Assessing the Genetic Divergence of Onion (Allium Cepa L.) through Morpho-Physiological and Molecular Markers
Abstract
1. Introduction
2. Materials and Methods
2.1. Plant. Materials and Field Experiment
2.2. Estimation of Biochemical Parameter
2.3. DNA Extraction and SSR Analysis
2.4. Statistical Analysis
3. Results and Discussion
3.1. Mean Performance of the Genotypes and Genetic Variability Studies
3.2. Genetic Divergence through Multivariate Analysis
3.3. Genetic Divergence Study at Molecular Level
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Khosa, J.S.; McCallum, J.; Dhatt, A.S.; Macknight, R. Enhancing onion breeding using molecular tools. Plant. Breed. 2016, 135, 9–20. [Google Scholar] [CrossRef]
- Murthy, B.N.S. This is How India can Make Sure Onions are Available Throughout the Year and at Good Price. 2019. Available online: https://theprint.in/opinion/how-india-can-ensure-onions-are-all-through-year-at-good-price/334477/ (accessed on 7 December 2021).
- Goldman, I.L. Molecular breeding of healthy vegetables. EMBO Rep. 2011, 12, 96–102. [Google Scholar] [CrossRef] [PubMed]
- Bonciu, E. Evaluation of cytotoxicity of the herbicide Galigan 240 EC to plants. Sci. Pap. Ser. A Agron. 2018, 61, 175–178. [Google Scholar]
- Bonciu, E. Some observations on the genotoxicity of the yellow food dye in Allium cepa meristematic cells. Banat. J. Biotechnol. 2019, 10, 46–50. [Google Scholar] [CrossRef]
- Jayaswall, K.; Bhandawat, A.; Sharma, H.; Yadav, V.K.; Mahajan, V.; Singh, M. Characterization of Allium germplasms for conservation and sustainable management using SSR markers. IndianJ.Tradit. Knowl. 2019, 18, 193–199. [Google Scholar]
- Rivera, A.; Mallor, C.; Garces-Claver, A.; García-Ulloa, A.; Pomar, F.; Silvar, C. Assessing the genetic diversity in onion (Allium cepa L.) landraces from northwest Spain and comparison with the European variability. New Zealand J. Crop. Hortic. Sci. 2016, 44, 103–120. [Google Scholar] [CrossRef]
- McCallum, J.; Thomson, S.; Pither-Joyce, M.; Kenel, F.; Clarke, A.; Havey, M.J. Genetic Diversity Analysis and Single-nucleotide Polymorphism Marker Development in Cultivated Bulb Onion Based on Expressed Sequence Tag–Simple Sequence Repeat Markers. J. Am. Soc. Hortic. Sci. 2008, 133, 810–818. [Google Scholar] [CrossRef]
- Rodriguez, J.M.; Berke, T.; Engle, L.; Nienhuis, J. Variation among and within Capsicum species revealed by RAPD markers. Theor. Appl. Genet. 1999, 99, 147–156. [Google Scholar] [CrossRef]
- Bennett, M.D.; Leitch, I.J. Nuclear DNA Amounts in Angiosperms. Ann. Bot. 1995, 76, 113–176. [Google Scholar] [CrossRef]
- Rouamba, A.; Sandmeier, M.; Sarr, A.; Ricroch, A. Allozyme variation within and among populations of onion (Allium cepa L.) from West Africa. Theor. Appl. Genet. 2001, 103, 855–861. [Google Scholar] [CrossRef]
