; MCP-1, monocyte chemoattractant protein-1; IL-10, interleukin-10.
Nutrients 12 03809 g007
Figure 8. Effect of EJE on PI3K/AKT/BDNF signaling in the hippocampus of LPS-induced depressive mice. Although the PI3K/AKT/BDNF signaling was decreased by intraperitoneal injection of LPS, administration of EJH significantly increased PI3K/AKT/BDNF signaling in the hippocampus. Results are presented as mean ± SEM. EJE, E. japonicum extract; LPS, lipopolysaccharide; Con, control; EJH, EJE 300 mg/kg. *** p < 0.001, ** p < 0.01, and * p < 0.05 versus the LPS-injected Con; ### p < 0.001 versus the Sham.
Figure 8. Effect of EJE on PI3K/AKT/BDNF signaling in the hippocampus of LPS-induced depressive mice. Although the PI3K/AKT/BDNF signaling was decreased by intraperitoneal injection of LPS, administration of EJH significantly increased PI3K/AKT/BDNF signaling in the hippocampus. Results are presented as mean ± SEM. EJE, E. japonicum extract; LPS, lipopolysaccharide; Con, control; EJH, EJE 300 mg/kg. *** p < 0.001, ** p < 0.01, and * p < 0.05 versus the LPS-injected Con; ### p < 0.001 versus the Sham.
Nutrients 12 03809 g008
Table 1. Primer sequences for quantitative reverse transcription polymerase chain reaction (RT-qPCR).
Table 1. Primer sequences for quantitative reverse transcription polymerase chain reaction (RT-qPCR).
SpeciesGenePrimer Sequence (5′-3′)
ForwardReverse
MouseTNF-αCAGGCGGTGCCTATGTCTCCGATCACCCCGAAGTTCAGTAG
IL-1βTTCAGGCAGGCAGTATCACTCGAAGGTCCACGGGAAAGACAC
IL-6ACTCACCTCTTCAGAACGAATTGCCATCTTTGGAAGGTTCAGGTTG
MCP-1CAGCCAGATGCAATCAATGCCTGGAATCCTGAACCCACTTCT
IL-10GCTCTTACTGACTGGCATGAGCGCAGCTCTAGGAGCATGTG
β-actinTCCGGCACTACCGAGTTATCGATCCGGTGTAGCAGATCGC
TNF-α, tumor necrosis factor-α; IL-1β, interleukin-1β; IL-6, interleukin-6; MCP-1, monocyte chemoattractant protein-1; IL-10, interleukin-6.
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Share and Cite

MDPI and ACS Style

Lim, D.W.; Park, J.; Han, D.; Lee, J.; Kim, Y.T.; Lee, C. Anti-Inflammatory Effects of Asian Fawn Lily (Erythronium japonicum) Extract on Lipopolysaccharide-Induced Depressive-Like Behavior in Mice. Nutrients 2020, 12, 3809. https://doi.org/10.3390/nu12123809

AMA Style

Lim DW, Park J, Han D, Lee J, Kim YT, Lee C. Anti-Inflammatory Effects of Asian Fawn Lily (Erythronium japonicum) Extract on Lipopolysaccharide-Induced Depressive-Like Behavior in Mice. Nutrients. 2020; 12(12):3809. https://doi.org/10.3390/nu12123809

Chicago/Turabian Style

Lim, Dong Wook, Joon Park, Daeseok Han, Jaekwang Lee, Yun Tai Kim, and Changho Lee. 2020. "Anti-Inflammatory Effects of Asian Fawn Lily (Erythronium japonicum) Extract on Lipopolysaccharide-Induced Depressive-Like Behavior in Mice" Nutrients 12, no. 12: 3809. https://doi.org/10.3390/nu12123809

APA Style

Lim, D. W., Park, J., Han, D., Lee, J., Kim, Y. T., & Lee, C. (2020). Anti-Inflammatory Effects of Asian Fawn Lily (Erythronium japonicum) Extract on Lipopolysaccharide-Induced Depressive-Like Behavior in Mice. Nutrients, 12(12), 3809. https://doi.org/10.3390/nu12123809

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop