Enhanced Anaerobic Biodegradation of PAHs by Rhamnolipid and Earthworm Casts in Contaminated Soil
Abstract
1. Introduction
2. Materials and Methods
2.1. Soil
2.2. Experimental Design
2.3. PAHs Extraction and Analysis in Soil
2.4. DNA Extraction from Soil and Quantitative Real-Time PCR
2.5. Microbial Community Analysis
2.6. Prediction of Microbial Community Function
2.7. Statistical Analysis
3. Results
3.1. Biostimulants Enhanced the Biodegradation of PAHs in Soil
3.2. Abundance of PAHs Anaerobic Degradation Genes
3.3. Changes in Microbial Alpha Diversity Analysis
3.4. Changes in Microbial Community Structure
3.5. Metabolic Function of Soil Bacteria
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Abdel-Shafy, H.I.; Mansour, M.S. A review on polycyclic aromatic hydrocarbons: Source, environmental impact, effect on human health and remediation. Egypt. J. Pet. 2016, 25, 107–123. [Google Scholar] [CrossRef] [Scilit]
- Kuppusamy, S.; Thavamani, P.; Venkateswarlu, K.; Lee, Y.B.; Naidu, R.; Megharaj, M. Remediation approaches for polycyclic aromatic hydrocarbons (PAHs) contaminated soils: Technological constraints, emerging trends and future directions. Chemosphere 2017, 168, 944–968. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhang, Y.; Dong, S.; Wang, H.; Tao, S.; Kiyama, R. Biological impact of environmental polycyclic aromatic hydrocarbons (ePAHs) as endocrine disruptors. Environ. Pollut. 2016, 213, 809–824. [Google Scholar] [CrossRef] [Scilit]
- Cai, H.; Yao, S.; Huang, J.; Zheng, X.; Sun, J.; Tao, X.; Lu, G. Polycyclic Aromatic Hydrocarbons Pollution Characteristics in Agricultural Soils of the Pearl River Delta Region, China. Int. J. Environ. Res. Public Health 2022, 19, 16233. [Google Scholar] [CrossRef] [Scilit]
- Manzetti, S. Polycyclic Aromatic Hydrocarbons in the Environment: Environmental Fate and Transformation. Polycycl. Aromat. Compd. 2013, 33, 311–330. [Google Scholar] [CrossRef] [Scilit]
- Lundstedt, S.; White, P.A.; Lemieux, C.L.; Lynes, K.D.; Lambert, I.B.; Öberg, L.; Haglund, P.; Tysklind, M. Sources, Fate, and Toxic Hazards of Oxygenated Polycyclic Aromatic Hydrocarbons (PAHs) at PAH-contaminated Sites. Ambio 2007, 36, 475–485. [Google Scholar] [CrossRef] [Scilit]
- Kaur, R.; Gupta, S.; Tripathi, V.; Chauhan, A.; Parashar, D.; Shankar, P.; Kashyap, V. Microbiome based approaches for the degradation of polycyclic aromatic hydrocarbons (PAHs): A current perception. Chemosphere 2023, 341, 139951. [Google Scholar] [CrossRef] [Scilit]
- Zhao, L.; Yao, T.; Zhao, Y.; Sun, S.; Lyu, C.; Zhao, W. Reduction strategies of polycyclic aromatic hydrocarbons in farmland soils: Microbial degradation, plant transport inhibition, and their mechanistic analysis. J. Hazard. Mater. 2024, 465, 133397. [Google Scholar] [CrossRef] [Scilit]
- Ghosal, D.; Ghosh, S.; Dutta, T.K.; Ahn, Y. Current State of Knowledge in Microbial Degradation of Polycyclic Aromatic Hydrocarbons (PAHs): A Review. Front. Microbiol. 2016, 7, 1369. [Google Scholar] [CrossRef] [Scilit]
- Ladino-Orjuela, G.; Gomes, E.; da Silva, R.; Salt, C.; Parsons, J.R. Metabolic Pathways for Degradation of Aromatic Hydrocarbons by Bacteria. Rev. Environ. Contam. Toxicol. 2016, 237, 105–121. [Google Scholar]
- Zafra, G.; Moreno-Montaño, A.; Absalón, Á.E.; Cortés-Espinosa, D.V. Degradation of polycyclic aromatic hydrocarbons in soil by a tolerant strain of Trichoderma asperellum. Environ. Sci. Pollut. Res. 2014, 22, 1034–1042. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Chen, C.; Zhang, Z.; Xu, P.; Hu, H.; Tang, H. Anaerobic biodegradation of polycyclic aromatic hydrocarbons. Environ. Res. 2023, 223, 115472. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhang, Z.; Sun, J.; Guo, H.; Wang, C.; Fang, T.; Rogers, M.J.; He, J.; Wang, H. Anaerobic biodegradation of phenanthrene by a newly isolated nitrate-dependent Achromobacter denitrificans strain PheN1 and exploration of the biotransformation processes by metabolite and genome analyses. Environ. Microbiol. 2021, 23, 908–923. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Dhar, K.; Subashchandrabose, S.R.; Venkateswarlu, K.; Krishnan, K.; Megharaj, M. Anaerobic Microbial Degradation of Polycyclic Aromatic Hydrocarbons: A Comprehensive Review. In Reviews of Environmental Contamination and Toxicology Volume 251; de Voogt, P., Ed.; Springer International Publishing: Cham, Switzerland, 2020; pp. 25–108. [Google Scholar]
- Ferraro, A.; Massini, G.; Miritana, V.M.; Panico, A.; Pontoni, L.; Race, M.; Rosa, S.; Signorini, A.; Fabbricino, M.; Pirozzi, F. Bioaugmentation strategy to enhance polycyclic aromatic hydrocarbons anaerobic biodegradation in contaminated soils. Chemosphere 2021, 275, 130091. [Google Scholar] [CrossRef] [Scilit]
- Li, X.; Yao, S.; Bian, Y.; Jiang, X.; Song, Y. The combination of biochar and plant roots improves soil bacterial adaptation to PAH stress: Insights from soil enzymes, microbiome, and metabolome. J. Hazard. Mater. 2020, 400, 123227. [Google Scholar] [CrossRef] [Scilit]
- Nzila, A. Biodegradation of high-molecular-weight polycyclic aromatic hydrocarbons under anaerobic conditions: Overview of studies, proposed pathways and future perspectives. Environ. Pollut. 2018, 239, 788–802. [Google Scholar] [CrossRef] [Scilit]
- Hošková, M.; Ježdík, R.; Schreiberová, O.; Chudoba, J.; Šír, M.; Čejková, A.; Masák, J.; Jirků, V.; Řezanka, T. Structural and physiochemical characterization of rhamnolipids produced by Acinetobacter calcoaceticus, Enterobacter asburiae and Pseudomonas aeruginosa in single strain and mixed cultures. J. Biotechnol. 2015, 193, 45–51. [Google Scholar] [CrossRef] [Scilit]
- Bharali, P.; Saikia, J.P.; Ray, A.; Konwar, B.K. Rhamnolipid (RL) from Pseudomonas aeruginosa OBP1: A novel chemotaxis and antibacterial agent. Colloids Surf. B Biointerfaces 2013, 103, 502–509. [Google Scholar] [CrossRef] [Scilit]
- Wang, J.; Bao, H.; Pan, G.; Zhang, H.; Li, J.; Li, J.; Cai, J.; Wu, F. Combined application of rhamnolipid and agricultural wastes enhances PAHs degradation via increasing their bioavailability and changing microbial community in contaminated soil. J. Environ. Manag. 2021, 294, 112998. [Google Scholar] [CrossRef] [Scilit]
- Luo, C.; Hu, X.; Bao, M.; Sun, X.; Li, F.; Li, Y.; Liu, W.; Yang, Y. Efficient biodegradation of phenanthrene using Pseudomonas stutzeri LSH-PAH1 with the addition of sophorolipids: Alleviation of biotoxicity and cometabolism studies. Environ. Pollut. 2022, 301, 119011. [Google Scholar] [CrossRef] [Scilit]
- Soberón-Chávez, G.; Maier, R.M. Biosurfactants: A general overview. Biosurfactants 2011, 20, 1–11. [Google Scholar]
- Luo, S.; Ren, L.; Wu, W.; Chen, Y.; Li, G.; Zhang, W.; Wei, T.; Liang, Y.-Q.; Zhang, D.; Wang, X.; et al. Impacts of earthworm casts on atrazine catabolism and bacterial community structure in laterite soil. J. Hazard. Mater. 2022, 425, 127778. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Rathankumar, A.K.; Saikia, K.; Ramachandran, K.; Batista, R.A.; Cabana, H.; Vaidyanathan, V.K. Effect of soil organic matter (SOM) on the degradation of polycyclic aromatic hydrocarbons using Pleurotus dryinus IBB 903-A microcosm study. J. Environ. Manag. 2020, 260, 110153. [Google Scholar] [CrossRef] [Scilit]
- Zhao, F.; Zhang, Y.; Li, Z.; Shi, J.; Zhang, G.; Zhang, H.; Yang, L. Vermicompost improves microbial functions of soil with continuous tomato cropping in a greenhouse. J. Soils Sediments 2020, 20, 380–391. [Google Scholar] [CrossRef] [Scilit]
- Zhang, Z.; Guo, H.; Sun, J.; Gong, X.; Wang, C.; Wang, H. Exploration of the biotransformation processes in the biodegradation of phenanthrene by a facultative anaerobe, strain PheF2, with Fe(III) or O(2) as an electron acceptor. Sci. Total Environ. 2021, 750, 142245. [Google Scholar] [CrossRef] [Scilit]
- Zhang, Z.; Sun, J.; Guo, H.; Gong, X.; Wang, C.; Wang, H. Investigation of anaerobic biodegradation of phenanthrene by a sulfate-dependent Geobacter sulfurreducens strain PheS2. J. Hazard. Mater. 2021, 409, 124522. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhang, Z.; Sun, J.; Gong, X.; Yang, Z.; Wang, C.; Wang, H. Anaerobic phenanthrene biodegradation by a new salt-tolerant/halophilic and nitrate-reducing Virgibacillus halodenitrificans strain PheN4 and metabolic processes exploration. J. Hazard. Mater. 2022, 435, 129085. [Google Scholar] [CrossRef] [Scilit]
- Liao, Q.; Liu, H.; Lu, C.; Liu, J.; Waigi, M.G.; Ling, W. Root exudates enhance the PAH degradation and degrading gene abundance in soils. Sci. Total Environ. 2021, 764, 144436. [Google Scholar] [CrossRef] [Scilit]
- Yuan, S.; Han, X.; Yin, X.; Su, P.; Zhang, Y.; Liu, Y.; Zhang, J.; Zhang, D. Nitrogen transformation promotes the anaerobic degradation of PAHs in water level fluctuation zone of the Three Gorges Reservoir in Yangtze River, China: Evidences derived from in-situ experiment. Sci. Total Environ. 2023, 864, 161034. [Google Scholar] [CrossRef] [Scilit]
- Bao, H.; Wang, J.; Zhang, H.; Li, J.; Li, H.; Wu, F. Effects of biochar and organic substrates on biodegradation of polycyclic aromatic hydrocarbons and microbial community structure in PAHs-contaminated soils. J. Hazard. Mater. 2020, 385, 121595. [Google Scholar] [CrossRef] [Scilit]
- Wilke, B.-M. Determination of Chemical and Physical Soil Properties. In Monitoring and Assessing Soil Bioremediation; Margesin, R., Schinner, F., Eds.; Springer: Berlin/Heidelberg, Germany, 2005; pp. 47–95. [Google Scholar]
- ASTM D2974-14; Standard Test Methods for Moisture, Ash, and Organic Matter of Peat and Other Organic Soils. ASTM: West Conshohocken, PA, USA, 1993.
- Kirk, P.L. Kjeldahl Method for Total Nitrogen. Anal. Chem. 1950, 22, 354–358. [Google Scholar] [CrossRef] [Scilit]
- Page, A.L. Methods of Soil Analysis. Part 2. Chemical and Microbiological Properties; Wiley: New York, NY, USA, 1982. [Google Scholar]
- Amoozegar, A.; Heitman, J.L.; Kranz, C.N. Comparison of soil particle density determined by a gas pycnometer using helium, nitrogen, and air. Soil Sci. Soc. Am. J. 2023, 87, 1–12. [Google Scholar] [CrossRef] [Scilit]
- Richards, L.A. Diagnosis and Improvement of Saline and Alkali Soils; US Government Printing Office: Washington, DC, USA, 1954.
- Posada-Baquero, R.; Grifoll, M.; Ortega-Calvo, J.-J. Rhamnolipid-enhanced solubilization and biodegradation of PAHs in soils after conventional bioremediation. Sci. Total Environ. 2019, 668, 790–796. [Google Scholar] [CrossRef] [Scilit]
- Yuan, K.; Xie, X.; Wang, X.; Lin, L.; Yang, L.; Luan, T.; Chen, B. Transcriptional response of Mycobacterium sp. strain A1-PYR to multiple polycyclic aromatic hydrocarbon contaminations. Environ. Pollut. 2018, 243, 824–832. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wang, J.; Liu, J.; Ling, W.; Huang, Q.; Gao, Y. Composite of PAH-degrading endophytic bacteria reduces contamination and health risks caused by PAHs in vegetables. Sci. Total Environ. 2017, 598, 471–478. [Google Scholar] [CrossRef] [Scilit]
- Wang, J.; Yang, Z.; Zhou, X.; Waigi, M.G.; Gudda, F.O.; Odinga, E.S.; Mosa, A.; Ling, W. Nitrogen addition enhanced the polycyclic aromatic hydrocarbons dissipation through increasing the abundance of related degrading genes in the soils. J. Hazard. Mater. 2022, 435, 129034. [Google Scholar] [CrossRef] [Scilit]
- Zheng, Z.; Liu, W.; Zhou, Q.; Li, J.; Zeb, A.; Wang, Q.; Lian, Y.; Shi, R.; Wang, J. Effects of co-modified biochar immobilized laccase on remediation and bacterial community of PAHs-contaminated soil. J. Hazard. Mater. 2023, 443, 130372. [Google Scholar] [CrossRef] [Scilit]
- Sawulski, P.; Clipson, N.; Doyle, E. Effects of polycyclic aromatic hydrocarbons on microbial community structure and PAH ring hydroxylating dioxygenase gene abundance in soil. Biodegradation 2014, 25, 835–847. [Google Scholar] [CrossRef] [Scilit]
- Song, B.; Tang, J.; Zhen, M.; Liu, X. Effect of rhamnolipids on enhanced anaerobic degradation of petroleum hydrocarbons in nitrate and sulfate sediments. Sci. Total Environ. 2019, 678, 438–447. [Google Scholar] [CrossRef] [Scilit]
- Wolf, D.; Gan, J. Influence of rhamnolipid biosurfactant and Brij-35 synthetic surfactant on 14C-Pyrene mineralization in soil. Environ. Pollut. 2018, 243, 1846–1853. [Google Scholar] [CrossRef] [Scilit]
- Dashti, N.; Ali, N.; Khanafer, M.; Radwan, S.S. Oil uptake by plant-based sorbents and its biodegradation by their naturally associated microorganisms. Environ. Pollut. 2017, 227, 468–475. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wang, Z.; Wang, W.; Li, Y.; Yang, Q. Co-metabolic degradation of naphthalene and pyrene by acclimated strain and competitive inhibition kinetics. J. Environ. Sci. Health Part B 2019, 54, 505–513. [Google Scholar] [CrossRef] [Scilit]
- Liang, L.; Song, X.; Kong, J.; Shen, C.; Huang, T.; Hu, Z. Anaerobic biodegradation of high-molecular-weight polycyclic aromatic hydrocarbons by a facultative anaerobe Pseudomonas sp. JP1. Biodegradation 2014, 25, 825–833. [Google Scholar] [CrossRef] [Scilit]
- Sayara, T.; Borràs, E.; Caminal, G.; Sarrà, M.; Sánchez, A. Bioremediation of PAHs-contaminated soil through composting: Influence of bioaugmentation and biostimulation on contaminant biodegradation. Int. Biodeterior. Biodegrad. 2011, 65, 859–865. [Google Scholar] [CrossRef] [Scilit]
- Yang, Y.; Zhang, N.; Xue, M.; Lu, S.T.; Tao, S. Effects of soil organic matter on the development of the microbial polycyclic aromatic hydrocarbons (PAHs) degradation potentials. Environ. Pollut. 2011, 159, 591–595. [Google Scholar] [CrossRef] [Scilit]
- Rodriguez-Campos, J.; Perales-Garcia, A.; Hernandez-Carballo, J.; Martinez-Rabelo, F.; Hernández-Castellanos, B.; Barois, I.; Contreras-Ramos, S.M. Bioremediation of soil contaminated by hydrocarbons with the combination of three technologies: Bioaugmentation, phytoremediation, and vermiremediation. J. Soils Sediments 2019, 19, 1981–1994. [Google Scholar] [CrossRef] [Scilit]
- Wang, Y.; Nie, M.; Diwu, Z.; Chang, F.; Nie, H.; Zhang, B.; Bai, X.; Yin, Q. Toxicity evaluation of the metabolites derived from the degradation of phenanthrene by one of a soil ubiquitous PAHs-degrading strain Rhodococcus qingshengii FF. J. Hazard. Mater. 2021, 415, 125657. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Chen, Q.; Li, Z.; Chen, Y.; Liu, M.; Yang, Q.; Zhu, B.; Mu, J.; Feng, L.; Chen, Z. Effects of electron acceptors and donors on anaerobic biodegradation of PAHs in marine sediments. Mar. Pollut. Bull. 2024, 199, 115925. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Guo, G.; He, F.; Tian, F.; Huang, Y.; Wang, H. Effect of salt contents on enzymatic activities and halophilic microbial community structure during phenanthrene degradation. Int. Biodeterior. Biodegrad. 2016, 110, 8–15. [Google Scholar] [CrossRef] [Scilit]
- Sorokin, D.Y.; Janssen, A.J.H.; Muyzer, G. Biodegradation Potential of Halo(alkali)philic Prokaryotes. Crit. Rev. Environ. Sci. Technol. 2012, 42, 811–856. [Google Scholar] [CrossRef] [Scilit]
- Rath, K.M.; Rousk, J. Salt effects on the soil microbial decomposer community and their role in organic carbon cycling: A review. Soil Biol. Biochem. 2015, 81, 108–123. [Google Scholar] [CrossRef] [Scilit]
- Rath, K.M.; Fierer, N.; Murphy, D.V.; Rousk, J. Linking bacterial community composition to soil salinity along environmental gradients. ISME J. 2019, 13, 836–846. [Google Scholar] [CrossRef] [Scilit]
- Taccari, M.; Milanovic, V.; Comitini, F.; Casucci, C.; Ciani, M. Effects of biostimulation and bioaugmentation on diesel removal and bacterial community. Int. Biodeterior. Biodegrad. 2012, 66, 39–46. [Google Scholar] [CrossRef] [Scilit]
- Jiang, L.; Yang, Y.; Jia, L.X.; Liu, Y.; Pan, B.; Lin, Y. Effects of earthworm casts on sorption-desorption, degradation, and bioavailability of nonylphenol in soil. Environ. Sci. Pollut. Res. 2018, 25, 7968–7977. [Google Scholar] [CrossRef] [Scilit]
- Ren, X.; Zeng, G.; Tang, L.; Wang, J.; Wan, J.; Wang, J.; Deng, Y.; Liu, Y.; Peng, B. The potential impact on the biodegradation of organic pollutants from composting technology for soil remediation. Waste Manag. 2018, 72, 138–149. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Chen, Z.; Chen, C.; Yang, Y.; Wang, X.; Zhou, H.; Zhang, C. Rhamnolipids supplement in salinized soils improves cotton growth through ameliorating soil properties and modifying rhizosphere communities. Appl. Soil. Ecol. 2024, 194, 105174. [Google Scholar] [CrossRef] [Scilit]
- Lee, D.W.; Lee, H.; Lee, A.H.; Kwon, B.-O.; Khim, J.S.; Yim, U.H.; Kim, B.S.; Kim, J.-J. Microbial community composition and PAHs removal potential of indigenous bacteria in oil contaminated sediment of Taean coast, Korea. Environ. Pollut. 2018, 234, 503–512. [Google Scholar] [CrossRef] [Scilit]
- Li, X.; Qu, C.; Bian, Y.; Gu, C.; Jiang, X.; Song, Y. New insights into the responses of soil microorganisms to polycyclic aromatic hydrocarbon stress by combining enzyme activity and sequencing analysis with metabolomics. Environ. Pollut. 2019, 255, 113312. [Google Scholar] [CrossRef] [Scilit]
- Wang, H.; Lou, J.; Gu, H.; Luo, X.; Yang, L.; Wu, L.; Liu, Y.; Wu, J.; Xu, J. Efficient biodegradation of phenanthrene by a novel strain Massilia sp. WF1 isolated from a PAH-contaminated soil. Environ. Sci. Pollut. Res. 2016, 23, 13378–13388. [Google Scholar] [CrossRef] [Scilit]
- Furtak, K.; Gawryjołek, K.; Gałązka, A.; Grządziel, J. The Response of Red Clover (Trifolium pratense L.) to Separate and Mixed Inoculations with Rhizobium leguminosarum and Azospirillum brasilense in Presence of Polycyclic Aromatic Hydrocarbons. Int. J. Environ. Res. Public Health 2020, 17, 5751. [Google Scholar] [CrossRef] [Scilit]
- Huang, X.; Mu, T.; Shen, C.; Lu, L.; Liu, J. Effects of bio-surfactants combined with alkaline conditions on volatile fatty acid production and microbial community in the anaerobic fermentation of waste activated sludge. Int. Biodeterior. Biodegrad. 2016, 114, 24–30. [Google Scholar] [CrossRef] [Scilit]
- Ali, A.; Imran Ghani, M.; Li, Y.; Ding, H.; Meng, H.; Cheng, Z. Hiseq Base Molecular Characterization of Soil Microbial Community, Diversity Structure, and Predictive Functional Profiling in Continuous Cucumber Planted Soil Affected by Diverse Cropping Systems in an Intensive Greenhouse Region of Northern China. Int. J. Mol. Sci. 2019, 20, 2619. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ambrosoli, R.; Petruzzelli, L.; Luis Minati, J.; Ajmone Marsan, F. Anaerobic PAH degradation in soil by a mixed bacterial consortium under denitrifying conditions. Chemosphere 2005, 60, 1231–1236. [Google Scholar] [CrossRef] [Scilit]
- Singh, A.; Karmegam, N.; Singh, G.S.; Bhadauria, T.; Chang, S.W.; Awasthi, M.K.; Sudhakar, S.; Arunachalam, K.D.; Biruntha, M.; Ravindran, B. Earthworms and vermicompost: An eco-friendly approach for repaying nature’s debt. Environ. Geochem. Health 2020, 42, 1617–1642. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Lai, L.; Li, S.; Zhang, S.; Liu, M.; Xia, L.; Ren, Y.; Cui, T. Enhancing Benzo[a]pyrene Degradation by Pantoea dispersa MSC14 through Biostimulation with Sodium Gluconate: Insights into Mechanisms and Molecular Regulation. Microorganisms 2024, 12, 592. [Google Scholar] [CrossRef] [Scilit]
- Elyamine, A.M.; Hu, C. Earthworms and rice straw enhanced soil bacterial diversity and promoted the degradation of phenanthrene. Environ. Sci. Eur. 2020, 32, 124. [Google Scholar] [CrossRef] [Scilit]
- Agnello, A.C.; Bagard, M.; van Hullebusch, E.D.; Esposito, G.; Huguenot, D. Comparative bioremediation of heavy metals and petroleum hydrocarbons co-contaminated soil by natural attenuation, phytoremediation, bioaugmentation and bioaugmentation-assisted phytoremediation. Sci. Total Environ. 2016, 563, 693–703. [Google Scholar] [CrossRef] [Scilit]






| Parameters | Value | Methods | Instrument |
|---|---|---|---|
| Moisture content (%) | 6.35 ± 0.84 | Oven-drying method [32] | Analytical balance |
| pH | 6.84 ± 0.17 | Potentiometric method [32] | pH meter |
| Organic matter (g·kg−1) | 14.40 ± 1.52 | Loss on Ignition [33] | Muffle furnace |
| Total N (g·kg−1) | 0.77 ± 0.02 | Kjeldahl digestion [34] | Elemental analyzer |
| Total P (g·kg−1) | 0.95 ± 0.06 | Molybdenum blue Colorimetric method [35] | Spectrophotometer |
| Bulk density (g·cm−3) | 1.02 ± 0.11 | pycnometer method [36] | Densimeter |
| Soil particle density (g·cm−3) | 2.71 ± 0.04 | Pycnometer | |
| Salinity (%) | 0.16 ± 0.05 | Saturated paste extract EC [37] | EC meter |
| Primer | Sequences |
|---|---|
| UbiD F: | GAGCATCCTGCGACAGTTCA |
| UbiD R: | GTAGTCGAGGGCGTGTTC |
| UbiE F: | CCGGCCTACGACTGGTATTC |
| UbiE R: | GAAGTACTGCACCCGTTCCA |
| 16 s F: | CCTACGGGNGGCWGCAG |
| 16 s R: | GACTACHVGGGTATCTAATCC |
| OTUs | Shannon | Chao1 | Ace | Simpson | Coverage | |
|---|---|---|---|---|---|---|
| O | 2748 ± 124 | 6.63 ± 0.11 | 2779.04 ± 201 | 2844.84 ± 58 | 0.0035 | 0.9965 |
| O–M | 1364 ± 102 | 1.85 ± 0.08 | 1259.23 ± 126 | 1314.74 ± 151 | 0.2900 | 0.9944 |
| O–F | 1738 ± 84 | 4.65 ± 0.05 | 1722.67 ± 96 | 1784.16 ± 89 | 0.0357 | 0.9956 |
| R–M | 1478 ± 132 * | 4.51 ± 0.19 ** | 1898.66 ± 189 ** | 1972.18 ± 174 ** | 0.0398 | 0.9959 |
| R–F | 1700 ± 76 | 4.72 ± 0.09 | 1903.10 ± 69 | 1969.96 ± 153 * | 0.0503 | 0.9953 |
| E–M | 2013 ± 141 ** | 5.00 ± 0.23 ** | 2203.21 ± 176 ** | 2326.94 ± 211 ** | 0.0289 | 0.9937 |
| E–F | 1999 ± 136 * | 5.48 + 0.19 ** | 2168.63 ± 164 * | 2239.59 ± 195 ** | 0.0132 | 0.9955 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Chen, T.; Ma, Y. Enhanced Anaerobic Biodegradation of PAHs by Rhamnolipid and Earthworm Casts in Contaminated Soil. Sustainability 2025, 17, 5417. https://doi.org/10.3390/su17125417
Chen T, Ma Y. Enhanced Anaerobic Biodegradation of PAHs by Rhamnolipid and Earthworm Casts in Contaminated Soil. Sustainability. 2025; 17(12):5417. https://doi.org/10.3390/su17125417
Chicago/Turabian StyleChen, Tao, and Yilin Ma. 2025. "Enhanced Anaerobic Biodegradation of PAHs by Rhamnolipid and Earthworm Casts in Contaminated Soil" Sustainability 17, no. 12: 5417. https://doi.org/10.3390/su17125417
APA StyleChen, T., & Ma, Y. (2025). Enhanced Anaerobic Biodegradation of PAHs by Rhamnolipid and Earthworm Casts in Contaminated Soil. Sustainability, 17(12), 5417. https://doi.org/10.3390/su17125417

