Next Article in Journal
Structure Improvement of Two-Cylinder Engine Cooling Water Jacket Based on Flow Field Simulation
Previous Article in Journal
Backcasting for Youths: Hypothetical and Critical Thinking in the Context of Sustainable Development Education
Previous Article in Special Issue
Suitability of Residues from Seaweed and Fish Processing for Composting and as Fertilizer
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

The Storage and Production of Bioenergy Using Macroalgae Biomass—Part I: Ensiling

1
Scottish Association for Marine Science, Oban, PA37 1QA, UK
2
Hortimare, 1704 CC Heerhugowaard, The Netherlands
3
Equilon Enterprises LLC, Houston, TX 77079, USA
*
Author to whom correspondence should be addressed.
Sustainability 2024, 16(24), 11094; https://doi.org/10.3390/su162411094
Submission received: 11 July 2024 / Revised: 26 November 2024 / Accepted: 5 December 2024 / Published: 18 December 2024
(This article belongs to the Special Issue Marine Biomass as the Basis for a Bio-Based, Circular Economy)

Abstract

Ensiling is a promising low-cost preservation approach that allows for a year-round supply of kelp feedstock for biofuel production via anaerobic digestion. In this study, farm-grown kelps of known age were ensiled with and without the addition of lactic acid bacterial (LAB) inoculant for a duration of up to one year in order to test long-term storage suitability. The study looked at the impacts of different bacterial inoculums on the chemical and microbial composition over the duration of storage. Significant fluctuations in the pH were observed during ensiling, leading to some cases of secondary fermentation and a loss of volatile components; however, over 12 months, the total mass loss was <2% on average. Biochemical compositional changes occurred in the silage over a period of 12 months, but protein, lipid and carbohydrate content remained suitable for biogas production. Microbial analysis showed variability in the bacterial distribution between the ensiled samples that was coincident with pH variability. Despite this variability, the bacterial communities underwent a succession with a selection for ensilage bacteria and drop in spoilage organisms. This shift supports the viability of this ensiled material for future usage. The impact of ensiling on bioenergy production through anaerobic digestion is explored in the second part of this two-part paper.

1. Introduction

Large Phaeophyceae macroalgae of the order Laminariales (kelp) are a promising bioresource for increasing the sustainability of various industries. Due to their fast growth, high yield per unit area, robust cultivation methods and high carbohydrate content, they are candidate feedstocks for biofuel production [1,2,3,4,5]. Within Europe, seaweed cultivation still operates on a small scale, and mainly for human food [6]; however, it is being considered as a future source of bioenergy [7].
A significant feature of kelps is that their composition and growth cycle are highly seasonal [8] and dependent on the surrounding physicochemical conditions and an entrained endogenous rhythm [9]. The optimal harvesting time of kelp for biofuel production is expected to occur in mid-late summer when maximal carbohydrate content is reached [7,10]. This seasonal harvesting generates a glut of biomass; however, this is prone to rapid microbial degradation due to its high carbohydrate and water content [11].
Efficient, continuous operation of a bioenergy processing plant will require a low-cost stabilisation method for the feedstock, which preserves the energy value of the biomass throughout the year [12]. If other valuable components are also preserved, using this low-cost stabilisation method, then these could be extracted first to add additional value to the biomass [13,14]. Preservation by sun drying is the most common stabilisation method for crops used worldwide [15]. This requires considerable handling, can change the chemical composition [16], and in areas without sufficient sunshine and dry conditions, requires large energy inputs. This makes it generally uneconomical and environmentally unsustainable for seaweed stabilisation in Northern temperate regions [17]. Ensilage offers a promising alternative for the stabilisation of wet seaweed biomass before processing for energy or biochemical extraction [12,18,19]. The method is commonly used for carbohydrate-rich, agricultural forage crops as a source of feed for ruminant livestock when fresh forage is unavailable [20]. The process relies on microbial preservation, where the biomass is tightly packed into a silo or bale, which quickly becomes anaerobic. Lactic acid bacteria (LAB) then convert a portion of the available labile sugar into predominantly lactic acid, causing the pH to decline to around 4 [21]. The acidic, anaerobic environment created inhibits the growth of undesirable spoilage microorganisms such as yeasts, molds and other bacteria (e.g., Clostridia or Enterobacter; [22,23,24]). When successful, ensilage preserves the composition with <7% energy losses [21]. The process may be particularly suited for anaerobic digestion, as experiments on agricultural crops have shown that it is able to preserve the majority of the Bio-Methane Potential (BMP) value of the biomass for up to one year [25,26]. In addition, ensiling has been shown to reduce the salt and sulphur content of seaweed, which has been suggested to have a positive impact on methane yields [27].
The kelp species Saccharina latissima is the target of experimentation for ensiling macroalgae, due to its widespread geographical cultivation potential and high carbohydrate content [23,28]. The typically high content of the C6 monosaccharide mannitol in this species can enable successful ensilage, as the compound is readily metabolised by numerous LAB groups acidifying the material and preventing further degradation [21]. In addition, the storage carbohydrate laminarin can be broken down into glucose by some microbes, and also through the continued activity of endogenous β-glucanases during storage [29].
Natural seaweed ensiling, although reported to be successful by some studies [23,28,30], is generally problematic as seaweed inherently has low concentrations of lactic acid bacteria (LAB), the bacteria responsible for spontaneous lactic acid production [28,31]. In addition, the chemical composition of macroalgae (with a high buffering capacity and a low concentration of easily digestible carbohydrates) has a prohibitive effect on ensiling [23,28]. Several silage additives have been employed to overcome these problems and improve silage fermentation, including the addition of acids [16,29], sugars [13], enzymes or lactic acid bacteria (LAB; [23,28]). Lactic acid bacteria are commonly added to address their low natural abundance, boost lactic acid production and quickly create a stable low pH silage [28,30,32]. This minimises energy/biomass losses due to undesirable microbial populations metabolizing the biomass constituents.
Several studies have now been published on macroalgal ensilage [13,23,27,28,29,30,31,32], however, to better understand the process and optimise preservation; data on the microbial and chemical compositional changes over yearlong ensilage are required. Yearlong ensilage is important to enable year-round biogas production by anaerobic digestion. Few macroalgal ensilage studies have, however, been conducted over long time scales (6 months [29] and 12 months [13,30]), and none of these studies have characterised the microbial communities involved, even though the ensilage microbiota are key for quick effective fermentation to minimise energy losses.
The indigenous microbial communities of the biomass may also play a role [33]; therefore, it is important to identify the epibiotal communities associated with fresh biomass in addition to the microbial species present during ensiling (either naturally present or added to promote fermentation). Promoting the growth of suitable indigenous microbial populations instead of inoculating with LAB cultures would provide a cheaper approach to ensilage. Seaweed, however, harbors few lactic acid bacteria. Alternatively, LAB that are commonly used in terrestrial crop ensiling such as Lactiplantibacillus (previously Lactobacillus) plantarum or other genera such as Pediococcus spp. [20,34] could be used, but many genera have not been trailed for seaweed ensilage.
This study aimed to assess the ensiling proficiency of S. latissimi with or without LAB inocula (three different LAB strains were used) by determining the chemical composition and microbial community dynamics over 12 months storage.

2. Materials and Methods

2.1. Lactic Acid Bacteria (LAB) Inoculum Preparation

Three LAB ensiling candidates were chosen for seaweed ensiling, namely Lactobacilus casei subsp. casei 11970 (Lcc), Lactiplantibacillus plantarum 6105 (Lp) and Tetragenococcus halophilus 9477 (Th) (National Collection of Industrial, Food and Marine Bacteria (NCMIB)), based on them being a) homofermentative, b) able to metabolise mannitol and c) salt-tolerant. These cultures were grown firstly in standard MRS + NaCl [35] media broth at 30 °C; then, after a week, the MRS media composition was modified to substitute half the glucose concentration with mannitol at 10 g·L−1 to allow for adaptation to seaweed-relevant sugars.

2.2. Seaweed Silage Preparation

S. latissima was harvested from cultivated stock at the Port a’ Bhuiltin seaweed farm, West Scotland (56°49.424′ N 005°28.194′ W) on the 3rd of July 2019. The fresh biomass was chopped using garden shears to a particle size of ~3 cm3. Approximately 1500 ± 10 g portions were then distributed into pre-labelled vacuum-sealed roll bags (Polyethylene, 28 cm × 0.01 cm roll cut to size) using stratified randomisation. The bagged seaweed was inoculated with the LAB preparations at the standard rate (10−6CFU g−1, [34]) with one of three LAB—L. plantarum 6105 (Lp), L. casei 11970 (Lc), T. halophilus 9477 (Th)—a mix of the three (M, applied at a ratio of 1:1:1), or sterile media (Z; Table 1). Inoculated bags were tightly packed (macroalgae pack well due to the lack of structural lignin), compressed manually, vacuum-sealed, and stored in the dark at ambient room temperature (15–20 °C). Ensiling was initiated within 24 h of harvest. Due to excessive gas production, bags were briefly vented and resealed during the early stages of ensiling (>9 day). All treatments for the 12-month ensilage were performed in quadruplicate except for Z (without bacterial additive), where there were 5 replicates. Further replication (as above) was also required for destructive sampling at 4 and 8 months.

2.3. Mass, pH and Sample Preparation

The mass of each bag was measured at the start, after 9 days, then at approximately 4-, 8- and 12-month timepoints. At the 4-, 8- and 12-month timepoints, the bags were homogenised and destructively sampled for pH, chemical and microbial composition analysis. Briefly, samples for the microbial composition analysis (Section 2.6) were collected first, using sterile technique and stored frozen. The pH of the homogenised sample was then measured, after which subsamples were collected and stored for later analysis of their chemical composition (frozen, freeze-dried then ground to fine powder using a coffee grinder (<1 mm)), volatile fatty acids (frozen) and solids content (using freeze drying and the standardised method for ash and volatile solids content [8,36]). All samples were stored frozen within 1 h of collection.

2.4. Chemical Composition Analysis

2.4.1. Protein Analysis

Total protein extraction was carried out on 0.5 mg (±10%) of each freeze-dried sample in 2 mL microcentrifuge tubes, to which 0.2 mL of 24% trichloroacetic acid was added. The samples were incubated in a water bath with the caps slightly open at 95 °C for 15 min following a procedure modified from Slocombe et al. [37]. The samples were allowed to cool to room temperature, then 0.6 mL of deionised water was added. These were centrifuged (16,200× g for 2 min at 10 °C) and the supernatant was discarded. The pellets were resuspended in 1 mL of Lowry’s reagent. The samples were analysed calorimetrically on a Nano Photometer using Lowry et al.’s [38] method modified by Pierce (Thermo Fisher Scientific Inc., Carlsbad, CA 92008 USA) against a bovine serum albumin standard over the range of 0.05–1.25 mg·mL−1.

2.4.2. Total Phenols

Total phenols were determined using the methods modified from Waterhouse [39]. and Schiener [8]. A total of 25 mg from each freeze-dried sample was extracted in a 2 mL microcentrifuge tube for 1 h on a rocking plate in 2 mL of 50% acetonitrile +0.1% formic acid (v/v) in UHP water. The sample was then spun-down at top speed (16,200× g) for 5 min. A total of 250 µL of the sample was then added to a fresh microcentrifuge containing 250 µL of UHP water and 100 µL of Folin–Ciocalteu reagent. The sample was vortex-mixed and left on the bench for 3 min; then, 500 µL of 6% (w/v) sodium carbonate (NaCO3) was added, and the sample was left to stand for 1 h. Samples were analysed colourimetrically at 750 nm on a plate reader (POLARstar OMEGA, BMG Labtech, Aylesbury, UK). Calibration was performed against phloroglucinol over the range of 0.01–0.25 mg·mL−1.

2.4.3. Total Lipids

Total lipids were quantified using the Sulfo-phospho-vanillin (SPV) method [40]. A total of 48–50 mg of the freeze-dried samples was vortexed in 2.1 mL chloroform/methanol (2:1, v/v) and left on ice for a minimum of 2 h. Next, 5 mL of 0.9% sodium chloride was added, and the sample was centrifuged (6100× g for 15 s). The top layer was removed, then 0.25 mL of the sample was transferred to a 4 mL glass vial and allowed to evaporate at 90 °C on a heating block. Following this, 0.1 mL of concentrated sulfuric acid was added and heated for a further 10 min. The vials were then cooled on ice for at least 5 min, then 2.4 mL of a reagent containing 1.2 mg·mL−1 vanillin in 68% phosphoric acid was added. These samples were allowed to sit for 10 min before the absorption was measured at 530 nm using the plate reader (POLARstar OMEGA, BMG Labtech, Aylesbury, UK). Samples were quantified against a canola oil standard over the range of 10–500 µg·mL−1.

2.4.4. Carbohydrate Analysis

Carbohydrate content (alginate, laminarian, mannitol and cellulose) was quantified using the methods described by Schiener et al. [8]. In addition, fucoidan was determined fluorometrically on a plate reader (POLARstar OMEGA, BMG Labtech, Aylesbury, UK) using a modification of the method developed by Yamazaki et al. [41].

2.4.5. Alginate Content

For alginate analysis, 7.5 mL of 6% (w/v) NaCO3 was added to 10–12 mg of the freeze-dried sample within 8 mL glass vials. The lids were sealed, and the vials incubated for 3 h at 60 °C within a shaking water bath (OLS200, Grant Instruments; Cambridge, Royston, UK). Halfway through, and at the end, the samples were inverted to ensure thorough mixing and complete sample hydration. The samples were centrifuged at 16,200× g for 2 min and analysed calorimetrically using a modified version of the Alcian Blue dye technique [42]. A total of 200 µL of the sample was combined with 950 µL of 0.5 M acetic acid and 50 µL of 0.5% (w/v) Alcian Blue (Thermo Fisher Scientific Inc., Carlsbad, CA 92008 USA) stock. After allowing a few minutes to neutralise, these were closed, briefly vortex-mixed and incubated overnight at room temperature. Dye precipitate was removed by centrifugation (16,200× g for 2 min) and absorption was measured at 610 nm using a Plate reader (POLARstar OMEGA, BMG Labtech, Aylesbury, UK). Samples were quantified against a sodium alginate standard (Thermo Fisher Scientific Inc., Carlsbad, CA 92008 USA) over the range of 0.02–1.25 mg·mL−1.

2.4.6. Fucoidan Content

Fucoidan was determined fluorometrically on a plate reader (POLARstar OMEGA, BMG Labtech, Aylesbury, UK) using a modification of the method developed by Yamazaki et al. [41]. Briefly, 2–2.5 mg of the freeze-dried sample was first incubated in 1 mL n-hexane on a shaking table for 1 h, then centrifuged for 5 min at 16,200× g. The supernatant was discarded, and the pellet left to air dry overnight. The pellet was resuspended in 0.8 mL of 5 mM hydrochloric acid (HCl) and incubated for 24 h on a shaking table, then neutralised with 0.2 mL of 20 mM HCl. To this, 50 µL of a staining solution containing 0.5% (v/v) SYBR® Gold stain (Thermo Fisher Scientific Inc., Carlsbad, CA 92008 USA) in 80 mM TRIS-HCl at pH 7.5 was added to 150 µL of sample. The samples were calibrated against a Saccharina japonica fucoidan standard (Carbosynth, Compton, UK) over the range of 0.01–5 mg·mL−1.

2.4.7. Mannitol, Laminarin and Cellulose Content

The saccharides, namely mannitol, laminarin [8] and cellulose [36], were quantified through duplicate high-performance liquid chromatography (HPLC) runs. In the first run, 48–50 mg of the freeze-dried sample was hydrolysed for 2 h in 1 mL of 0.5 M sulfuric acid, then autoclaved at 121 °C for 15 min. This was diluted with 7 mL of deionised water and filtered at 0.45 µm (Phenex, Phenomenex, Torrance, CA 90501-1430 USA) into 2 mL glass vials. The samples were then analysed for glucose (hydrolysed laminarin and free glucose) and mannitol [8], using an Agilent 1100 HPLC system (Agilent Technologies, Santa Clara, CA, USA) running isothermally at 60 °C, with a degassed 0.25 mM H2SO42 mobile phase at 0.45 mL·min−1, through a 150 × 7.8 mm ROA-organic acid H+ (8%) column (Rezek, Phenomenex, Torrance, CA 90501-1430, USA) and a refractive index detector. The calibration ranges were 0.01–2.5 mg·mL−1.
In the second run, cellulose was analysed using a method modified from Sluiter et al. [36]. 0.5 mL of 95% H2SO4 was dispensed into a vial containing 48–50 mg of the freeze-dried sample. This was incubated for 30 min at 30 °C, then 7.5 mL of deionised water was added, and this was autoclaved at 121 °C for 15 min. To this, 2.9 g of barium carbonate (Thermo Fisher Scientific Inc., Carlsbad, CA 92008 USA) was added to fully neutralise the acid overnight. Then, the sample was spun-down (2 min, 2000× g) and filtered (0.45 µm) into vials and analysed as above.

2.4.8. Organic Acids

Organic acids (volatile fatty acids) were determined using frozen ensiled samples. A homogenised 750–800 mg sample was weighed into a glass vial and dissolved in 20 mL of 62.5 mM sulfuric acid. Glass vials were sealed with minimal headspace, agitated regularly and left overnight. The samples were then filtered (0.45 µm) and analysed for lactic, acetic, propionic and butyric acid using an Agilent 1100 HPLC system (Agilent Technologies, Santa Clara, CA, USA). The HPLC system was run isothermically at 60 °C, with a degassed 0.25 mM H2SO42− mobile phase at 0.45 mL·min−1, through a 150 × 7.8 mm ROA-organic acid H+ (8%) column (Rezek, Phenomenex, Torrance, CA 90501-1430, USA) and a refractive index detector. Calibrations were made against commercial standards over the range of 0.001–0.25%. These percentages (v/v) were converted to mg·mL−1. using the known density of each organic acid.
Note: All chemical composition analyses are expressed on a dry-weight basis.

2.5. Statistical Analyses

Statistical analysis was undertaken using Minitab Statistical Software version 21.2.1. Data are displayed as means ± standard deviation. Tests between treatments were conducted using one-way ANOVA, and all data were tested for homogeneity of variance prior to analysis using Levene’s test.

2.6. Microbial Community Analysis of Seaweed Epibiota and Ensiled Samples

To identify the epibiotic communities associated with the seaweed at the time of sampling, triplicate swab samples were collected. Typically, a 15 cm surface area of frond from three replicate individuals was sampled using sterile polypropylene swabs with a viscose tip (SLS, Newhouse, UK). The top of the swab was cut using sterile technique and stored frozen until DNA extraction.
DNA was extracted from epibiotal (top of swab) and ensiled samples (0.5 g of homogenised material) using the FAST DNA soil kit (Fisher Scientific (MP Biomedicals™) Loughborough, UK) according to the manufacturer’s instructions. DNA extractions for replicate treatments were pooled in equimolar concentrations for 4-, 8- and 12-month samples. To examine the variability between replicates, 8-month extraction treatments were also sequenced individually. DNA was checked for quality and concentration using a POLARstar Omega microplate reader (Omega, BMG Labtech, Aylesbury, UK) and sent to Novogene (Cambridge, UK) for bacterial MiSeq Illumina sequencing. Paired-end amplicon sequencing (PE250) of 16S rRNA genes was performed using the 515F (5′ GTGCCAGCMGCCGCGGTAA 3′) and 907R (5′ CCGTCAATTCCTTTGAGTTT3′) primers targeting the bacterial V4–V5 region. Paired-end reads were split according to their unique barcodes and primers and barcodes truncated. DADA2 vers. 18 [43] was used to quality-filter, dereplicate and denoise truncated reads prior to chimera removal. Taxonomic inference was based on the DADA2 implementation of the Naïve Bayesian classifier [44] trained using SILVA 138 rRNA SSU database release [45]. Microbial community analysis of amplicon sequence variants (ASV) was performed using the NAMCO website (https://exbio.wzw.tum.de/namco/, accessed on 8 August 2023; a R shiny application, [46]) and R vers. 4.0.3 [47].

2.7. Data Accessibility

Sequences from seaweed epibiota and ensiled seaweed were deposited in the NCBI database with the accession numbers SAMN40414497–SAMN40414535 (PRJNA1086867).

3. Results

3.1. Bag Mass

In the first nine days of incubation, 1.2 ± 0.2% (mean ± standard deviation) of the fresh mass was lost. Over the same period, gas production caused the bags to swell. After this period, no significant bag swelling was observed. After four months, the fresh mass of the bags had reduced by 1.9 ± 0.0% (Figure 1) and by 12 months it had reduced by 2.0 ± 0.0% (mean ± standard deviation). There was no significant deviation between the treatments at the 12-month point (one-way ANOVA; df4, 8, f = 0.28, p = 0.889) as suggested by the replicate variability in Figure 1.

3.2. pH of the Experimental Replicates

The bag pH varied substantially between pH 3.8–6.1 (mean ± standard deviation = pH 4.60 ± 0.41; Figure 2). Neither treatment, nor timepoint, had a significant influence on pH (p > 0.05). Observationally, samples with pH < 4.7 had the characteristics associated with successful ensilage (based on previous experience and similar to Cabrita et al. [23]): these were dark brown in color, with the fragment integrity retained and with a pleasant, sweet smell. At a pH > 4.7, one or more changes in these characteristics was observed: a greener coloration, disintegration of the frond and/or an unpleasant smell. Most samples were considered successful by maintaining a pH of 4.4–4.6 over 12 months.
The highest rate of ensilaging above pH 4.7 failure was seen in samples inoculated with L. plantarum or L. casei subsp. casei (Lp-5/12 and Lc-4/12 replicates in each condition across the timepoints). A lower failure rate was seen with the samples containing mixed inoculum (3/12), followed by T. halophilus (2/12) and no inoculum (3/15).

3.3. Composition of Ensiled Seaweed

For the following results, only samples which obtained a pH of 4.7 or lower have been included below. Ensilage led to substantial changes to the fresh seaweed composition. Decreases were seen in all polysaccharides (alginate, mannitol, cellulose, laminarin and fucoidan). Increases were seen in proteins, lipids and polyphenols (Figure 3). The different inoculums had no distinct influence on the composition of the ensilage; however, some temporal changes in components were seen between the pre-ensiled and ensiled material and over a period of 4–12 months (Figure 3). Apart from fucoidan, all components changed following ensilage. Some components maintained consistent levels during the early stages of ensiling (cellulose), while other components varied during the early stages and were stable later in the ensilage (lipid and the organic acids acetic, propionic and butyric). For example, the lipid content increased 5-fold to 2.3% during the first 4 months of ensilage (Figure 3A), while polyphenols increased from 0.29% to 0.56% over 8 months (Figure 3B). Similarly, the protein content increased from 15.1% to 27.7% over 8 months, then declined slightly to 22.2% after 12 months (Figure 3C).
The mannitol, laminarin and alginate content all decreased over 8 months by 64, 63 and 42%, respectively (Figure 3D–F). The cellulose content did not change over 4 months but declined by 82% after 8 months (Figure 3G). Fucoidan appeared to be stable over the 12-month period. Following ensilage, organic acids increased over the first 4 months, while in the later stages some individual acids were stable, and others increased (Figure 3I–L). Acetic, propanoic and butyric acid remained at 0.3%, 0.5–0.6% and 0.5–0.6%, respectively, over 4–12 months (Figure 3I–K). Lactic acid was 0.4–0.5% over 8–12 months, then rose to 0.8% after 12 months (Figure 3L).

3.4. Organic Acid Production and pH

There was a strong positive relationship between the pH and the propanoic and acetic acid content of all the ensiled samples (successfully and unsuccessfully ensiled) while there was a strong negative correlation between the pH and the lactic acid content. No correlation was observed for butyric acid (Figure 4).
At the end of the experiment (at 12 months), only protein and mannitol showed significant differences between the treatments (Table 2). For protein treatment, Z was significantly higher, while for mannitol it was Lp.

3.5. Bacterial Community of the Seaweed Epibiota and Ensiled Samples

The number of valid reads obtained from the bacterial 16S rRNA gene sequence libraries averaged 117,514 (+/− 12,687) reads per seaweed epibiota/ensiled sample. A good coverage of >99% suggests adequate sampling depth capture of the majority of the bacteria. The sequences captured were clustered into amplicon sequence variants (ASVs), yielding a total of 21,158 ASVs, of which 21,109 ASVs were bacterial and 49 archaeal. Greater than 99% of bacterial library was classified as bacteria.
Alpha diversity metrics were calculated [46] to determine the richness and evenness of the microbial community. Both Shannon (all species represented) and Simpson’s (weighted by dominant species) diversity indexes were used to measure the richness and evenness of the ASVs identified. These indexes are not linear; therefore, effective indexes were used to take this into consideration. The richness and the bacterial diversity indexes of Shannon and Simpson were substantially greatest on the fresh seaweed compared to the ensiled material (Figure 5, Fresh versus ensiled diversity values were significantly different p < 0.05), suggesting that ensiling conditions were driving the community composition. Furthermore, the bacterial richness and diversity indexes decreased with time ensiled (e.g., average richness for 4-, 8- and 12-month samples 586 +/− 167, 329 +/− 109 and 252 +/− 143, respectively; only the comparison of richness between 4 and 12 months was significantly different p < 0.05). No clear trends were observed with inoculation treatments.
A range of alpha diversity indexes was identified for individual replicates from the 8-month ensiled samples ranging from 81–906 for Effective Shannon entropy, 60–700 for the Effective Simpson index and richness values of 128–1227. Unsuccessfully ensiled replicates (pH > 4.7) generally had a greater diversity than well-ensiled samples. When failed samples were removed from the analysis, the variability in the diversity indexes was reduced (e.g., 147–486).
The comparison of diversity (Bray–Curtis dissimilarity) between individual samples pooled into treatment groups and ‘months ensiled’, was used to test if any of the observed differences in community diversity could be explained by these variables. The bacterial community composition appears to be influenced by ‘months ensiled’ based on the PERMANOVA model (Figure 6), while different treatments showed no significant effects (p > 0.05).
Prior to ensilage, the dominant bacterial phyla on the fresh seaweed were Proteobacteria (44–53%), Bacteriodota (30–37%), Verrucomicrobiota (6–9%), Planctomycetota (2–4%) and Actinobacteriota (2–5%) (Figure 7). Proteobacteria (9–53%) and Bacteriodota (30–37%), as with the pre-ensiled material, were the dominant phyla in the ensiled communities. However, other populations diverged away, becoming dominant following ensilage, namely Firmicutes (2–38%), Spirochaetota (1–32%), Fusobacteriota (0–7%) and Verrucomicrobiota (0–3%). Pre-ensiled material was dominated by Proteobacteria, but the relative abundance of this decreased following ensiling. At 4 months, Spirochaetota, Firmicutes and Fusobacteriota were the most abundant. The abundance of Firmicutes and Fusobacteriota decreased in most samples over the time ensiled, while the proportion of Spirochaetota increased over time. No clear trend was observed with treatment except that the uninoculated sample (Z) had a high abundance of Firmicutes (4 and 8 months) relative to other treatments, and Lc, Lp and the mixed-treatment samples were more comparable to each other.
Similar to the phylum level, there was a divergence away from the pre-ensiled to ensiled communities at the genus level. Granulosicoccus (3–7%), Cocleimonas (2–7%), Arenicella (2–5%) and Litorimonas (2–4%) showed the highest abundances at the genus level in the seaweed epibiota (pre-ensiled) material. Interestingly, Lactobacillus (LAB) were found prior to ensiling, albeit at low abundances (0.06–0.6%). Spoilage bacteria were also identified in the fresh biomass samples but at very low abundances (0.03–0.04%).
In the ensiled material, the Sphaerochaeta (1–33%), the Rikenellaceae RC9 gut group (0–22%), Psychrilyobacter (0–15%), Clostridium sensu stricto. 12 (0–13%) and Lactobacillus (1–10%) genera were proportionally greatest, with an overall increase in and predominance of Sphaerochaeta and decrease in Clostridium with time ensiled. Two of the inoculated bacteria were detected at the genus level within the sequencing libraries namely Lactobacillus and Tetragenococcus. Lactobacillus was found in all samples with the highest relative abundance in the uninoculated samples (LAB inoculated samples 0.5–7%, Z uninoculated samples 6–10%), while Tetragenococcus was only identified at low abundances in some of the samples inoculated with this bacterium (only detected in 8- and 12-month samples and not all replicates (0–0.3% relative abundance).
In addition to analysis of the pooled replicates, individual replicates of all 8-month samples were sequenced. The 8-month replicate samples were broadly similar within treatments for all the inoculated samples. The replicates in the uninoculated samples were more distinct compared to the inoculated samples. Failed samples, particularly samples with a higher pH (pH 5.17), green colouration and the presence of high butyric acids (all indicators of a poorly ensiled sample), generally had greater bacterial diversity, and in many cases had a lower abundance of Lactobacillus. For example, replicate 4 for the mixed inoculation fulfilled all the characteristics of a poorly ensiled sample, had the highest richness value (n = 1227) and was dominated by a distinct community including Rhodobacteraceae (4%), Roseibacillus (3%), Saprospiraceae (3%) Sulfitobacter (3%) Litorimonas (3%), Hellea (2%) and Blastopirellula (2%).

4. Discussion

Seaweed ensilage is regarded as a cost-effective preservation method for long-term storage and year-round biofuel production, but it is not yet well understood, reproducible or optimised. It is challenging due to seaweed’s high buffering capacity, low concentration of easily digestible carbohydrates and low natural presence of LAB [28,48]. The potential of ensilage was originally demonstrated in 1955; however, it was deemed unsuccessful as an optimal pH drop of less than pH 4 was not achieved, resulting in a poor-quality product [18]. A number of silage additives have since been employed, including the addition of LAB or organic acids, to overcome these problems and improve silage fermentation, but results have been variable [13,16,28,31,49]. Further investigation is required to give insight into methods of improving preservation and ensuring reproducibility. The present study aimed to address this by conducting a detailed compositional investigation of a 12-month ensiling experiment with or without different LAB inoculants. Chemical and microbial compositional analysis was determined to allow for better understanding and optimisation of seaweed ensilage.
Of the different seaweeds tested for ensilage, S. latissima, the seaweed chosen for this study, has been shown to be the most promising for ensilage [13,23,28]. This is attributed to its lower buffering capacity (dependent on time of year sampled), greater quantities of total solids (dry matter content) and higher average content of microbially accessible saccharides, particularly mannitol, which many LAB are able to metabolise [21,28]. If composition is optimal, this can allow for increases in lactic acid, resulting in a rapid pH reduction followed by stabilisation at pH < 4.2 (recommended for effective terrestrial ensilage), preventing the growth of spoilage organisms and ensuring lower degradation of the biomass [20]. In the present study, experimental fermentation did not reproducibly achieve pH < 4.2. However, many samples had a low mass loss over 12 months and maintained a good level of digestible substrates for biofuel production (discussed in more detail later). The reason fermentation did not consistently achieve the recommended pH may be due to the composition (e.g., low carbohydrate content of the biomass) or buffering of the pH by the onset of fouling organisms, both of which are impacted by seasonality and growth conditions [13,28,32]. Feedstock composition is therefore considered a crucial factor in achieving optimal ensilage [50].

4.1. Composition Variation Influences Instability

Kelp composition is well-known to vary seasonally in both wild and cultivated biomasses [8,51,52,53]. For comparison, the total carbohydrate content of wild S. latissima populations in Scotland averaged over one year was 65% DM [8], whereas in previous work at the Port a’ Bhuiltin seaweed farm (farm used in this study), we found that the peak seasonal carbohydrate content of S. latissima reached its maximum in the summer months [54]. The biomass harvested for the present study was comparable to farmed seaweed from 2017, but lower relative to the literature on wild seaweed, with a total carbohydrate content of 37%; only 11.5% of this was composed of the non-structural carbohydrates mannitol and laminarin [8]. A high sugar content, and, in particular, mannitol, have been linked with a high likelihood of successful ensiling [23,28]. In addition, the total solid content (dry weight content) of the seaweed used here was 12% +/− 0.4. This is a similar to the content seen in other studies [8,55,56] but lower than the optimal content (25%) suggested for successful terrestrial ensilage [21]. Due to the early season low sugar content of S. latissima [8], the seaweed used in this study was harvested late to maximise the carbohydrate content, but this later harvest date resulted in increased levels of biofouling (June onwards [57]). Biofouling is not only detrimental to biomass quality, but the growth of calcareous organisms may also result in a higher buffering capacity impacting ensiling performance [13]. A balance must be found to maximise the degradable substrates but minimise fouling. The instability of seaweed differs, for example, between species, season and biofouling extent [13,28]. Long-term monitoring of environmental parameters alongside seaweed composition is key to identifying the drivers responsible for variability [10,32]. Understanding this seasonal/interannual variations in composition and its impact on instability is necessary so that successful silage can be assured, e.g., by supplementing the biomass for ensilage with LAB, sugar or acid [13,23,29,30,31]. Heat treatment has also been shown to be an effective method to increase the availability of the present sugars from kelps [49], allowing successful fermentation of S. latissima by LAB as a food product [32,49]. Other pretreatments have been applied, such as chopping (as applied in this study) or maceration to increase fermentation efficiency by increasing the surface area for degradation and improving the compaction of the biomass [27,58]. Other pretreatments include rapid wilting (24 h) or heat treatment prior to ensilage to increase the DM and digestible sugar content [23,32,59].

4.2. Inoculum Treatments

Inoculation with LAB did not improve ensilage in this study. Seaweed inherently has low concentrations of LAB; furthermore, to improve ensilability and lactic acid production, LAB are commonly added [13,23,28,30,31]. L. plantarum and L. casei were chosen for this study based on their antimicrobial and antifungal properties and common usage in terrestrial silage [21,60]. L. plantarum has been successfully used for S. latissima ensilage [13,30,32,59], fermentation [32,49] and for the fermentation of other kelps [31]. Other studies have suggested that inoculation with a mixed consortia is the most effective [13,23,28]. It must be noted that none of these studies examined the microbial communities associated with ensilage, either naturally present (discussed later) or added to promote fermentation of the biomass. This study found that most of the added inoculated bacteria were not identified in greater relative abundance than the uninoculated control. For Lactobacillus, inoculated samples higher concentrations were detected in the control samples (Z). It may be that these inoculated LAB were unsuitable for seaweed ensilage in this study and more appropriate LAB could be identified [30]. The uninoculated control had the highest success rate for ensilage (12/15 had a pH of less than 4.7), including the presence of LAB, albeit in low abundance in the seaweed epibiota (pre-ensiled). This suggests that the natural populations were suitable to promote ensilage. Other studies have shown that the addition of LAB leads to a faster reduction and lower pH compared to uninoculated ensilage, but the preserved dry matter content remained the same with or without the addition of LAB [30]. Cabrita et al. [23] found that the addition of LAB only had a beneficial effect on S. latissima but the natural ensilage of S. latissimi was still deemed successful.
Ensiling with T. halophilus was also comparably successful (10/12). T. halophilus was chosen in addition to the other LAB due to its reported high salt tolerance [61,62], reflecting the need for a halotolerant LAB in response to the use of a high-salinity biomass. T. halophilus sequences were only detected in low abundances in some of the samples inoculated with T. halophilus (only 4- and 8-month Th samples), and none were detected in the M samples. Alongside the fact that T. halophilus was just as variable and effective as no inoculum (Z), ensilage success may be as much related to the presence of natural ensiling bacteria as it was to T. halophilus.

4.3. Detailed Chemical and Microbial Compositional Analysis

4.3.1. Mass Loss over the Ensiling Period

The ensiling process leads to inevitable losses of mass and energy from the biomass. When performed well, <7% energy losses can be achieved [21]. A recent review for terrestrial silage estimated that 5% DM loss occurred in the silo, increasing to 18% with non-optimal management [63]. In the present study, incubation over one year led to a surprisingly low total fresh mass loss of 1.9%, regardless of condition or pH. The mass loss was lower than the 4.2–9.4% mass loss reported after 9 weeks by Cabrita et al. [23]. A separate study on Sargassum muticum reported <9% DM loss after 3 months [27]. The losses in this study are among the lowest reported, and we speculate this may be because we retained the silage leachate in situ.

4.3.2. Carbohydrate Content of Ensiled Seaweed

A high initial biomass carbohydrate content is generally beneficial for efficient ensiling [27]. Over the 12-month ensiling period, the amount of nearly all polysaccharides decreased due to their consumption/conversion by microbial activity. Mannitol was predominately utilised within the first 4 months, while laminarin and alginate were consumed steadily over 8 months, which agrees with the degradation pattern from other studies [16,23]. While mannitol decreased significantly following anaerobic fermentation in a study by Bruhn [32], this was still successful due to the addition of dextrose (a sugar carrier). By comparison to the other polysaccharides, we observed that fucoidan was not degraded in any condition and appears highly recalcitrant to degradation during successful ensilage. As fucoidan is of interest to the pharmaceutical industry for its functional properties, including anticoagulant, antithrombotic, immunomodulation, anticancer and anti-proliferative activities [64,65,66], this compound could be a target for biorefinery extraction from ensiled kelp before anaerobic digestion of the bulk biomass, without being detrimental to biogas production.

4.3.3. Protein Content of Ensiled Seaweed

Our study found that ensilage caused an increase in the total protein content using a modified Lowry assay. This stands in contrast with previous studies that have reported protein degradation by estimating protein content based on the elemental nitrogen [18], and also in some measurements of ammonia content as an indicator of proteolytic activity [23,59]. Bruhn and coworkers [32] maintained a stable protein content before and after ensilage (calculation based on nitrogen content). The degradation of protein tends to be in accordance with the existing terrestrial ensilage literature. Other studies have suggested that the epiphytic populations growing on the seaweed may increase the protein content [55,67].

4.3.4. Polyphenol Content of Ensiled Material

In agreement with this study, an increase in S. latissima total polyphenols during ensiling was recently reported [59]. Phaeophyceae macroalgae contain the class of phenolics called phlorotannins, which have been demonstrated to have antioxidant, anti-inflammatory and antimicrobial activities [68,69]. Some of these activities have been demonstrated to still be effective when used in animal feed [70]. Phlorotannins are highly variable in their reported molecular weight of ca. 126 > 10,000 Da [71] and the composition varies widely depending on the species [72]. It may be the case that ensilage is causing the breakdown of the longer chains into shorter units, which may in turn increase the total polyphenol content detected by our assay. Such a structural change due to ensilage has been detected in S. latissima by Campbell et al. [59]; therefore, this may just be a detection artifact, rather than microbial synthesis de novo.

4.3.5. Lipid Content of Ensiled Material

We observed that when lactic acid ensilage was successful (ca. pH < 4.6), the silage had increasing lipid (0–4 months), polyphenol and protein (0–8 months) contents due to apparent microbial metabolic synthesis. The lipid content of Laminariaceae macroalgae such as S. latissima is low (ca. 1–3%) compared to some other phaeophyte macroalgae such as the Dictyotales, which have ca. 10–11% [52,56,73]. Despite a five-fold increase in lipids during ensiling, the total lipid content was still very low at 2.3% DM.

4.3.6. Organic Acid Content of Ensiled Material

Due to the raw nature of the biomass used for ensilage—including complex microbial microbiota (as identified in this study)—a mixture of organic acids (acetic, propionic, butyric) other than lactic acid may be synthesised by the microbes during ensilage. While the production of organic acids other than lactic acid is detrimental for fodder applications (reduce palatability), the presence of these compounds for bioenergy silage is not considered a problem. It has been suggested that ensiling for biofuel production could be optimised to increase acetic and propanoic acid (supplementing with both homo- and heterofermentative LAB) instead of lactic acid to ensure better long-term stability (better for year-round supply), aerobic stability and improve methane yield for suboptimal silages [74].
While a mixture of organic acids is allowable for bioenergy conversion, it is still preferable to predominately produce lactic acid. When lactic acid alone is formed through homofermentation, this conserves the highest energy value within the biomass [21]. Organic acids such as acetic, propionic and butyric acid are evidence of wasteful secondary fermentation and heterofermentative LAB activity, where more of the biomass energy density is lost through heat and gaseous emissions [63]. In addition, these other organic acids have much higher pKa values than lactic acid, and so their formation will increase the biomass pH, which may destabilise the biomass, allowing unwanted microbial activity. A tipping point appears to occur at pH 4.6–4.7 in S. latissima ensilage in this study. This is supported by work by Cabrita et al. [23], who suggest that a pH of 4.48–4.10 is optimal for sugar kelp.
A wide range of endpoint pH levels was achieved in different replicates. At a pH of around 4.6–4.7, a distinct change was detected in the texture, smell and color of the biomass. There was a change in organic acids present in the samples from lactic (pH < 4.6) to acetic and propionic acid (pH > 4.7), with little lactic acid. This indicated a transition point from lactic acid fermentation to an uncontrolled secondary fermentation by many other microbial groups, where lactic acid is used as a substrate causing its depletion and a positive feedback pH rise. It is very useful for silage monitoring to know that at a pH 4.6–4.7, the transition from lactic acid fermentation to uncontrolled secondary fermentation may occur. Yet, this should not be interpreted as the target pH for seaweed ensilage to achieve, as the tipping point may begin to occur at a lower pH, but rise slowly, and other compositional changes must also be considered. In an acid preservation study, Sandbakken et al. [29] found that using a combination of sulfuric and formic acid at pH of 4 was needed to preserve S. latissima with no sugar loss over 6.5 months. McDonald and coworkers [21] suggested that the lower the DM content, the lower the pH needed to inactivate unwanted microbial activity.
It has also been suggested for terrestrial silage that saltiness (similar to seawater) could inhibit butrifying organisms at pH levels as high as 4.5 [21]. This does not appear to be effective in S. latissima ensilage in this study, as butyric acid occurred at up to 1% DM across the entire pH range. This may indicate the presence of spoilage microorganisms such as Enterobacteria, Bacillus or Clostridium [34]. Molecular analysis in this study did reveal the presence of Clostridium (all replicate bags) and Bacillus (in one sample), but no Enterobacteria were detected. However, the presence of spoilage organisms such as the spore-forming clostridia does not demonstrate that they are active; instead, they may be inactive until suitable conditions prevail [75].

4.3.7. Microbial Community Composition of the Fresh and Ensiled Material

The complex, indigenous microbial communities of fresh biomass play a critical role in the ensilage process [33,76]. Ensiling begins with the growth of these indigenous aerobic microorganisms. They utilise digestible sugars in the biomass to produce organic acids. As the oxygen concentration and pH fall, the organisms that are intolerant to these conditions are inhibited, while the microbial population that prefer these conditions, such as the homofermentative bacteria, predominant and the pH, continues to drop. Below pH 5, LAB (e.g., Pediococci and Lactobacillus) are selected for and may dominate the process to boost the production of lactic acid, resulting in a faster drop in pH (optimal drop pH < 4; [21]). This extreme anaerobic, acidic environment inhibits most microbial activity, including unwanted microorganisms (e.g., Clostridium, Bacillus, or Enterobacteria [22]), preserving high-quality, carbohydrate-rich biomass. If, however, the pH remains high or fails to drop rapidly spoilage organisms such as clostridia can dominate, leading to the production of unwanted butyric acid, protein breakdown and an increase in pH, resulting in a poor-quality biomass [21]. Seaweeds are commonly colonised by a diverse microbial consortium [77,78]. At the phylum level, Proteobacteria and Bacteroidetes typically predominate [78,79]. However, LAB, the key populations required for effective ensiling, are present in low numbers on the seaweed biomass [28]. This study showed a similarly high level of epiphytic diversity and phylum-level community composition, with a dominance of Proteobacteria and Bacteroidetes, to previous studies. Many of the genera identified are commonly found in association with seaweed (e.g., Granulosicoccus and brown algae [80] and Litorimonas identified as a core community associated with seaweed [81]). Furthermore, as suggested by other studies, LAB numbers (based on the relative abundance in the sequencing library) were low, suggesting that seaweed ensilage may be compromised by their absence or low abundance.
Despite the fact that microbiota play a key role in ensilage, as far as we are aware, no studies have looked at microbial populations involved in seaweed ensiling over a 12-month period. Although the indigenous epibiotic community is specific to the biomass, ensiling creates distinct conditions that select for key populations [82]; therefore, comparisons can be drawn with the microbial populations associated with the ensiling of terrestrial biomass. Associated with a change in conditions and selection for consortia, a reduction in bacterial diversity with ensilage duration is also commonly found [22,33]. The bacterial diversity in this study dropped following ensilage and with ensilage duration with the exception of the poorly ensiled samples, which showed an increase in diversity due, we assume, to oxygen ingress and aerobic activity.
Proteobacteria and Firmicutes phyla dominate ensiled material [83,84,85]. Within these phyla are lactic acid and propanoic acid bacteria that are often associated with biomass that has successfully ensiled, while increases in Enterobacteriaceae family, acetic acid bacteria, Clostridium, Bacillus and aerobic organisms relate to poorly ensiled material [22,75,76,82]. The seaweed ensilage microbiome identified in this study shares some phylogenetic and functional diversity with terrestrial ensilage. However, with the exception of Lactobacillus for desirable and Clostridium for undesirable organisms, many of the typical silage genera were not found in this study. Other LABs such as Streptococcus, Pediococcus and Lactococcus were detected in very low abundances in a few samples, and Sphingomonas and Stenotrophomonas (Enterobacteriaceae family) were detected in very low abundances in some of the unsuccessfully ensiled samples. Instead, this study was dominated by other fermentative organisms. Sphaerochaeta, the Rikenellaceae RC9 gut group and Psychrilyobacter, for example, are all involved in carbohydrate fermentation, producing short-chain fatty acids such as acetate and propionate [86,87,88]. The Rikenellaceae RC9 gut group and Psychrilyobacter, in addition, play a role in lipid and peptide/amino acid metabolism, respectively [87,88]; moreover, Psychrilyobacter is commonly found in marine animal gut environments [88], suggesting that these organisms are adapted to metabolizing seaweed. However, as this is the first study to identify the microbial populations associated with seaweed ensilage, it is difficult to determine what we would expect to find. Despite this, LAB were detected, and many ensiled samples had little mass loss and maintained digestible material (e.g., sugars and proteins) for biofuel production. Further, it should be noted that this study only examined the microbial population on fresh biomass and 4, 8 and 12 months after being ensiled. More detailed temporal resolution at the start of ensilage may have allowed for a better understanding of the associated microbial community.
A final consideration should be given to the treatment of the sample at the end of the ensilage “opening” phase. Once silage is opened, it becomes exposed to the air, which may lead to the growth of undesirable aerobic organisms and deterioration of the biomass [75]. In this study, samples for DNA-based analysis and BMP determination (paper B) were collected and immediately frozen to prevent the growth of aerobic organisms, specifically spore-forming organisms (e.g., Clostridium).
This study considered the potential of ensilage as a storage mechanism for preserving S. latissimi biomass for bioenergy production. The compositional results were variable, but showed promise; however, the effectiveness of ensilage has been shown to be species-dependent (S. latissimi ensilage was more promising than Fucus vesiculosus, [59]). Further work is therefore required to examine the ensilage of species other than S. latissimi to better understand microbial populations and the associated processes involved in seaweed ensilage. Another consideration, particularly for seaweeds other than S. latissimi that have low concentrations of easily digestible carbohydrates, might be the use of sugars as a silage additive [13] to maximise ensilage and minimise losses.

5. Conclusions

This study on the ensilage of Saccharina. latissima demonstrates that there exists a tipping point between a lactic-acid-fermentation-dominated silage at pH < 4.6 to uncontrolled secondary fermentation dominated by acetic and propionic acid production at pH > 4.7. Over the 12-month period at pH < 4.6, many saccharides were continually depleted, while increases were detected in lipids, polyphenols and proteins. The fucoidan content did not change over 12 months at pH < 4.6, and so this could be a target for biorefinery extraction, before anaerobic digestion of the remaining biomass. The seaweed used in the study harbored a diverse bacterial community, and following ensilage, a reduction in diversity was observed (with the exception of unsuccessful silage samples). Ensilage microbiota detected in this study reflected the variable composition of the silage. Key LAB populations were detected on the fresh seaweed and throughout ensilage. Crucially, it is apparent that the indigenous microbiota of S. latissima are suitable to drive ensiling of this seaweed. The microbial populations detected in this study were distinct to other terrestrial silages, which likely relates to the different compositions of the seaweeds compared to the terrestrial biomass. The ensiled S. latissima biomass generated in this study was, although not optimal, viable for anaerobic digestion.

Author Contributions

Conceptualisation, A.D.H., M.S.S. and J.F.; methodology and experimental work P.D.K. and A.K.D.; writing—original draft preparation, P.D.K. and A.K.D.; writing—review and editing all authors. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by Shell Research Limited. The funder had the following involvement with the study: Conceptualisation.

Data Availability Statement

Sequences from seaweed epibiota and ensiled seaweed were deposited in the NCBI database with the accession numbers SAMN40414497–SAMN40414535 (PRJNA1086867).

Conflicts of Interest

Author J.F was employed by the company Equilon Enterprises LLC, Houston, TX 77079 USA. The remaining authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest. The authors declare no conflicts of interest.

References

  1. Milledge, J.J.; Smith, B.; Dyer, P.W.; Harvey, P. Macroalgae-Derived Biofuel: A Review of Methods of Energy Extraction from Seaweed Biomass. Energies 2014, 7, 7194–7222. [Google Scholar] [CrossRef]
  2. Hughes, A.D.; Kelly, M.S.; Black, K.D.; Stanley, M.S. Biogas from Macroalgae: Is It Time to Revisit the Idea? Biotechnol. Biofuels 2012, 5, 86. [Google Scholar] [CrossRef] [PubMed]
  3. Wei, N.; Quarterman, J.; Jin, Y.S. Marine Macroalgae: An Untapped Resource for Producing Fuels and Chemicals. Trends Biotechnol. 2013, 31, 70–77. [Google Scholar] [CrossRef]
  4. Chen, H.; Zhou, D.; Luo, G.; Zhang, S.; Chen, J. Macroalgae for Biofuels Production: Progress and Perspectives. Renew. Sustain. Energy Rev. 2015, 47, 427–437. [Google Scholar] [CrossRef]
  5. Kostas, E.T.; Adams, J.M.M.; Ruiz, H.A.; Durán-Jiménez, G.; Lye, G.J. Macroalgal Biorefinery Concepts for the Circular Bioeconomy: A Review on Biotechnological Developments and Future Perspectives. Renew. Sustain. Energy Rev. 2021, 151, 111553. [Google Scholar] [CrossRef]
  6. Lüning, K.; Mortensen, L. European Aquaculture of Sugar Kelp (Saccharina latissima) for Food Industries: Iodine Content and Epiphytic Animals as Major Problems. Bot. Mar. 2015, 58, 449–455. [Google Scholar] [CrossRef]
  7. Kraan, S. Mass-Cultivation of Carbohydrate Rich Macroalgae, a Possible Solution for Sustainable Biofuel Production. Mitig. Adapt. Strat. Glob. Chang. 2013, 18, 27–46. [Google Scholar] [CrossRef]
  8. Schiener, P.; Black, K.D.; Stanley, M.S.; Green, D.H. The Seasonal Variation in the Chemical Composition of the Kelp Species Laminaria digitata, Laminaria hyperborea, Saccharina latissima and Alaria esculenta. J. Appl. Phycol. 2015, 27, 363–373. [Google Scholar] [CrossRef]
  9. Lüning, K. Endogenous Rhythms and Daylength Effects in Macroalgal Development. In Algal Culturing Techniques; Elsevier: Amsterdam, The Netherlands, 2005. [Google Scholar]
  10. Kerrison, P.D.; Stanley, M.S.; Edwards, M.D.; Black, K.D.; Hughes, A.D. The Cultivation of European Kelp for Bioenergy: Site and Species Selection. Biomass Bioenergy 2015, 80, 229–242. [Google Scholar] [CrossRef]
  11. Naylor, J. Production, Trade and Utilization of Seaweeds and Seaweed Products. In FAO Fisheries Technical Paper No. 159; FAO: Rome, Italy, 1976; p. 73. [Google Scholar]
  12. Milledge, J.J.; Harvey, P.J. Potential Process ‘Hurdles’ in the Use of Macroalgae as Feedstock for Biofuel Production in the British Isles. J. Chem. Technol. Biotechnol. 2016, 91, 2221–2234. [Google Scholar] [CrossRef]
  13. Larsen, S.U.; Ma, N.; Hou, X.; Bruhn, A.; Boderskov, T.; MacLeod, A.; Bak, U.G.; Bjerre, A.B. Ensiling of Sugar Kelp Biomass for Biorefining. Biomass Bioenergy 2021, 151, 106134. [Google Scholar] [CrossRef]
  14. Filote, C.; Santos, S.C.R.; Popa, V.I.; Botelho, C.M.S.; Volf, I. Biorefinery of Marine Macroalgae into High-Tech Bioproducts: A Review. Env. Chem. Lett. 2021, 19, 969–1000. [Google Scholar] [CrossRef]
  15. Esper, A.; Mühlbauer, W. Solar Drying—An Effective Means of Food Preservation. Renew. Energy 1998, 15, 95–100. [Google Scholar] [CrossRef]
  16. Albers, E.; Malmhäll-Bah, E.; Olsson, J.; Sterner, M.; Mayers, J.J.; Nylund, G.M.; Rupar-Gadd, K.; Abdollahi, M.; Cvijetinovic, S.; Welander, U.; et al. Influence of Preservation Methods on Biochemical Composition and Downstream Processing of Cultivated Saccharina latissima Biomass. Algal Res. 2021, 55, 102261. [Google Scholar] [CrossRef]
  17. Allen, E.; Wall, D.M.; Herrmann, C.; Xia, A.; Murphy, J.D. What Is the Gross Energy Yield of Third Generation Gaseous Biofuel Sourced from Seaweed? Energy 2015, 81, 352–360. [Google Scholar] [CrossRef]
  18. Black, W.A.P. The Preservation of Seaweed by Ensiling and Bactericides. J. Sci. Food Agric. 1955, 6, 14–23. [Google Scholar] [CrossRef]
  19. Milledge, J.J.; Maneein, S. Storage of Seaweed for Biofuel Production: Ensilage. In Sustainable Seaweed Technologies; Elsevier: Amsterdam, The Netherlands, 2020; pp. 155–167. [Google Scholar]
  20. Woolford, M.K.; Pahlow, G. The Silage Fermentation. In Microbiology of Fermented Foods; Wood, B.J.B., Ed.; Springer: Boston, MA, USA, 1998; pp. 73–102. [Google Scholar]
  21. McDonald, P.; Henderson, A.R.; Heron, S.J.E. The Biochemistry of Silage, 2nd ed.; Chalcombe Publications: Southampton, UK, 1991. [Google Scholar]
  22. Ni, K.; Wang, F.; Zhu, B.; Yang, J.; Zhou, G.; Pan, Y.; Tao, Y.; Zhong, J. Effects of Lactic Acid Bacteria and Molasses Additives on the Microbial Community and Fermentation Quality of Soybean Silage. Bioresour. Technol. 2017, 238, 706–715. [Google Scholar] [CrossRef]
  23. Cabrita, A.R.J.; Maia, M.R.G.; Sousa-Pinto, I.; Fonseca, A.J.M. Ensilage of Seaweeds from an Integrated Multi-Trophic Aquaculture System. Algal Res. 2017, 24, 290–298. [Google Scholar] [CrossRef]
  24. Maneein, S.; Milledge, J.J.; Nielsen, B.V.; Harvey, P.J. A Review of Seaweed Pre-Treatment Methods for Enhanced Biofuel Production by Anaerobic Digestion or Fermentation. Fermentation 2018, 4, 100. [Google Scholar] [CrossRef]
  25. Janke, L.; McCabe, B.K.; Harris, P.; Hill, A.; Lee, S.; Weinrich, S.; Marchuk, S.; Baillie, C. Ensiling Fermentation Reveals Pre-Treatment Effects for Anaerobic Digestion of Sugarcane Biomass: An Assessment of Ensiling Additives on Methane Potential. Bioresour. Technol. 2019, 279, 398–403. [Google Scholar] [CrossRef]
  26. Franco, R.T.; Bayard, R.; Buffière, P. Mathematical Modelling of the Ensiling Process before Biogas Production: Strengthening the Links between Biomass Storage and Anaerobic Digestion. Chem. Eng. J. 2018, 350, 872–882. [Google Scholar] [CrossRef]
  27. Milledge, J.J.; Harvey, P.J. Ensilage and Anaerobic Digestion of Sargassum muticum. J. Appl. Phycol. 2016, 28, 3021–3030. [Google Scholar] [CrossRef]
  28. Herrmann, C.; FitzGerald, J.; O’Shea, R.; Xia, A.; O’Kiely, P.; Murphy, J.D. Ensiling of Seaweed for a Seaweed Biofuel Industry. Bioresour. Technol. 2015, 196, 301–313. [Google Scholar] [CrossRef]
  29. Sandbakken, I.S.; Sæther, M.; Funderud, J.; Aasen, I.M. Acid Preservation of Saccharina latissima for Application as a Carbon Source for Fermentation to Biofuels and Chemicals. J. Appl. Phycol. 2018, 30, 3581–3588. [Google Scholar] [CrossRef]
  30. Redden, H.; Milledge, J.J.; Greenwell, H.C.; Dyer, P.W.; Harvey, P.J. Changes in Higher Heating Value and Ash Content of Seaweed during Ensiling. J. Appl. Phycol. 2017, 29, 1037–1046. [Google Scholar] [CrossRef]
  31. Uchida, M.; Numaguchi, K.; Murata, M. Mass Preparation of Marine Silage from Undaria pinnatifida and Its Dietary Effect for Young Pearl Oysters. Fish. Sci. 2004, 70, 456–462. [Google Scholar] [CrossRef]
  32. Bruhn, A.; Brynning, G.; Johansen, A.; Lindegaard, M.S.; Sveigaard, H.H.; Aarup, B.; Fonager, L.; Andersen, L.L.; Rasmussen, M.B.; Larsen, M.M.; et al. Fermentation of Sugar Kelp (Saccharina latissima)—Effects on Sensory Properties, and Content of Minerals and Metals. J. Appl. Phycol. 2019, 31, 3175–3187. [Google Scholar] [CrossRef]
  33. Eikmeyer, F.G.; Köfinger, P.; Poschenel, A.; Jünemann, S.; Zakrzewski, M.; Heinl, S.; Mayrhuber, E.; Grabherr, R.; Pühler, A.; Schwab, H.; et al. Metagenome Analyses Reveal the Influence of the Inoculant Lactobacillus buchneri CD034 on the Microbial Community Involved in Grass Ensiling. J. Biotechnol. 2013, 167, 334–343. [Google Scholar] [CrossRef] [PubMed]
  34. Pahlow, G.; Muck, R.E.; Driehuis, F.; Oude Elferink, S.J.W.H.; Spoelstra, S.F. Microbiology of Ensiling. In Silage Science and Technology; Wiley: Hoboken, NJ, USA, 2003; pp. 31–93. [Google Scholar]
  35. De Man, J.C.; Rogosa, M.; Sharpe, M.E. A Medium for the Cultivation of Lactobacilli. J. Appl. Microbiol. 1960, 23, 130–135. [Google Scholar] [CrossRef]
  36. Sluiter, A.; Hames, B.; Ruiz, R.; Scarlata, C.; Sluiter, J.; Templeton, D.; Crocker, D. Determination of Structural Carbohydrates and Lignin in Biomass: Laboratory Analytical Procedure (LAP) (Revised July 2011); National Renewable Energy Laboratory: Golden, CO, USA, 2008. [Google Scholar]
  37. Slocombe, S.P.; Ross, M.; Thomas, N.; McNeill, S.; Stanley, M.S. A Rapid and General Method for Measurement of Protein in Micro-Algal Biomass. Bioresour. Technol. 2013, 129, 51–57. [Google Scholar] [CrossRef] [PubMed]
  38. Lowry, O.H.; Rosebrough, N.J.; Farr, A.L.; Randall, R.J. Protein Measurement with the Folin Phenol Reagent. J. Biol. Chem. 1951, 193, 265–275. [Google Scholar] [CrossRef] [PubMed]
  39. Waterhouse, A.L. Determination of Total Phenolics. In Current Protocols in Food Analytical Chemistry; Wrolstad, R.E., Acree, T.E., An, H., Decker, E.A., Penner, M.H., Reid, D.S., Sporns, P., Schwartz, S.J., Shoemaker, C., Eds.; John Wiley & Sons: New York, NY, USA, 2002; pp. I1.1.1–I1.1.8. [Google Scholar]
  40. Cheng, Y.S.; Zheng, Y.; VanderGheynst, J.S. Rapid quantitative analysis of lipids using a colorimetric method in a microplate format. Lipids 2021, 46, 95–103. [Google Scholar] [CrossRef]
  41. Yamazaki, Y.; Nakamura, Y.; Nakamura, T. A Fluorometric Assay for Quantification of Fucoidan, A Sulfated Polysaccharide from Brown Algae. Plant Biotechnol. 2016, 33, 117–121. [Google Scholar] [CrossRef]
  42. Ramus, J. Alcian Blue: A Quantitative Aqueous Assay for Algal Acid and Sulfated Polysaccharides. J. Phycol. 1977, 13, 345–348. [Google Scholar] [CrossRef]
  43. Callahan, B.J.; McMurdie, P.J.; Rosen, M.J.; Han, A.W.; Johnson, A.J.A.; Holmes, S.P. DADA2: High-resolution sample inference from Illumina amplicon data. Nat. Methods 2016, 13, 581–583. [Google Scholar] [CrossRef]
  44. Wang, Q.; Garrity, G.M.; Tiedje, J.M.; Cole, J.R. Naïve Bayesian Classifier for Rapid Assignment of rRNA Sequences into the New Bacterial Taxonomy. Appl. Environ. Microbiol. 2007, 73, 5261–5267. [Google Scholar] [CrossRef] [PubMed]
  45. Yilmaz, P.; Parfrey, L.W.; Yarza, P.; Gerken, J.; Pruesse, E.; Quast, C.; Schweer, T.; Peplies, J.; Ludwig, W.; Glöckner, F.O. The SILVA and “all-species Living Tree Project (LTP)” taxonomic frameworks. Nucleic Acids Res. 2014, 42, D643–D648. [Google Scholar] [CrossRef] [PubMed]
  46. Dietrich, A.; Matchado, M.S.; Zwiebel, M.; Ölke, B.; Lauber, M.; Lagkouvardos, I.; Baumbach, J.; Haller, D.; Brandl, B.; Skurk, T.; et al. Namco: A microbiome explorer. Microb. Genom. 2022, 8, mgen000852. [Google Scholar] [CrossRef]
  47. R Core Team. R: A Language and Environment for Statistical Computing; R Foundation for Statistical Computing: Vienna, Austria, 2019; Available online: https://www.R-project.org/ (accessed on 8 August 2023).
  48. Jard, G.; Marfaing, H.; Carrère, H.; Delgenes, J.P.; Steyer, J.P.; Dumas, C. Bioresource Technology French Brittany Macroalgae Screening: Composition and Methane Potential for Potential Alternative Sources of Energy and Products. Bioresour. Technol. 2013, 144, 492–498. [Google Scholar] [CrossRef]
  49. Gupta, S.; Abu-Ghannam, N.; Scannell, A.G.M. Growth and Kinetics of Lactobacillus plantarum in the Fermentation of Edible Irish Brown Seaweeds. Food Bioprod. Process 2011, 89, 346–355. [Google Scholar] [CrossRef]
  50. Franco, R.T.; Buffière, P.; Bayard, R. Ensiling for biogas production: Critical parameters. A review. Biomass Bioenergy 2016, 94, 94–104. [Google Scholar] [CrossRef]
  51. Handå, A.; Forbord, S.; Wang, X.; Broch, O.J.; Dahle, S.W.; Størseth, T.R.; Reitan, K.I.; Olsen, Y.; Skjermo, J. Seasonal- and Depth-Dependent Growth of Cultivated Kelp (Saccharina latissima) in Close Proximity to Salmon (Salmo Salar) Aquaculture in Norway. Aquaculture 2013, 414–415, 191–201. [Google Scholar] [CrossRef]
  52. Bak, U.G. Seaweed Cultivation in the Faroe Islands: An Investigation of the Biochemical Composition of Selected Macroalgal Species, Optimised Seeding Technics, and Open-Ocean Cultivation Methods from a Commercial Perspective. Ph.D. Thesis, Technical University of Denmark, Copenhagen, Denmark, 2019; p. 157. [Google Scholar]
  53. Manns, D.; Nielsen, M.M.; Bruhn, A.; Saake, B.; Meyer, A.S. Compositional Variations of Brown Seaweeds Laminaria digitata and Saccharina latissima in Danish Waters. J. Appl. Phycol. 2017, 29, 1493–1506. [Google Scholar] [CrossRef]
  54. Kerrison, P.D. The Scottish Association for Marine Science: Oban, UK, 2019; Manuscript in preparation.
  55. Marinho, G.S.; Holdt, S.L.; Angelidaki, I. Seasonal Variations in the Amino Acid Profile and Protein Nutritional Value of Saccharina Latissima Cultivated in a Commercial IMTA System. J. Appl. Phycol. 2015, 27, 1991–2000. [Google Scholar] [CrossRef]
  56. Marinho, G.S.; Holdt, S.L.; Jacobsen, C.; Angelidaki, I. Lipids and Composition of Fatty Acids of Saccharina latissima Cultivated Year-Round in Integrated Multi-Trophic Aquaculture. Mar. Drugs 2015, 13, 4357–4374. [Google Scholar] [CrossRef] [PubMed]
  57. Bruhn, A.; Tørring, D.; Thomsen, M.; Canal-Vergés, P.; Nielsen, M.; Rasmussen, M.; Eybye, K.; Larsen, M.; Balsby, T.; Petersen, J. Impact of environmental conditions on biomass yield, quality, and bio-mitigation capacity of Saccharina latissima. Aquac. Environ. Interact 2016, 8, 619–636. [Google Scholar] [CrossRef]
  58. Tsapekos, P.; Kougias, P.G.; Angelidaki, I. Biogas production from ensiled meadow grass; effect of mechanical pretreatments and rapid determination of substrate biodegradability via physicochemical methods. Bioresour. Technol. 2015, 182, 329–335. [Google Scholar] [CrossRef] [PubMed]
  59. Campbell, M.; Ortuño, J.; Ford, L.; Davies, D.R.; Koidis, A.; Walsh, P.J.; Theodoridou, K. The Effect of Ensiling on the Nutritional Composition and Fermentation Characteristics of Brown Seaweeds as a Ruminant Feed Ingredient. Animals 2020, 10, 1019. [Google Scholar] [CrossRef] [PubMed]
  60. AHDB. Making Grass Silage for Better Returns; AHDB: Kenilworth, UK, 2011. [Google Scholar]
  61. Tanasupawat, S.; Daengsubha, W. Pediococcus Species and Related Bacteria Found in Fermented Foods and Related Materials in Thailand. J. Gen. Appl. Microbiol. 1983, 29, 487–506. [Google Scholar] [CrossRef]
  62. Röling, W.F.M.; Van Verseveld, H.W. Growth, Maintenance and Fermentation Pattern of the Salt-Tolerant Lactic Acid Bacterium Tetragenococcus halophila in Anaerobic Glucose Limited Retention Cultures. Anton Leeuw Int. J. G. 1997, 72, 239–243. [Google Scholar] [CrossRef]
  63. Borreani, G.; Tabacco, E.; Schmidt, R.J.; Holmes, B.J.; Muck, R.E. Silage Review: Factors Affecting Dry Matter and Quality Losses in Silages. J. Dairy. Sci. 2018, 101, 3952–3979. [Google Scholar] [CrossRef] [PubMed]
  64. Wijesinghe, W.A.J.P.; Jeon, Y.-J. Biological Activities and Potential Industrial Applications of Fucose Rich Sulfated Polysaccharides and Fucoidans Isolated from Brown Seaweeds: A Review. Carbohydr. Polym. 2012, 88, 13–20. [Google Scholar] [CrossRef]
  65. Senthilkumar, K.; Manivasagan, P.; Venkatesan, J. International Journal of Biological Macromolecules Brown Seaweed Fucoidan: Biological Activity and Apoptosis, Growth Signaling Mechanism in Cancer. Int. J. Biol. Macromol. 2013, 60, 366–374. [Google Scholar] [CrossRef]
  66. Young, H.; Ho, M.; Park, C.; Jin, C.; Kim, G.; Choi, I.; Deuk, N.; Nam, T.; Kyu, T.; Hyun, Y. Anti-Inflammatory Effects of Fucoidan through Inhibition of NF- j B, MAPK and Akt Activation in Lipopolysaccharide-Induced BV2 Microglia Cells. Food Chem. Toxicol. 2011, 49, 1745–1752. [Google Scholar]
  67. Forbord, S.; Matsson, S.; Brodahl, G.E.; Bluhm, B.A.; Broch, O.J.; Handå, A.; Metaxas, A.; Skjermo, J.; Steinhovden, K.B.; Olsen, Y. Latitudinal, Seasonal and Depth-Dependent Variation in Growth, Chemical Composition and Biofouling of Cultivated Saccharina latissima (Phaeophyceae) along the Norwegian Coast. J. Appl. Phycol. 2020, 32, 2215–2232. [Google Scholar] [CrossRef]
  68. Eom, S.H.; Kim, Y.M.; Kim, S.K. Antimicrobial Effect of Phlorotannins from Marine Brown Algae. Food Chem. Toxicol. 2012, 50, 3251–3255. [Google Scholar] [CrossRef] [PubMed]
  69. Ford, L.; Curry, C.; Campbell, M.; Theodoridou, K.; Sheldrake, G.; Dick, J.; Stella, L.; Walsh, P.J. Effect of Phlorotannins from Brown Seaweeds on the in Vitro Digestibility of Pig Feed. Animals 2020, 10, 2193. [Google Scholar] [CrossRef]
  70. Wang, Y.; Xu, Z.; Bach, S.J.; McAllister, T.A. Effects of Phlorotannins from Ascophyllum Nodosum (Brown Seaweed) on in Vitro Ruminal Digestion of Mixed Forage or Barley Grain. Anim. Feed. Sci. Technol. 2008, 145, 375–395. [Google Scholar] [CrossRef]
  71. Parys, S.; Rosenbaum, A.; Kehraus, S.; Reher, G.; Glombitza, K.; König, G.M. Evaluation of Quantitative Methods for the Determination of Polyphenols in Algal Extracts. J. Nat. Prod. 2007, 70, 1865–1870. [Google Scholar] [CrossRef]
  72. Steevensz, A.J.; Mackinnon, S.L.; Hankinson, R.; Craft, C.; Connan, S.; Stengel, D.B.; Melanson, J.E. Pro Fi Ling Phlorotannins in Brown Macroalgae by Liquid Chromatography—High Resolution Mass Spectrometry. Phytochem. Anal. 2012, 23, 547–553. [Google Scholar] [CrossRef]
  73. Gosch, B.J.; Magnusson, M.; Paul, N.A.; de Nys, R. Total Lipid and Fatty Acid Composition of Seaweeds for the Selection of Species for Oil-Based Biofuel and Bioproducts. GCB Bioenergy 2012, 4, 919–930. [Google Scholar] [CrossRef]
  74. Herrmann, C.; Idler, C.; Heiermann, M. Improving Aerobic Stability and Biogas Production of Maize Silage Using Silage Additives. Bioresour. Technol. 2015, 197, 393–403. [Google Scholar] [CrossRef]
  75. Ávila, C.L.S.; Carvalho, B.F. Silage Fermentation—Updates Focusing on the Performance of Micro-Organisms. J. Appl. Microbiol. 2020, 128, 966–984. [Google Scholar] [CrossRef] [PubMed]
  76. Pang, H.; Qin, G.; Tan, Z.; Li, Z.; Wang, Y.; Cai, Y. Natural Populations of Lactic Acid Bacteria Associated with Silage Fermentation as Determined by Phenotype, 16S Ribosomal RNA and RecA Gene Analysis. Syst. Appl. Microbiol. 2011, 34, 235–241. [Google Scholar] [CrossRef]
  77. Egan, S.; Harder, T.; Burke, C.; Steinberg, P.; Kjelleberg, S.; Thomas, T. The Seaweed Holobiont: Understanding Seaweed-Bacteria Interactions. FEMS Microbiol. Rev. 2013, 37, 462–476. [Google Scholar] [CrossRef] [PubMed]
  78. Hollants, J.; Leliaert, F.; De Clerck, O.; Willems, A. What We Can Learn from Sushi: A Review on Seaweed-Bacterial Associations. FEMS Microbiol. Ecol. 2013, 83, 1–16. [Google Scholar] [CrossRef]
  79. King, N.G.; Moore, P.J.; Thorpe, J.M.; Smale, D.A. Consistency and Variation in the Kelp Microbiota: Patterns of Bacterial Community Structure Across Spatial Scales. Microb. Ecol. 2023, 85, 1265–1275. [Google Scholar] [CrossRef]
  80. Park, S.; Jung, Y.T.; Won, S.M.; Park, J.M.; Yoon, J.H. Granulosicoccus undariae sp. nov., a member of the family Granulosicoccaceae isolated from a brown algae reservoir and emended description of the genus Granulosicoccus. Antonie Leeuwenhoek 2014, 106, 845–852. [Google Scholar] [CrossRef]
  81. Paix, B.; Layglon, N.; le Poupon, C.; D’Onofrio, S.; Misson, B.; Garnier, C.; Culioli, G.; Briand, J.F. Integration of spatio-temporal variations of surface metabolomes and epibacterial communities highlights the importance of copper stress as a major factor shaping host-microbiota interactions within a Mediterranean seaweed holobiont. Microbiome 2021, 9, 201. [Google Scholar] [CrossRef]
