A Pilot Study on Anti-Obesity Mechanisms of Kappaphycus Alvarezii: The Role of Native κ-Carrageenan and the Leftover Sans-Carrageenan Fraction
Abstract
:1. Introduction
2. Materials and Methods
2.1. Sample Acquisition and Processing
2.2. Preparation of Study Diets
2.3. Animal Study
2.4. Oral Glucose Tolerance Test (OGTT)
2.5. Phenotype Measurements
2.6. Histology
2.7. Sera Biochemical Analyses
2.8. RNA Extraction
2.9. Real-Time qPCR (RT-qPCR)
2.10. ELISA
2.11. Fecal Short-Chain Fatty Acids (SCFAs)
2.12. Gut Microbiota Profiling
2.13. Statistical Analysis
3. Results
3.1. Carrageenan (CGN) and Sans-Carrageenan (SCGN) Normalized Animal Obese Phenotype More Than Whole Kappaphycus (T)
3.2. Dietary Treatments Improved Sera Biochemical Profile of Mice
3.3. Different Influences of CGN and SCGN on Gene Involved in Lipid Metabolism
3.4. CGN and SCGN Changed Fecal SCFA Compositions in Mice
3.5. CGN and SCGN Modulate Gut Microbiota with Links to Adipocytokines Levels
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Conflicts of Interest
References
- Obesity and Overweight. Available online: https://www.who.int/en/news-room/fact-sheets/detail/obesity-and-overweight (accessed on 24 October 2018).
- Lean, M.E.; Leslie, W.S.; Barnes, A.C.; Brosnahan, N.; Thom, G.; McCombie, L.; Peters, C.; Zhyzhneuskaya, S.; Al-Mrabeh, A.; Hollingsworth, K.G.; et al. Primary care-led weight management for remission of type 2 diabetes (DiRECT): An open-label, cluster-randomised trial. Lancet (London, England) 2018, 391, 541–551. [Google Scholar] [CrossRef]
- Lichtman, S.W.; Pisarska, K.; Berman, E.R.; Pestone, M.; Dowling, H.; Offenbacher, E.; Weisel, H.; Heshka, S.; Matthews, D.E.; Heymsfield, S.B. Discrepancy between self-reported and actual caloric intake and exercise in obese subjects. N. Engl. J. Med. 1992, 327, 1893–1898. [Google Scholar] [CrossRef]
- Polidori, D.; Sanghvi, A.; Seeley, R.J.; Hall, K.D. How strongly does appetite counter weight loss? quantification of the feedback control of human energy intake. Obesity 2016, 24, 2289–2295. [Google Scholar] [CrossRef]
- Chow, C.C.; Hall, K.D. Short and long-term energy intake patterns and their implications for human body weight regulation. Physiol. Behav. 2014, 134, 60–65. [Google Scholar] [CrossRef] [Green Version]
- Hall, K.D. Maintenance of lost weight and long-term management of obesity. Med. Clin. N. Am. 2018, 102, 183–197. [Google Scholar] [CrossRef]
- Suresh Kumar, K.; Ganesan, K.; Subba Rao, P.V. Seasonal variation in nutritional composition of Kappaphycus alvarezii (Doty) Doty—An edible seaweed. J. Food Sci. Technol. 2015, 52, 2751–2760. [Google Scholar] [CrossRef]
- Chithra, R.; Chandra, S. Qualitative and Quantitative Analysis Of Phytochemical Variation in G. corticata And K. alvarezii. Int. J. Sci. Res. Dev. 2013, 1, 2174–2176. [Google Scholar]
- Chu, W.-L.; Phang, S.-M. Marine algae as a potential source for anti-obesity agents. Mar. Drugs 2016, 14, 222. [Google Scholar]
- Wanyonyi, S.; Du Preez, R.; Brown, L.; Paul, N.A.; Panchal, S.K. Kappaphycus alvarezii as a food supplement prevents diet-induced metabolic syndrome in rats. Nutrients 2017, 9, 1261. [Google Scholar] [CrossRef]
- Manuhara, G.J.; Praseptiangga, D.; Riyanto, R.A. Extraction and Characterization of Refined K-carrageenan of Red Algae [Kappaphycus Alvarezii (Doty ex P.C. Silva, 1996)] Originated from Karimun Jawa Islands. Aquat. Procedia 2016, 7, 106–111. [Google Scholar] [CrossRef]
- Webber, V.; de Carvalho, S.M.; Ogliari, P.J.; Hayashi, L.; Barreto, P.L.M. Optimization of the extraction of carrageenan from Kappaphycus alvarezii using response surface methodology. Food Sci. Technol. 2012, 32, 812–818. [Google Scholar] [CrossRef] [Green Version]
- Tabarsa, M.; Han, J.H.; Kim, C.Y.; You, S.G. Molecular characteristics and immunomodulatory activities of water-soluble sulfated polysaccharides from ulva pertusa. J. Med. Food 2012. [Google Scholar] [CrossRef]
- Vinoth Kumar, T.; Lakshmanasenthil, S.; Geetharamani, D.; Marudhupandi, T.; Suja, G.; Suganya, P. Fucoidan—A α-d-glucosidase inhibitor from Sargassum wightii with relevance to type 2 diabetes mellitus therapy. Int. J. Biol. Macromol. 2015, 72, 1044–1047. [Google Scholar] [CrossRef]
- Sharifuddin, Y.; Chin, Y.-X.; Lim, P.-E.; Phang, S.-M. Potential bioactive compounds from seaweed for diabetes management. Mar. Drugs 2015, 13, 5447–5491. [Google Scholar] [CrossRef]
- Muanprasat, C.; Wongkrasant, P.; Satitsri, S.; Moonwiriyakit, A.; Pongkorpsakol, P.; Mattaveewong, T.; Pichyangkura, R.; Chatsudthipong, V. Activation of AMPK by chitosan oligosaccharide in intestinal epithelial cells: Mechanism of action and potential applications in intestinal disorders. Biochem. Pharmacol. 2015, 96, 225–236. [Google Scholar] [CrossRef] [PubMed]
- Hsieh, Y.-L.; Yao, H.-T.; Cheng, R.-S.; Chiang, M.-T. Chitosan reduces plasma adipocytokines and lipid accumulation in liver and adipose tissues and ameliorates insulin resistance in diabetic Rats. J. Med. Food 2012, 15, 453–460. [Google Scholar] [CrossRef] [PubMed]
- Muanprasat, C.; Chatsudthipong, V. Chitosan oligosaccharide: Biological activities and potential therapeutic applications. Pharmacol. Ther. 2017, 170, 80–97. [Google Scholar] [CrossRef] [PubMed]
- Yuan, H.; Song, J.; Zhang, W.; Li, X.; Li, N.; Gao, X. Antioxidant activity and cytoprotective effect of κ-carrageenan oligosaccharides and their different derivatives. Bioorg. Med. Chem. Lett. 2006, 16, 1329–1334. [Google Scholar] [CrossRef] [PubMed]
- Raman, M.; Doble, M. κ-Carrageenan from marine red algae, Kappaphycus alvarezii—A functional food to prevent colon carcinogenesis. J. Funct. Foods 2015, 15, 354–364. [Google Scholar] [CrossRef]
- Sun, Y.; Yang, B.; Wu, Y.; Liu, Y.; Gu, X.; Zhang, H.; Wang, C.; Cao, H.; Huang, L.; Wang, Z. Structural characterization and antioxidant activities of κ-carrageenan oligosaccharides degraded by different methods. Food Chem. 2015, 178, 311–318. [Google Scholar] [CrossRef]
- Suganya, A.M.; Sanjivkumar, M.; Chandran, M.N.; Palavesam, A.; Immanuel, G. Pharmacological importance of sulphated polysaccharide carrageenan from red seaweed Kappaphycus alvarezii in comparison with commercial carrageenan. Biomed. Pharmacother. 2016, 84, 1300–1312. [Google Scholar] [CrossRef]
- Joint FAO/WHO Expert Committee on Food Additives (JECFA). Evaluation of Certain Food Additives. Seventy-Ninth Report; World Health Organization: Geneva, Switzerland, 2014; pp. 14–23. [Google Scholar]
- Bhattacharyya, S.; Feferman, L.; Unterman, T.; Tobacman, J.K. Exposure to common food additive carrageenan alone leads to fasting hyperglycemia and in combination with high fat diet exacerbates glucose intolerance and hyperlipidemia without effect on weight. J. Diabetes Res. 2015, 2015, 1–13. [Google Scholar] [CrossRef] [PubMed]
- Weiner, M.L. Food additive carrageenan: Part II: A critical review of carrageenan in vivo safety studies. Crit. Rev. Toxicol. 2014, 44, 244–269. [Google Scholar] [CrossRef] [PubMed]
- Haslianti Utilization of Carrageenan. Waste Processing Kappaphycus alvarezii Dotty on Producing of Bioethanol; Bogor Agricultural University: Bogor, Indonesia, 2013. [Google Scholar]
- Ortiz-Tena, J.G.; Schieder, D.; Sieber, V. Carrageenan and More: Biorefinery Approaches with Special Reference to the Processing of Kappaphycus. In Tropical Seaweed Farming Trends, Problems and Opportunities; Springer International Publishing: Cham, Switzerland, 2017; pp. 155–164. [Google Scholar]
- Wang, C.-Y.; Liao, J.K. A mouse model of diet-induced obesity and insulin resistance. Methods Mol. Biol. 2012, 821, 421–433. [Google Scholar] [PubMed]
- Mouse Strain Datasheet—000664—C57BL/6J. Available online: https://www.jax.org/strain/000664 (accessed on 10 April 2019).
- Phang, S.-M.; Yeong, H.-Y.; Lim, P.-E.; Nor, A.-R.M.; Gan, K.-T. Commercial varieties of Kappaphycus and Eucheuma in Malaysia. Malays. J. Sci. 2010, 29, 214–224. [Google Scholar] [CrossRef]
- Farnier, C.; Krief, S.; Blache, M.; Diot-Dupuy, F.; Mory, G.; Ferre, P.; Bazin, R. Adipocyte functions are modulated by cell size change: Potential involvement of an integrin/ERK signalling pathway. Int. J. Obes. 2003, 27, 1178–1186. [Google Scholar] [CrossRef]
- Food-based Dietary Guidelines—United States. Available online: http://www.fao.org/nutrition/education/food-based-dietary-guidelines/regions/countries/united-states-of-america/en/ (accessed on 27 March 2019).
- Lang, T. Food control or food democracy? Re-engaging nutrition with society and the environment. Public Health Nutr. 2005, 8, 730–737. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Glanz, K.; Sallis, J.F.; Saelens, B.E.; Frank, L.D. Nutrition Environment Measures Survey in Stores (NEMS-S). Development and Evaluation. Am. J. Prev. Med. 2007, 32, 282–289. [Google Scholar] [CrossRef]
- Contento, I.R. Nutrition education: Linking research, theory, and practice. Asia Pac. J. Clin. Nutr. 2008, 17, 176–179. [Google Scholar]
- Zeevi, D.; Korem, T.; Zmora, N.; Israeli, D.; Rothschild, D.; Weinberger, A.; Ben-Yacov, O.; Lador, D.; Avnit-Sagi, T.; Lotan-Pompan, M.; et al. Personalized nutrition by prediction of glycemic responses. Cell 2015, 163, 1079–1094. [Google Scholar] [CrossRef]
- Septembre-Malaterre, A.; Remize, F.; Poucheret, P. Fruits and vegetables, as a source of nutritional compounds and phytochemicals: Changes in bioactive compounds during lactic fermentation. Food Res. Int. 2018. [Google Scholar] [CrossRef]
- Dewettinck, K.; Van Bockstaele, F.; Kühne, B.; Van de Walle, D.; Courtens, T.M.; Gellynck, X. Nutritional value of bread: Influence of processing, food interaction and consumer perception. J. Cereal Sci. 2008, 48, 243–257. [Google Scholar] [CrossRef]
- Henry, C.J.K.; Massey, D. Micro-nutrient changes during food processing and storage. In Proceedings of the Crop Post-Harvest Programme; Natural Resources International Ltd.: Ken, UK, 2001. [Google Scholar]
- Caleja, C.; Barros, L.; Antonio, A.L.; Carocho, M.; Oliveira, M.B.P.P.; Ferreira, I.C.F.R. Fortification of yogurts with different antioxidant preservatives: A comparative study between natural and synthetic additives. Food Chem. 2016, 210, 262–268. [Google Scholar] [CrossRef] [Green Version]
- FDA Overview of Food Ingredients, Additives & Colors. Available online: https://www.fda.gov/food/ingredientspackaginglabeling/foodadditivesingredients/ucm094211.htm (accessed on 27 March 2019).
- Lowe, C.E.; O’Rahilly, S.; Rochford, J.J. Adipogenesis at a glance. J. Cell Sci. 2011, 124, 2681–2686. [Google Scholar] [CrossRef] [Green Version]
- Nigro, E.; Scudiero, O.; Monaco, M.L.; Palmieri, A.; Mazzarella, G.; Costagliola, C.; Bianco, A.; Daniele, A. New insight into adiponectin role in obesity and obesity-related diseases. Biomed Res. Int. 2014, 2014, 658913. [Google Scholar] [CrossRef]
- McKenney, R.L.; Short, D.K. Tipping the balance: The pathophysiology of obesity and type 2 diabetes mellitus. Surg. Clin. N. Am. 2011, 91, 1139–1148. [Google Scholar] [CrossRef]
- Pan, H.; Guo, J.; Su, Z. Advances in understanding the interrelations between leptin resistance and obesity. Physiol. Behav. 2014, 130, 157–169. [Google Scholar] [CrossRef]
- Yamauchi, T.; Kadowaki, T. Adiponectin receptor as a key player in healthy longevity and obesity-related diseases. Cell Metab. 2013, 17, 185–196. [Google Scholar] [CrossRef]
- Awazawa, M.; Ueki, K.; Inabe, K.; Yamauchi, T.; Kaneko, K.; Okazaki, Y.; Bardeesy, N.; Ohnishi, S.; Nagai, R.; Kadowaki, T. Adiponectin suppresses hepatic SREBP1c expression in an AdipoR1/LKB1/AMPK dependent pathway. Biochem. Biophys. Res. Commun. 2009, 382, 51–56. [Google Scholar] [CrossRef]
- Akingbemi, B.T. Adiponectin Receptors in Energy Homeostasis and Obesity Pathogenesis. In Progress in Molecular Biology and Translational Science; Tao, Y.-X., Ed.; Academic Press: Oxford, UK, 2013; pp. 317–342. [Google Scholar]
- Nakamura, M.T.; Yudell, B.E.; Loor, J.J. Regulation of energy metabolism by long-chain fatty acids. Prog. Lipid Res. 2014, 53, 124–144. [Google Scholar] [CrossRef]
- Ríos-Covián, D.; Ruas-Madiedo, P.; Margolles, A.; Gueimonde, M.; de Los Reyes-Gavilán, C.G.; Salazar, N. Intestinal Short Chain Fatty Acids and their Link with Diet and Human Health. Front. Microbiol. 2016, 7, 185. [Google Scholar] [CrossRef] [Green Version]
- Gao, Z.; Yin, J.; Zhang, J.; Ward, R.E.; Martin, R.J.; Lefevre, M.; Cefalu, W.T.; Ye, J. Butyrate improves insulin sensitivity and increases energy expenditure in mice. Diabetes 2009, 58, 1509–1517. [Google Scholar] [CrossRef] [PubMed]
- Liu, H.; Wang, J.; He, T.; Becker, S.; Zhang, G.; Li, D.; Ma, X. Butyrate: A double-edged sword for health? Adv. Nutr. 2018, 9, 21–29. [Google Scholar] [CrossRef]
- Karlsson, F.; Tremaroli, V.; Nielsen, J.; Bäckhed, F. Assessing the Human Gut Microbiota in Metabolic Diseases. Diabetes 2013, 62, 3341–3349. [Google Scholar] [CrossRef] [Green Version]
- Murphy, E.F.; Cotter, P.D.; Hogan, A.; O’Sullivan, O.; Joyce, A.; Fouhy, F.; Clarke, S.F.; Marques, T.M.; O’Toole, P.W.; Stanton, C.; et al. Divergent metabolic outcomes arising from targeted manipulation of the gut microbiota in diet-induced obesity. Gut 2013, 62, 220–226. [Google Scholar] [CrossRef]
- Morrison, D.J.; Preston, T. Formation of short chain fatty acids by the gut microbiota and their impact on human metabolism. Gut Microbes 2016, 7, 189–200. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Carmody, R.N.; Gerber, G.K.; Luevano, J.M.; Gatti, D.M.; Somes, L.; Svenson, K.L.; Turnbaugh, P.J. Diet dominates host genotype in shaping the murine gut microbiota. Cell Host Microbe 2015, 17, 72–84. [Google Scholar] [CrossRef]
- Goodrich, J.K.; Davenport, E.R.; Beaumont, M.; Jackson, M.A.; Knight, R.; Ober, C.; Spector, T.D.; Bell, J.T.; Clark, A.G.; Ley, R.E. Genetic Determinants of the Gut Microbiome in UK Twins. Cell Host Microbe 2016, 19, 731–743. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Shang, Q.; Sun, W.; Shan, X.; Jiang, H.; Cai, C.; Hao, J.; Li, G.; Yu, G. Carrageenan-induced colitis is associated with decreased population of anti-inflammatory bacterium, Akkermansia muciniphila, in the gut microbiota of C57BL/6J mice. Toxicol. Lett. 2017, 279, 87–95. [Google Scholar] [CrossRef]
- Bervoets, L.; Van Hoorenbeeck, K.; Kortleven, I.; Van Noten, C.; Hens, N.; Vael, C.; Goossens, H.; Desager, K.N.; Vankerckhoven, V. Differences in gut microbiota composition between obese and lean children: A cross-sectional study. Gut Pathog. 2013, 5, 10. [Google Scholar] [CrossRef]
- Di Rienzi, S.C.; Sharon, I.; Wrighton, K.C.; Koren, O.; Hug, L.A.; Thomas, B.C.; Goodrich, J.K.; Bell, J.T.; Spector, T.D.; Banfield, J.F.; et al. The human gut and groundwater harbor non-photosynthetic bacteria belonging to a new candidate phylum sibling to Cyanobacteria. Elife 2013, 2, e01102. [Google Scholar] [CrossRef] [PubMed]
- Wei, X.; Tao, J.; Xiao, S.; Jiang, S.; Shang, E.; Zhu, Z.; Qian, D.; Duan, J. Xiexin Tang improves the symptom of type 2 diabetic rats by modulation of the gut microbiota. Sci. Rep. 2018, 8, 3685. [Google Scholar] [CrossRef]
- Shang, Q.; Song, G.; Zhang, M.; Shi, J.; Xu, C.; Hao, J.; Li, G.; Yu, G. Dietary fucoidan improves metabolic syndrome in association with increased Akkermansia population in the gut microbiota of high-fat diet-fed mice. J. Funct. Foods 2017, 28, 138–146. [Google Scholar] [CrossRef]
- Jangi, S.; Gandhi, R.; Cox, L.M.; Li, N.; von Glehn, F.; Yan, R.; Patel, B.; Mazzola, M.A.; Liu, S.; Glanz, B.L.; et al. Alterations of the human gut microbiome in multiple sclerosis. Nat. Commun. 2016, 7, 12015. [Google Scholar] [CrossRef] [PubMed]
- Yang, C.; Qu, Y.; Fujita, Y.; Ren, Q.; Ma, M.; Dong, C.; Hashimoto, K. Possible role of the gut microbiota–brain axis in the antidepressant effects of (R)-ketamine in a social defeat stress model. Transl. Psychiatry 2017, 7, 1294. [Google Scholar] [CrossRef]
- Kreutzer, C.; Peters, S.; Schulte, D.M.; Fangmann, D.; Türk, K.; Wolff, S.; van Eimeren, T.; Ahrens, M.; Beckmann, J.; Schafmayer, C.; et al. Hypothalamic Inflammation in Human Obesity Is Mediated by Environmental and Genetic Factors. Diabetes 2017, 66, 2407–2415. [Google Scholar] [CrossRef] [Green Version]
- Zhang, C.; Zhang, M.; Pang, X.; Zhao, Y.; Wang, L.; Zhao, L. Structural resilience of the gut microbiota in adult mice under high-fat dietary perturbations. ISME J. 2012. [Google Scholar] [CrossRef]
- Guo, W.-L.; Pan, Y.-Y.; Li, L.; Li, T.-T.; Liu, B.; Lv, X.-C. Ethanol extract of Ganoderma lucidum ameliorates lipid metabolic disorders and modulates the gut microbiota composition in high-fat diet fed rats. Food Funct. 2018, 9, 3419–3431. [Google Scholar] [CrossRef]
- Saulnier, D.M.; Riehle, K.; Mistretta, T.-A.; Diaz, M.-A.; Mandal, D.; Raza, S.; Weidler, E.M.; Qin, X.; Coarfa, C.; Milosavljevic, A.; et al. Gastrointestinal microbiome signatures of pediatric patients with irritable bowel syndrome. Gastroenterology 2011, 141, 1782–1791. [Google Scholar] [CrossRef] [PubMed]
- Kaakoush, N.O. Insights into the Role of Erysipelotrichaceae in the Human Host. Front. Cell. Infect. Microbiol. 2015, 5, 84. [Google Scholar] [CrossRef] [Green Version]
- Kameyama, K.; Itoh, K. Intestinal Colonization by a Lachnospiraceae Bacterium Contributes to the Development of Diabetes in Obese Mice. Microbes Environ. 2014, 29, 427–430. [Google Scholar] [CrossRef] [Green Version]
- Faust, K.; Sathirapongsasuti, J.F.; Izard, J.; Segata, N.; Gevers, D.; Raes, J.; Huttenhower, C. Microbial co-occurrence relationships in the human microbiome. PLoS Comput. Biol. 2012, 8, e1002606. [Google Scholar] [CrossRef]
- Mordor Intelligence Carrageenan Market—Trends and Forecasts (2019—2024). Available online: https://www.mordorintelligence.com/industry-reports/global-carrageenan-market-industry (accessed on 27 January 2019).
- Tobacman, J.K.; Bhattacharyya, S.; Borthakur, A.; Dudeja, P.K. The Carrageenan Diet: Not Recommended. Science 2008, 321, 1040d–1041d. [Google Scholar] [CrossRef]
- Weiner, M.L.; Nuber, D.; Blakemore, W.R.; Harriman, J.F.; Cohen, S.M. A 90-day dietary study on kappa carrageenan with emphasis on the gastrointestinal tract. Food Chem. Toxicol. 2007, 45, 98–106. [Google Scholar] [CrossRef]
- McKim, J.M. Food additive carrageenan: Part I: A critical review of carrageenan in vitro studies, potential pitfalls, and implications for human health and safety. Crit. Rev. Toxicol. 2014, 44, 211–243. [Google Scholar] [CrossRef] [PubMed]
- McKim, J.M.; Baas, H.; Rice, G.P.; Willoughby, J.A.; Weiner, M.L.; Blakemore, W. Effects of carrageenan on cell permeability, cytotoxicity, and cytokine gene expression in human intestinal and hepatic cell lines. Food Chem. Toxicol. 2016, 96, 1–10. [Google Scholar] [CrossRef]
- Weiner, M.L. Parameters and pitfalls to consider in the conduct of food additive research, Carrageenan as a case study. Food Chem. Toxicol. 2016, 87, 31–44. [Google Scholar] [CrossRef]
- Weiner, M.L.; McKim, J.M.; Blakemore, W.R. Addendum to Weiner, M.L. (2016) Parameters and Pitfalls to Consider in the Conduct of Food Additive Research, Carrageenan as a Case Study. Food Chemical Toxicology 87, 31-44. Food Chem. Toxicol. 2017, 107, 208–214. [Google Scholar] [CrossRef]
Group | Diet Composition |
---|---|
Normal (N) | 10% LFD |
Model (M) | 45% HFD |
Orlistat (O) | 45% HFD + 5% Orlistat |
Whole Kappaphycus alvarezii (T) | 45% HFD + 5% whole Kappaphycus alvarezii |
Carrageenan (CGN) | 45% HFD + 5% CGN |
Sans-carrageenan (SCGN) | 45% HFD + 5% SCGN |
Gene | Forward Primer | Reverse Primer |
---|---|---|
NPC1L1 | GCTTCTTCCGCAAGATATACACTCCC | GAGGATGCAGCAATAGCCACATAAGAC |
AdipoR1 | AGAGCATCTTCCGCATCCA | CAGGGGAGCCATGAAGTACA |
AdipoR2 | TACCAAGGAGATTTGGAGCCC | GCCCATAAACCCTTCATCTTCC |
aco | CAGCTAAGTTGCTTGTCTTTACCTC | CACCAAAATACAGGAATACCATAGC |
ppar-α | GTACGGTGTGTATGAAGCCATCTT | GCCGTACGCGATCAGCAT |
fasn | TGATGTGGAACACAGCAAGG | GGCTGTGGTGACTCTTAGTGATAA |
srebp-1a | ACTTTTCCTTAACGTGGGCCT | CATCTCGGCCAGTGTCTGTT |
© 2019 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Chin, Y.X.; Mi, Y.; Cao, W.X.; Lim, P.E.; Xue, C.H.; Tang, Q.J. A Pilot Study on Anti-Obesity Mechanisms of Kappaphycus Alvarezii: The Role of Native κ-Carrageenan and the Leftover Sans-Carrageenan Fraction. Nutrients 2019, 11, 1133. https://doi.org/10.3390/nu11051133
Chin YX, Mi Y, Cao WX, Lim PE, Xue CH, Tang QJ. A Pilot Study on Anti-Obesity Mechanisms of Kappaphycus Alvarezii: The Role of Native κ-Carrageenan and the Leftover Sans-Carrageenan Fraction. Nutrients. 2019; 11(5):1133. https://doi.org/10.3390/nu11051133
Chicago/Turabian StyleChin, Yao Xian, Ye Mi, Wan Xiu Cao, Phaik Eem Lim, Chang Hu Xue, and Qing Juan Tang. 2019. "A Pilot Study on Anti-Obesity Mechanisms of Kappaphycus Alvarezii: The Role of Native κ-Carrageenan and the Leftover Sans-Carrageenan Fraction" Nutrients 11, no. 5: 1133. https://doi.org/10.3390/nu11051133
APA StyleChin, Y. X., Mi, Y., Cao, W. X., Lim, P. E., Xue, C. H., & Tang, Q. J. (2019). A Pilot Study on Anti-Obesity Mechanisms of Kappaphycus Alvarezii: The Role of Native κ-Carrageenan and the Leftover Sans-Carrageenan Fraction. Nutrients, 11(5), 1133. https://doi.org/10.3390/nu11051133