- Khar, A.; Lawande, K.E.; Negi, K.S. Microsatellite marker based analysis of genetic diversity in short day tropical Indian onion and cross amplification in related Allium spp. Genet. Resour. Crop. Evol. 2011, 58, 741–752. [Google Scholar] [CrossRef]
- Baldwin, S.; Pither-Joyce, M.; Wright, K.; Chen, L.; McCallum, J. Development of robust genomic simple sequence repeat markers for estimation of genetic diversity within and among bulb onion (Allium cepa L.) populations. Mol. Breed. 2012, 30, 1401–1411. [Google Scholar] [CrossRef]
- Mallor, C.; Arnedo-Andrés, M.; Garces-Claver, A. Assessing the genetic diversity of Spanish Allium cepa landraces for onion breeding using microsatellite markers. Sci. Hortic. 2014, 170, 24–31. [Google Scholar] [CrossRef]
- Mitrova, K.; Svoboda, P.; Ovesná, J. The selection and validation of a marker set for the differentiation of onion cultivars from the Czech Republic. Czech. J. Genet. Plant. Breed. 2015, 51, 62–67. [Google Scholar] [CrossRef]
- Tandon, H.L.S. Methods of Analysis of Soils, Plants, Waters and Fertilizers; Fertilizer Development and Consultation Organization: New Delhi, India, 1993. [Google Scholar]
- Walter, W.M.; Purcell, A.E. Evaluation of several methods for analysis of sweet potato phenolics. J. Agric. Food Chem. 1979, 27, 942–946. [Google Scholar] [CrossRef] [PubMed]
- Sadasivam, S.; Balasubramanian, T. Practical Manual in Biochemistry; Tamil Nadu Agricultural University: Coimbatore, India, 1987; p. 14. [Google Scholar]
- Doyle, J.J.; Doyle, J.L. A rapid DNA isolation procedure for small quantities of fresh leaf tissue. Phytochem. Bull. 1987, 19, 11–15. [Google Scholar]
- Harn, C.H.; Hur, C.-G.; Kim, J.E.; Kim, K.-H.; Song, K.H.; Hyun, J.Y.; Lee, H.-R.; Kim, H.-J. Marker Development for Onion Genetic Purity Testing using SSR Finder. Korean J. Breed. Sci. 2012, 44, 421–432. [Google Scholar] [CrossRef]
- Karic, L.; Golzardi, M.; Glamoclija, P.; Sutkovic, J. Genetic diversity assessment of Allium cepa L. cultivars from Bosnia and Herzegovina using SSR makers. Genet. Mol. Res. 2018, 17, 16039870. [Google Scholar] [CrossRef]
- Fisher, R.A.; Yates, F. Statistical Tables for Biological, Agricultural and Medical Research, 4th ed.; Oliver & Boyd: Edinburgh, UK, 1953. [Google Scholar] [CrossRef]
- Singh, R.K.; Chaudhary, B.D. Biometrical Methods in Quantitative Genetic Analysis. Biom. Methods Quant. Genet. Anal. 1977, 34, 723. [Google Scholar] [CrossRef][Green Version]
- Mahalanobis, P.C. On the generalized distance in Statistics. Proc. Natl. Acad. Sci. India Sect. B Biol. Sci. 1936, 2, 49–55. [Google Scholar]
- Banfield, C.F. Multivariate analysis in genstat. J. Stat. Comput. Simul. 1978, 6, 211–222. [Google Scholar] [CrossRef]
- Sehgal, D.; Rajpal, V.R.; Raina, S.N.; Sasanuma, T.; Sasakuma, T. Assaying polymorphism at DNA level for genetic diversity diagnostics of the safflower (Carthamus tinctorius L.) world germplasm resources. Genetics 2009, 135, 457–470. [Google Scholar] [CrossRef] [PubMed]
- Prevost, A.; Wilkinson, M.J. A new system of comparing PCR primers applied to ISSR fingerprinting of potato cultivars. Theor. Appl. Genet. 1999, 98, 107–112. [Google Scholar] [CrossRef]
- Jaccard, P. Nouvelles recherches sur la distribution florale. Bull. Société Vaud. Sci. Nat. 1908, 44, 223–270. [Google Scholar] [CrossRef]
- Dhotre, M. Studies on Genetic Diversity and Influence of Nitrogen Sources on Performance of Kharif Onion (Allium cepa var. Cepa L.). Master’s Thesis, University of Agricultural Sciences, Dharwad, India, 2009. [Google Scholar]
- Singh, R.K.; Dubey, B.K. Studies on genetic divergence in onion advance lines. Indian J. Hort. 2011, 68, 123–127. [Google Scholar]
- Golani, I.J.; Vaddoria, M.A.; Mehta, D.R.; Naliyadhara, M.V.; Dobariya, K.L. Analysis of yield components in onion. Indian J. Agric. Res. 2006, 40, 224–227. [Google Scholar]
- Akter, M.S.; Biswas, A.; Siddique, S.S.; Hossain, S.; Ivy, N.A. Estimation of Genetic Diversity in Onion (Allium cepa L.). Agriculture 2015, 13, 26–34e. [Google Scholar] [CrossRef]
- Arya, J.S.; Singh, N.; Arya, P.S.; Kant, A. Morphological variations and relationship among onion germplasm for quantitative and qualitative traits at trans-Himalaya Ladakh, India. Aust. J. Crop. Sci. 2017, 11, 329–337. [Google Scholar] [CrossRef]
- Hanci, F.; Gokçe, A.F. Molecular characterization of Turkish onion germplasm using SSR markers. Czech. J. Genet. Plant. Breed. 2016, 52, 71–76. [Google Scholar] [CrossRef]
Sources of Variation | Year | Genotypes | Year × Genotypes | Pooled Error | |
---|---|---|---|---|---|
Characteristics | |||||
Plant height (cm) | 33.539 | 25.640 ** | 1.376 | 0.719 | |
No. of leaves | 147.253 | 28.169 ** | 2.494 | 0.163 | |
Polar diameter (mm) | 31.039 | 185.530 ** | 36.679 | 0.738 | |
Equatorial diameter (mm) | 33.878 | 83.747 ** | 29.201 | 0.847 | |
Neck thickness (mm) | 5.305 | 19.939 ** | 1.286 | 0.508 | |
No. of scales | 0.972 | 7.313 ** | 1.680 | 0.390 | |
Days to maturity | 132.300 | 551.621 ** | 27.774 | 3.368 | |
Grade ‘A’ bulbs | 12.662 | 40.806 ** | 0.831 | 71.978 | |
Grade ‘B’ bulbs | 19.200 | 51.603 ** | 1.759 | 0.932 | |
Grade ‘C’ bulbs | 12.040 | 43.816 ** | 2.897 | 0.910 | |
Individual bulb weight (g) | 7.757 | 53.477 ** | 0.587 | 3.323 | |
Marketable bulb/plot | 133.753 | 381.131 ** | 11.723 | 8.368 | |
Marketable yield (kg/plot) | 0.823 | 1.339 ** | 0.050 | 0.023 | |
Total yield (kg/plot) | 1.514 | 1.221 ** | 0.071 | 0.025 | |
Total yield (q/ha) | 1711.81 | 1355.951 ** | 77.076 | 27.315 | |
TSS (Brix) | 6.385 | 3.312 ** | 2.386 | 0.340 | |
Dry matter content of bulb (%) | 21.118 | 11.214 ** | 15.782 | 0.120 | |
Pungency (S %) | 0.010 | 0.059 ** | 0.005 | 0.000 | |
Total phenol (mg/100 g) | 21.914 | 16.825 ** | 1.177 | 0.092 | |
Vitamin C (mg/100 g) | 27.956 | 13.393 ** | 18.181 | 0.043 |
Character | Mean | Range | GCV (%) | PCV (%) | Heritability (%) | GA as (%) of mean |
---|---|---|---|---|---|---|
Plant height (cm) | 52.15 | 49.28–56.07 | 3.90 | 4.09 | 91.00 | 7.66 |
Number of leaves | 11.09 | 7.39–15.47 | 19.48 | 19.64 | 98.00 | 39.79 |
Polar diameter (mm) | 50.05 | 39.43–60.16 | 11.09 | 11.16 | 99.00 | 22.70 |
Equatorial diameter (mm) | 56.05 | 49.88–62.05 | 6.64 | 6.71 | 98.00 | 13.54 |
Neck thickness (mm) | 8.30 | 5.55–12.66 | 21.65 | 22.57 | 92.00 | 42.77 |
Number of scales | 10.65 | 8.60–12.20 | 10.01 | 11.06 | 82.00 | 18.67 |
Days to maturity | 126.40 | 110–151.5 | 7.56 | 7.64 | 98.00 | 15.39 |
Grade ‘A’ bulbs | 43.26 | 37.00–46.67 | 5.87 | 6.28 | 87.00 | 11.29 |
Grade ‘B’ bulbs | 42.97 | 36.67–46.67 | 6.70 | 7.07 | 90.00 | 13.09 |
Grade ‘C’ bulbs | 42.10 | 35.83–45.33 | 6.28 | 6.68 | 89.00 | 12.18 |
Individual bulb weight (g) | 53.23 | 48.74–59.30 | 29.28 | 29.37 | 99.00 | 60.15 |
Marketable bulb/plot | 128.46 | 109.55–138.56 | 16.07 | 16.47 | 88.00 | 11.72 |
Marketable yield (kg/plot) | 6.84 | 6.21–8.02 | 16.79 | 17.15 | 90.00 | 23.28 |
Total yield (kg/plot) | 7.02 | 6.45–8.24 | 6.30 | 6.69 | 89.00 | 12.24 |
TSS (Brix) | 11.43 | 10.58–13.27 | 6.13 | 7.18 | 73.00 | 10.77 |
Dry matter content of bulbs (%) | 15.15 | 12.88–17.61 | 18.93 | 19.22 | 94.00 | 27.84 |
Pungency (S%) | 0.54 | 0.42–0.73 | 18.35 | 18.51 | 98.00 | 37.48 |
Total phenol (mg/100 g) | 6.74 | 3.63–9.66 | 24.78 | 24.98 | 98.00 | 50.62 |
Vitamin C (mg/100 g) | 7.03 | 4.71–9.79 | 21.19 | 21.36 | 98.00 | 43.29 |
Component | Eigen Value (Root) | Percent Variation Extracted | Cumulative Variation Explained |
---|---|---|---|
PC-I | 4.76799 | 22.70472 | 22.70472 |
PC-II | 4.09322 | 19.49150 | 42.19622 |
PC-III | 2.95169 | 14.05568 | 56.25190 |
PC-IV | 2.06959 | 9.85521 | 66.10711 |
PC-V | 1.79821 | 8.56291 | 74.67001 |
PC-VI | 1.75612 | 8.36246 | 83.03246 |
PC-VII | 1.01696 | 4.84268 | 87.87514 |
Sl No. | Marker Name | Sequence (5′–3′) | TSB a | NTB | PIC | MI | DI | RP |
---|---|---|---|---|---|---|---|---|
1 | ACM 004 | F-TCGTTCTTTAGAACACGTTAGG | ||||||
R-GTCGGCGGATATAGTGACA | 15 | 2 | 0.37 | 6.93 | 0.81 | 1.1 | ||
2 | ACM 018 | F-GGGGAATGGTGGAGAATAGA | ||||||
R-AACAGAGGCAAGAGGAGCG | 19 | 2 | 0.5 | 9.38 | 0.77 | 1.9 | ||
3 | ACM 046 | F-TCCTCGTCACCACCACAG | ||||||
R-CTGAAAGGGAGTAGCGGAG | 19 | 2 | 0.47 | 8.81 | 0.76 | 1.5 | ||
4 | ACM 068 | F-GAAGGTGAAGGTGTACGGT | ||||||
R-CAAATGGCTGCAATAAGCAA | 14 | 2 | 0.41 | 7.73 | 0.86 | 1.4 | ||
5 | ACM 187 | F-GTACTCGGGCAGTGGAGGTA | ||||||
R-GGAGCTGTCCAAATGCTAGG | 21 | 2 | 0.4 | 7.49 | 0.67 | 1.1 | ||
6 | ACM 240 | F-GTGCAACTCCAAGAGAAGGG | ||||||
R-AATATAAAGGCGTTGGCCTG | 20 | 2 | 0.42 | 7.92 | 0.71 | 1.2 | ||
7 | ACM 318 | F-TCCTCCTTCCAAACCACATC | ||||||
R-GATCAGAAACAGCAGCGTC | 18 | 2 | 0.42 | 7.82 | 0.76 | 1.2 | ||
8 | ACM 326 | F-AAACCAGCAACAACCAATG | ||||||
R-AAAATTGGAGAGCAGGCAAA | 20 | 2 | 0.4 | 11.21 | 0.87 | 1.8 | ||
9 | gSSR 6 | F-CAAGAGGCCAATCATGTGATAA | ||||||
R-AGGCTTTGATGCTGTTTTTGAT | 20 | 2 | 0.48 | 9.05 | 0.74 | 1.6 | ||
10 | gSSR 11 | F-ATGGCTCAAACTTGCGTTATTT | ||||||
R-GCCTTAACATTTTCCAACTTCG | 23 | 2 | 0.39 | 7.3 | 0.62 | 1.1 | ||
11 | gSSR 38 | F- AAACGAAGAGTCGCGATGTTAT | ||||||
R-CGTAATTTCCTTCTTCAAACGG | 22 | 2 | 0.5 | 9.33 | 0.7 | 1.8 | ||
12 | gSSR 39 | F-AGCCCACTAATTCATGCTTGTT | ||||||
R-ACATTAATGACCAAGTGTTGCG | 22 | 2 | 0.5 | 9.33 | 0.7 | 1.8 | ||
13 | gSSR 50 | F-GAAGAGGGAGTGATATGGCAAC | ||||||
R-ATTTTCCCAAAGTTCATTGCAT | 21 | 2 | 0.5 | 9.38 | 0.72 | 1.9 | ||
14 | eSSR 6 | F-GATTCCTGGTTGAAGTCAGAGG | ||||||
R-CTCACTTCTCTTTCGCCTCAAT | 17 | 2 | 0.49 | 9.19 | 0.82 | 1.7 | ||
15 | eSSR 20 | F-GGAGGAAAGGGAAAGAAAGAAA | ||||||
R-AAGAGAAAAAGGAAGAAGCGGT | 20 | 2 | 0.5 | 9.33 | 0.75 | 1.8 | ||
16 | AMS 16 | F-CTGCATTAAAACAACCAAACTTG | ||||||
R-GAGCTCCACTTCTTCCAAACTAG | 20 | 2 | 0.5 | 9.33 | 0.75 | 1.8 | ||
Mean | 19.44 | 2.06 | 0.45 | 8.72 | 0.75 | 1.54 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Raj, A.C.; Sharangi, A.B.; Das, A.; Pramanik, K.; Upadhyay, T.K.; Almutairi, M.; Khan, M.I.; Ahmad, I.; Kausar, M.A.; Saeed, M. Assessing the Genetic Divergence of Onion (Allium Cepa L.) through Morpho-Physiological and Molecular Markers. Sustainability 2022, 14, 1131. https://doi.org/10.3390/su14031131
Raj AC, Sharangi AB, Das A, Pramanik K, Upadhyay TK, Almutairi M, Khan MI, Ahmad I, Kausar MA, Saeed M. Assessing the Genetic Divergence of Onion (Allium Cepa L.) through Morpho-Physiological and Molecular Markers. Sustainability. 2022; 14(3):1131. https://doi.org/10.3390/su14031131
Chicago/Turabian StyleRaj, Akkabathula Chandini, Amit Baran Sharangi, Arpita Das, Krishnendu Pramanik, Tarun Kumar Upadhyay, Malak Almutairi, Mohammad Idreesh Khan, Irfan Ahmad, Mohd Adnan Kausar, and Mohd Saeed. 2022. "Assessing the Genetic Divergence of Onion (Allium Cepa L.) through Morpho-Physiological and Molecular Markers" Sustainability 14, no. 3: 1131. https://doi.org/10.3390/su14031131
APA StyleRaj, A. C., Sharangi, A. B., Das, A., Pramanik, K., Upadhyay, T. K., Almutairi, M., Khan, M. I., Ahmad, I., Kausar, M. A., & Saeed, M. (2022). Assessing the Genetic Divergence of Onion (Allium Cepa L.) through Morpho-Physiological and Molecular Markers. Sustainability, 14(3), 1131. https://doi.org/10.3390/su14031131