  82. Dong, Z.; Li, J.; Chen, L.; Wang, S.; Shao, T. Effects of Freeze-Thaw Event on Microbial Community Dynamics during Red Clover Ensiling. Front. Microbiol. 2019, 10, 1559. [Google Scholar] [CrossRef]
  83. Liu, B.; Huan, H.; Gu, H.; Xu, N.; Shen, Q.; Ding, C. Dynamics of a Microbial Community during Ensiling and upon Aerobic Exposure in Lactic Acid Bacteria Inoculation-Treated and Untreated Barley Silages. Bioresour. Technol. 2019, 273, 212–219. [Google Scholar] [CrossRef] [PubMed]
  84. Muck, R.E. Recent Advances in Silage Microbiology. Agric. Food Sci. 2013, 22, 3980–4000. [Google Scholar] [CrossRef]
  85. Zi, X.; Liu, Y.; Chen, T.; Li, M.; Zhou, H.; Tang, J. Effects of Sucrose, Glucose and Molasses on Fermentation Quality and Bacterial Community of Stylo Silage. Fermentation 2022, 8, 191. [Google Scholar] [CrossRef]
  86. Caro-Quintero, A.; Ritalahti, K.M.; Cusick, K.D.; Löffler, F.E.; Konstantinidis, K.T. The chimeric genome of Sphaerochaeta: Nonspiral spirochetes that break with the prevalent dogma in spirochete biology. mBio 2012, 3, e00025-12. [Google Scholar] [CrossRef]
  87. Sebastià, C.; Folch, J.M.; Ballester, M.; Estellé, J.; Passols, M.; Muñoz, M.; García-Casco, J.M.; Fernández, A.I.; Castelló, A.; Sánchez, A.; et al. Interrelation between gut microbiota, SCFA, and fatty acid composition in pigs. MSystems 2024, 9, e01049-23. [Google Scholar] [CrossRef] [PubMed]
  88. Liu, M.; Wei, G.; Lai, Q.; Huang, Z.; Li, M.; Shao, Z. Genomic and metabolic insights into the first host-associated isolate of Psychrilyobacter. Microbiol. Spectr. 2023, 11, e03990-22. [Google Scholar] [CrossRef]
Figure 1. Percentage change in fresh mass of ensiled Saccharina latissima over a 12-month incubation period, with different bacterial inocula Z: no bacterial addition, Lp: L. plantarum, Lcc: L. casei subspecies casei, Th: T. halophilus, M: An equal mix of the three species. Four replicates were used for each treatment per time point (4, 8 and 12 months), with the exception of Z (no bacterial addition) where there were five replicates per time point. Error bars represent standard deviation of the mean.
Figure 1. Percentage change in fresh mass of ensiled Saccharina latissima over a 12-month incubation period, with different bacterial inocula Z: no bacterial addition, Lp: L. plantarum, Lcc: L. casei subspecies casei, Th: T. halophilus, M: An equal mix of the three species. Four replicates were used for each treatment per time point (4, 8 and 12 months), with the exception of Z (no bacterial addition) where there were five replicates per time point. Error bars represent standard deviation of the mean.
Sustainability 16 11094 g001
Figure 2. The distribution of pH in all replicates over the 12-month experimental ensilage incubation of Saccharina latissima. A morphological transition was observed in the biomass at pH 4.6–4.7. The horizontal black line denotes the pH for successful ensilage (pH < 4.7) or poor ensilage (pH ≥ 4.7).
Figure 2. The distribution of pH in all replicates over the 12-month experimental ensilage incubation of Saccharina latissima. A morphological transition was observed in the biomass at pH 4.6–4.7. The horizontal black line denotes the pH for successful ensilage (pH < 4.7) or poor ensilage (pH ≥ 4.7).
Sustainability 16 11094 g002
Figure 3. Temporal changes in volatile solids composition components in Saccharina latissima ensiled over 12 months with different bacterial inocula, where the pH achieved was <4.7. Z: no bacterial addition, Lp: Lactobacillus plantarum, Lcc: Lactobacillus casei subspecies casei, Th: Tetragenococcus halophilus, M: An equal mix of the three bacterial species (mean only shown). The black line shows the mean ± standard deviation of all treatments. Error bars represent standard deviation of the mean.
Figure 3. Temporal changes in volatile solids composition components in Saccharina latissima ensiled over 12 months with different bacterial inocula, where the pH achieved was <4.7. Z: no bacterial addition, Lp: Lactobacillus plantarum, Lcc: Lactobacillus casei subspecies casei, Th: Tetragenococcus halophilus, M: An equal mix of the three bacterial species (mean only shown). The black line shows the mean ± standard deviation of all treatments. Error bars represent standard deviation of the mean.
Sustainability 16 11094 g003
Figure 4. The relationship between the organic acid content and the ensiling pH over the course of the 12-month storage. The dashed line shows trendline for all of the data.
Figure 4. The relationship between the organic acid content and the ensiling pH over the course of the 12-month storage. The dashed line shows trendline for all of the data.
Sustainability 16 11094 g004
Figure 5. Alpha diversity analysis (Richness, effective Shannon Entropy and Simpson Index) of the microbial 16S rRNA bacterial libraries for fresh seaweed epibiota (SE) and 4-, 8- and 12-month ensiled samples. Outlying data points plotted individually as dots.
Figure 5. Alpha diversity analysis (Richness, effective Shannon Entropy and Simpson Index) of the microbial 16S rRNA bacterial libraries for fresh seaweed epibiota (SE) and 4-, 8- and 12-month ensiled samples. Outlying data points plotted individually as dots.
Sustainability 16 11094 g005
Figure 6. Bray–Curtis community dissimilarity visualised by non-metric multidimensional scaling (NMDS) of bacterial communities. The 95% confidence interval group samples according to the months ensiled and treatment.
Figure 6. Bray–Curtis community dissimilarity visualised by non-metric multidimensional scaling (NMDS) of bacterial communities. The 95% confidence interval group samples according to the months ensiled and treatment.
Sustainability 16 11094 g006
Figure 7. Bacterial taxonomic bar plots of pre-ensiled (epibiota) and ensiled seaweed samples across 12 months of storage under different inoculation treatments. Plot (A): phylum (10 top taxa), and Plot (B): genus level (10 top taxa), shown in treatment block versus prior to ensiling and time ensiled (ensiled for 4, 8 or 12 months) SE: Seaweed epibiota (pre-ensiled)—ensiling inocula Lp: L. plantarum, Lc: L. casei subspecies casei, Th: T. halophilus. M: An equal mix of the 3 inoculum species and a control. Z: no bacterial addition.
Figure 7. Bacterial taxonomic bar plots of pre-ensiled (epibiota) and ensiled seaweed samples across 12 months of storage under different inoculation treatments. Plot (A): phylum (10 top taxa), and Plot (B): genus level (10 top taxa), shown in treatment block versus prior to ensiling and time ensiled (ensiled for 4, 8 or 12 months) SE: Seaweed epibiota (pre-ensiled)—ensiling inocula Lp: L. plantarum, Lc: L. casei subspecies casei, Th: T. halophilus. M: An equal mix of the 3 inoculum species and a control. Z: no bacterial addition.
Sustainability 16 11094 g007
Table 1. Summary of destructive ensiled samples including details on treatment and replication.
Table 1. Summary of destructive ensiled samples including details on treatment and replication.
Number of Replicates
Inoculum Treatment4 Months8 Months12 Months
Lactiplantibacillus plantarum 6105 (Lp)4 44
Lactobacillus casei 11970 (Lc)444
Tetragenococcus halophilus 9477 (Th)444
Mix of all 3 inoculums (M, at 1:1:1 ratio)444
No treatment (Z)555
Table 2. Statistical analysis of the composition of the seaweed after 12 months of ensiling comparing the different inoculums used. * indicates a significant difference at p = 0.05 level. Letters in the pairwise comparison column denote significant post hoc differences. Those treatments with different letters are significantly different at p < 0.05.
Table 2. Statistical analysis of the composition of the seaweed after 12 months of ensiling comparing the different inoculums used. * indicates a significant difference at p = 0.05 level. Letters in the pairwise comparison column denote significant post hoc differences. Those treatments with different letters are significantly different at p < 0.05.
Tukey’s Pair-Wise Comparison
VariabledfMSFP ZLpLccThM
Ash4, 150.0002232.370.096
Lipid4, 160.0000140.510.727
polyphenols4, 16<0.000010.790.548 ABBBAB
protein4, 160.0060956.500.003*BABABB
Mannitol4, 160.0001587.190.002*
Alginate4, 160.0000790.230.915
Laminarian4, 160.0000390.250.903
Cellulose4, 160.0000030.250.903
Fucoidan4, 160.0000040.230.919
Lactic Acid4, 160.0000190.840.519
Acetic Acid4, 160.0000030.280.884
Propanoic Acid4, 160.0000030.140.965
Butyric Acid4, 160.0000020.500.734
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Ditchfield, A.K.; Kerrison, P.D.; Mair, A.; Hurst, G.; Green, D.H.; Stanley, M.S.; Fedenko, J.; Hughes, A.D. The Storage and Production of Bioenergy Using Macroalgae Biomass—Part I: Ensiling. Sustainability 2024, 16, 11094. https://doi.org/10.3390/su162411094

AMA Style

Ditchfield AK, Kerrison PD, Mair A, Hurst G, Green DH, Stanley MS, Fedenko J, Hughes AD. The Storage and Production of Bioenergy Using Macroalgae Biomass—Part I: Ensiling. Sustainability. 2024; 16(24):11094. https://doi.org/10.3390/su162411094

Chicago/Turabian Style

Ditchfield, Arlene K., Philip D. Kerrison, Alison Mair, George Hurst, David H. Green, Michele S. Stanley, Jeffrey Fedenko, and Adam D. Hughes. 2024. "The Storage and Production of Bioenergy Using Macroalgae Biomass—Part I: Ensiling" Sustainability 16, no. 24: 11094. https://doi.org/10.3390/su162411094

APA Style

Ditchfield, A. K., Kerrison, P. D., Mair, A., Hurst, G., Green, D. H., Stanley, M. S., Fedenko, J., & Hughes, A. D. (2024). The Storage and Production of Bioenergy Using Macroalgae Biomass—Part I: Ensiling. Sustainability, 16(24), 11094. https://doi.org/10.3390/su162411094

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop